ID: 1166865455

View in Genome Browser
Species Human (GRCh38)
Location 19:45833663-45833685
Sequence ATCAGAACACTGGTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 16, 3: 50, 4: 362}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166865455 Original CRISPR ATCAGAACACTGGTTTTCTC TGG Intronic
900836327 1:5007205-5007227 ATTAGAACAATGGTTGTCACTGG - Intergenic
900928680 1:5721971-5721993 ATCAGAGCACTGCATTTCTCTGG + Intergenic
900930764 1:5735513-5735535 AGCAGAACACTGATTTCTTCCGG + Intergenic
901203705 1:7481997-7482019 ATCAGAACAGTGGTGGCCTCTGG - Intronic
903088283 1:20883798-20883820 ATCAGAAGACTAGTTTTCACTGG + Intronic
903373355 1:22850850-22850872 AGCAGAAGGCTGGTGTTCTCAGG + Intronic
903865107 1:26392175-26392197 GGCAGAACAGTGGATTTCTCTGG + Intergenic
903893312 1:26584947-26584969 ATCAGAACAGTGATTGCCTCTGG - Intergenic
904458665 1:30662599-30662621 TTCAGAACCGTGGTGTTCTCTGG - Intergenic
906015976 1:42579998-42580020 TTCAGGATATTGGTTTTCTCTGG + Intronic
906369340 1:45239357-45239379 ATCAGAACAGTGGTTCTCTCTGG + Intronic
906652424 1:47522132-47522154 ATTACAACACTGGTATTTTCTGG + Intergenic
906928064 1:50140305-50140327 ATCAGAACACTTGCTTCCTCAGG - Intronic
907362587 1:53931112-53931134 ATCAGAGCACTGGTTGCCTAAGG - Intronic
907558050 1:55362321-55362343 TTCAGGACAGTGGTTTCCTCTGG + Intergenic
907986853 1:59540526-59540548 ATCTGGACAGTGGTTATCTCTGG + Intronic
908823442 1:68111919-68111941 AGCAGAAAACTGGCTTGCTCTGG + Intronic
909081577 1:71118746-71118768 ATCAGCACAGTGGTTTTTTCTGG - Intergenic
909084322 1:71153820-71153842 ATTAGAAGACTGCCTTTCTCTGG - Intergenic
910024118 1:82628475-82628497 ATCAGGAGACTGCTTTTCCCTGG + Intergenic
910165915 1:84327409-84327431 ATCAGAACAGGGGTTGCCTCTGG + Intronic
910493437 1:87798688-87798710 ATTAGGACACTGGCTTTCTATGG - Intergenic
910501702 1:87899964-87899986 ATCAGAACTTTGCTTTCCTCTGG + Intergenic
911688616 1:100805914-100805936 ATCAGAACCCCACTTTTCTCTGG + Intergenic
912619290 1:111139599-111139621 ATTAGACCGCTGATTTTCTCCGG + Exonic
912768658 1:112441216-112441238 ATCAGAAGAGTGGTTTCCTCTGG - Intronic
913393458 1:118340254-118340276 AACAGAACTCTGCTGTTCTCAGG + Intergenic
913395144 1:118361315-118361337 ATCAGAACGGCGGTTGTCTCTGG + Intergenic
916288677 1:163139410-163139432 ATCAGAACACCCTTTGTCTCTGG + Intronic
916608538 1:166366821-166366843 ATGAGCACAATGGTGTTCTCTGG - Intergenic
918056545 1:181026324-181026346 ATCAAAACAGTGGTTGTCTTGGG + Intergenic
918452992 1:184678102-184678124 ATGTTAACACTGATTTTCTCTGG - Intergenic
919090468 1:192972889-192972911 ATCAGATCAGTGGTTTTCAGGGG - Intergenic
919605877 1:199683337-199683359 ACCAGAACAGTGGTTTACTTGGG + Intergenic
920982886 1:210854822-210854844 AGCAGAACATTTGTGTTCTCTGG - Intronic
921180437 1:212627505-212627527 TTCAGGACAGTGGTTTTCTCTGG + Intergenic
921505085 1:215958213-215958235 AAAAGGACACTGGATTTCTCTGG + Intronic
921586913 1:216957950-216957972 ATCAGAACATTGGTTTCCTCTGG - Intronic
921903176 1:220469319-220469341 ATCAAAACACTGGTTTTTAATGG - Intergenic
922599848 1:226841886-226841908 ATCAGAACAGTGGTTTCCTCTGG - Intergenic
1065210389 10:23396924-23396946 ATCAGAAAACTGGTTGTAACAGG + Intergenic
1065412749 10:25447974-25447996 ATCTGAACAGCGGTTATCTCTGG - Intronic
1065875156 10:29991513-29991535 ATCACAGCACTGGTTTTCCTGGG - Intergenic
1066344000 10:34564363-34564385 AACAGAACCCTGATTTTATCAGG + Intronic
1067142191 10:43667379-43667401 ATCAGCACAGTGGTTTTCCGAGG - Intergenic
1067742305 10:48904875-48904897 AACAGAACCTTGATTTTCTCAGG - Intronic
1069346457 10:67476378-67476400 ATAAGAACAGTGGGTGTCTCTGG - Intronic
1070634321 10:78111830-78111852 ATCAGAATAGTGGTTGCCTCTGG - Intergenic
1070653506 10:78254798-78254820 AGCAGAACACCTTTTTTCTCAGG + Intergenic
1071560326 10:86641686-86641708 ACCAGGACATTGGTTTTCTCAGG - Intergenic
1071712908 10:88067210-88067232 ATCAGAAGGCTGGTTCTCTCTGG + Intergenic
1071964631 10:90839765-90839787 ATAAAAACCCTGGTATTCTCTGG - Intronic
1072174877 10:92910437-92910459 ATCAGAACAGTGGTTACCTCTGG + Intronic
1072489706 10:95892569-95892591 AGATGAACACTGGTTTTGTCTGG + Intronic
1072653702 10:97315776-97315798 ATCAGAAGACTGGTTGCCTTTGG - Intergenic
1073954032 10:108847127-108847149 ATCAGAACAGTGGTTTTCTATGG + Intergenic
1075051784 10:119187615-119187637 ATTAGAGCAGTGGTTTCCTCTGG - Intergenic
1075429412 10:122368037-122368059 ATCAGAATAGTGGTTACCTCTGG + Intergenic
1076173963 10:128350947-128350969 AACAGAACATTGGTGATCTCTGG - Intergenic
1078773297 11:14371071-14371093 ATCAGAACAGTTGTTGGCTCAGG - Intergenic
1079557417 11:21776922-21776944 ATCAGAAGAGTGGTTGCCTCTGG - Intergenic
1080599944 11:33811537-33811559 GTCAGAACAGTGGTTCTCTTGGG - Intergenic
1081509092 11:43750248-43750270 GTCAGAATACTGGTTATCTCTGG - Intronic
1082924040 11:58527127-58527149 ATGCCAACACTGGTTTTCTTAGG - Exonic
1084994778 11:72965724-72965746 GTCAGAACAATGGTTATCTTGGG - Intronic
1085008583 11:73118414-73118436 GTCAGTACAGTGGTTTCCTCTGG - Intronic
1085483297 11:76840554-76840576 TTCAGAAGAATGGTTATCTCTGG - Intergenic
1087250726 11:95896193-95896215 ATGGGAGCACTGGTTTTGTCTGG - Intronic
1087321682 11:96668465-96668487 AGCAGAATAGTGGTTTTCTACGG - Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1087789896 11:102394649-102394671 ATCAGAAAATTGGCTTTGTCGGG + Intergenic
1088515779 11:110631868-110631890 ATCAGAATAGTGGTTACCTCTGG - Intronic
1089876607 11:121727788-121727810 ATCAGAACAGTGGTTGTGTCTGG - Intergenic
1090448085 11:126781403-126781425 ACCAAAACACTGGTTTCCCCTGG - Intronic
1091525126 12:1292492-1292514 TTTAGAAGACTGGTCTTCTCTGG + Intronic
1091951516 12:4596794-4596816 GTCAGAACACTAGATTTCTCTGG + Intronic
1092300608 12:7246186-7246208 GTCAGAACAATGGTTGTCCCTGG + Intergenic
1092956962 12:13560141-13560163 GTAAGAAGACTGGTTTTCTGGGG + Exonic
1093304649 12:17499270-17499292 CTCAGAATAATGGTTTTCTTTGG + Intergenic
1093774767 12:23060686-23060708 ATCAGACCAGTGGTTTCTTCTGG - Intergenic
1094158408 12:27362581-27362603 GTCAGAACAGTGGTTCTCTTCGG - Intronic
1094353192 12:29549356-29549378 ATCAGAACAGTGATTGCCTCAGG + Intronic
1095552622 12:43460903-43460925 ATCAGAATAGGAGTTTTCTCTGG + Intronic
1097937147 12:65265487-65265509 ATTAGAAAACTGCCTTTCTCTGG - Intergenic
1098516697 12:71385863-71385885 ATCAGAATAATCATTTTCTCTGG + Intronic
1099011647 12:77298236-77298258 ATCAGAATAGTGGTTGTTTCTGG + Intergenic
1099581882 12:84458734-84458756 ATCAGACCAGTGGTTGCCTCTGG - Intergenic
1100428322 12:94508152-94508174 ATCAGAATAGTGGCTATCTCTGG + Intergenic
1100668518 12:96783405-96783427 ATTAGAACAGTGGTTGTCTCTGG - Intronic
1100808170 12:98309849-98309871 AAGAGAACAGTGGTTGTCTCTGG + Intergenic
1102875991 12:116449178-116449200 ATCAGAACACTGTGTTTTCCTGG + Intergenic
1103429410 12:120869913-120869935 ATCTGAAAACTGGATTTCACTGG + Intronic
1104437544 12:128767779-128767801 ATCAAACCACTACTTTTCTCTGG + Intergenic
1106493360 13:30249691-30249713 ATCAGAACAGTGGTTACCTTTGG + Intronic
1107992329 13:45829684-45829706 GTCAGAACAGGGGTTATCTCTGG - Intronic
1108568656 13:51728045-51728067 ATGCCAACACTGGCTTTCTCTGG - Intronic
1108804380 13:54135757-54135779 ATAAGGACACTTGTTTTCTCTGG - Intergenic
1109848162 13:68024586-68024608 ATTAGAAAACTGCCTTTCTCTGG + Intergenic
1110390492 13:74968010-74968032 ATGAGAACACTGGTGCTTTCAGG - Intergenic
1112120277 13:96402589-96402611 ATAAGAAAAATGGTTTTCTCTGG - Intronic
1112699273 13:101986508-101986530 CTCAGAACACTCTTTTTCTTTGG - Intronic
1113508472 13:110832628-110832650 TCCAGAACCCTGGTTTTCACGGG - Intergenic
1113710629 13:112462012-112462034 ATCAGAACTCTCCTTTTCTTGGG - Intergenic
1113819681 13:113204196-113204218 ACCAGAACACTCCTCTTCTCAGG - Intronic
1114820927 14:26018606-26018628 TTCAGAACTCTGGATTTCTCTGG + Intergenic
1115111219 14:29825159-29825181 TTCAGAAGACAGATTTTCTCAGG + Intronic
1115722989 14:36183252-36183274 ATTAGAACAGTAGTTTCCTCTGG - Intergenic
1116035828 14:39626262-39626284 ATCAGAACAGTAGTTTTGACTGG - Intergenic
1116507961 14:45708827-45708849 ATCAGAACAGTGGTTGCCTGTGG - Intergenic
1116724010 14:48537619-48537641 ATCAGAACTGTACTTTTCTCAGG - Intergenic
1117241090 14:53834282-53834304 GTCAGAACAGTGGTTATATCTGG + Intergenic
1117629472 14:57675104-57675126 ACCAGAACAGTGCTTTCCTCTGG + Intronic
1117697585 14:58381613-58381635 TTCAGGATAGTGGTTTTCTCTGG + Intergenic
1119797583 14:77413185-77413207 ATCAGAACAATGATTTCTTCTGG - Intronic
1120952919 14:90059638-90059660 TTCTGAACAGTGGTTTTCTCTGG + Intergenic
1121132233 14:91458914-91458936 ATAAAAACACTGGTGTTTTCTGG + Intronic
1121432104 14:93894893-93894915 CTGAGAGCAGTGGTTTTCTCGGG - Intergenic
1121555433 14:94832959-94832981 ATCAGAGCAATGGTTATCTCGGG + Intergenic
1123427843 15:20187420-20187442 AGCAGAACAGTGGTGTTCTGTGG + Intergenic
1123485915 15:20738605-20738627 ATCAGAATAATGGTTATCTTTGG - Intergenic
1123542404 15:21307675-21307697 ATCAGAATAATGGTTATCTTTGG - Intergenic
1126224714 15:46257704-46257726 ATCAGATCATTGGTTGTCTGTGG + Intergenic
1126456923 15:48873248-48873270 ATCAGAACAGTGGTTATTTCTGG + Intronic
1127238157 15:57079233-57079255 ATCAGAATAGAGTTTTTCTCTGG + Intronic
1128077183 15:64834883-64834905 ATCAGAACAGAGGTTGTCTAAGG - Intergenic
1128209543 15:65885798-65885820 CACTGTACACTGGTTTTCTCTGG + Intronic
1129639167 15:77356087-77356109 TTCAGAACAGTGGTTCCCTCTGG + Intronic
1130713783 15:86311573-86311595 ACCAAAACCCGGGTTTTCTCCGG + Intronic
1131341773 15:91609084-91609106 GTCAGAATACTGGTTTCCTTTGG - Intergenic
1131421334 15:92308042-92308064 ATATGAAGACTGGTTTTCTTAGG + Intergenic
1131811290 15:96176268-96176290 ATCAGAATAATGGTTGTCTTTGG + Intergenic
1202950721 15_KI270727v1_random:34816-34838 ATCAGAATAATGGTTATCTTTGG - Intergenic
1133172399 16:3989359-3989381 ATCAGAACCTTGGTTTTTTGGGG + Intronic
1133525275 16:6599032-6599054 ATGTGAATAATGGTTTTCTCTGG + Intronic
1133856506 16:9554390-9554412 GTCAGAACAGTGGTTGCCTCTGG - Intergenic
1135239025 16:20786872-20786894 AACACAACACTGGTCCTCTCAGG + Intronic
1135569945 16:23541607-23541629 ATTTTAACACTGGTTATCTCTGG + Intronic
1136614878 16:31392566-31392588 ATCAGAAGAGTGGTTGTCTATGG - Intergenic
1136856453 16:33662341-33662363 AGCAGAACAGTGGTGTTCTGTGG - Intergenic
1137507991 16:49072911-49072933 ATTACAACAGTGGTTGTCTCCGG - Intergenic
1137993404 16:53183303-53183325 ATCAGAATAGTGGTTTGCTCTGG - Intronic
1138231624 16:55341549-55341571 ATGAAAACAGTGGTTATCTCTGG + Intergenic
1138302339 16:55942981-55943003 ATCAGAACAGTGGTTGCCTGCGG + Intronic
1138399958 16:56737537-56737559 ATCAGAATACTGGTTATCCTTGG - Intronic
1139174112 16:64666659-64666681 TTCAGAAAACGAGTTTTCTCAGG + Intergenic
1139381709 16:66536623-66536645 ATCAGAACCCGGGACTTCTCAGG - Intronic
1139903182 16:70344187-70344209 ATCAGAACAGTGGTTGCCTGGGG - Intronic
1140470291 16:75209994-75210016 ATCAGAACAGTGGTTGCTTCTGG - Intergenic
1140770512 16:78199522-78199544 ATGAGAACACTGGCTTTCCTGGG - Intronic
1141469081 16:84226327-84226349 ATCAGAACAGTGGCTGCCTCTGG + Intronic
1203118033 16_KI270728v1_random:1510818-1510840 AGCAGAACAGTGGTGTTCTGTGG - Intergenic
1142728803 17:1836550-1836572 ACCAGAACACTGGTTGCCTAGGG - Intronic
1142923277 17:3209845-3209867 AATAGAATAGTGGTTTTCTCTGG - Intergenic
1144038779 17:11390014-11390036 GGCAGAAGACTGGTGTTCTCAGG + Intronic
1144774869 17:17780383-17780405 TTCAGAAAACTGGTTTTCTTGGG - Intronic
1145756247 17:27392425-27392447 ATCAGAACAATGGTTGCCTCTGG - Intergenic
1146779462 17:35655351-35655373 ATCAGAACAGTGGTAATCTCTGG - Intronic
1148328431 17:46797915-46797937 AACAAAAAACTGGTTTTCCCAGG - Intronic
1148709820 17:49670491-49670513 ATCAGAATACTGTTATTATCTGG + Intronic
1148718840 17:49736023-49736045 CTCATAACATTGGTTATCTCTGG - Intronic
1150020683 17:61609403-61609425 TTAATAACAATGGTTTTCTCCGG + Intergenic
1151157296 17:72134415-72134437 ATCAGACCAGTGGTTGTCTATGG - Intergenic
1152060401 17:78069375-78069397 ATCAAAACGCTGGCTTTCTGTGG - Intronic
1155525168 18:26708640-26708662 GTCAGAACACTGGTTGTCTCTGG - Intergenic
1155739220 18:29266134-29266156 ATCAGAATACTGTTTTGCTTTGG + Intergenic
1155872894 18:31049169-31049191 AGCAGAACACTGGTTGCCCCAGG - Intergenic
1156062412 18:33096249-33096271 ATCAGAAAACTGGTTCTTTTTGG + Intronic
1156515336 18:37674473-37674495 ATCATATCACTGGCTTTCTAGGG + Intergenic
1156845734 18:41663482-41663504 TTCAGCACACTGATTTTTTCTGG - Intergenic
1156950843 18:42895887-42895909 CTGATAACAGTGGTTTTCTCTGG + Intronic
1157882350 18:51332498-51332520 TTCAGAACAGTGGTTACCTCTGG - Intergenic
1159247638 18:65830043-65830065 TTCATAACAATGTTTTTCTCAGG + Intronic
1166570095 19:43790146-43790168 TTCAGAATACTGGTTATCTCTGG - Intergenic
1166865455 19:45833663-45833685 ATCAGAACACTGGTTTTCTCTGG + Intronic
927419485 2:22915424-22915446 TTCAGAAAGATGGTTTTCTCAGG - Intergenic
927790643 2:26006703-26006725 ATTAGAACCCTGGTTTTCCTTGG - Intergenic
927923553 2:26992895-26992917 AACAGAACACTGGATTTCTCAGG - Intronic
928101781 2:28442046-28442068 ATCAGAACGTTGGTTGCCTCAGG - Intergenic
928618296 2:33061486-33061508 ATCAGAAGAGTGGTTGTCTCTGG - Intronic
928712604 2:34024137-34024159 ATGACAACCCTGGCTTTCTCGGG + Intergenic
932088296 2:68782000-68782022 ATCAGAACCTTGTCTTTCTCTGG + Intronic
933510952 2:83240972-83240994 AATAGAACACTTGTTTTCCCTGG - Intergenic
933936432 2:87207616-87207638 ATCAGGAAACTGCCTTTCTCTGG + Intergenic
935596459 2:104882186-104882208 ATCAGAAAGCTGATTTTGTCAGG - Intergenic
936356717 2:111758213-111758235 ATCAGGAAACTGCCTTTCTCTGG - Intergenic
936688165 2:114853140-114853162 GTCAGAATAGTGGTTATCTCTGG + Intronic
937380176 2:121369361-121369383 ATCTTAACAGAGGTTTTCTCTGG + Intronic
937718434 2:125061863-125061885 TTCAGCACACTCATTTTCTCAGG + Intergenic
939611305 2:144314363-144314385 ATCAGAACACTAGCTGTCTGTGG + Intronic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
940596018 2:155794477-155794499 TTCAGAATAGTGATTTTCTCAGG - Intergenic
941266913 2:163373727-163373749 AACAGAACCCTGGGGTTCTCCGG + Intergenic
941900219 2:170671011-170671033 TTCAGTACACTGGGATTCTCTGG + Intergenic
942121154 2:172778920-172778942 TTGAGAACACTGGTATTCTGAGG + Intronic
942179607 2:173367361-173367383 GTCAGAAGAGTGGTTATCTCTGG + Intronic
942617034 2:177802663-177802685 ATCAGAACACTGGTTGTGTCTGG + Intronic
942855988 2:180548677-180548699 ATCCTAACTCTGCTTTTCTCTGG - Intergenic
943512887 2:188848141-188848163 GTCAGAATACTGGTTGTCTGTGG + Intergenic
943951656 2:194136619-194136641 ATCAGAGCACTGTTTGCCTCTGG + Intergenic
944313877 2:198264809-198264831 ATCAGAACTCCAGTTTTCTTTGG - Intronic
944359408 2:198835155-198835177 ATTAGAACAGTGGTTTCCACTGG + Intergenic
944427312 2:199596780-199596802 ATCAGAAGACTGGCTGTCTTAGG + Intergenic
945546711 2:211163164-211163186 ATCAGAACAATGATTGTCTCTGG - Intergenic
946338304 2:219053123-219053145 CCCAGAATAATGGTTTTCTCTGG + Intergenic
946768999 2:223068774-223068796 AGCAGATCAGTGGTTTTCTAAGG - Intronic
948213251 2:236210498-236210520 ATCACAAAGGTGGTTTTCTCAGG - Intronic
1169026162 20:2373389-2373411 ATCAGAACAGTGGTTGCCTTTGG - Intergenic
1169180194 20:3558084-3558106 ATCAGGATACAGGTTATCTCTGG - Intronic
1169837798 20:9899739-9899761 ATCTGAACACTGATTGTTTCTGG - Intergenic
1169921376 20:10737483-10737505 ATCAGAACATTGGTTACCTGGGG - Intergenic
1170541230 20:17390223-17390245 ATCAGAACAGTGGTTGCCTAAGG + Intronic
1171510677 20:25681611-25681633 ATCCGAATAGTGATTTTCTCTGG + Intronic
1172268006 20:33633681-33633703 ATCAGGAGACTGGTTTCCTCTGG + Intronic
1173142802 20:40499002-40499024 CTCAGATCACTTATTTTCTCTGG + Intergenic
1175447598 20:59034486-59034508 ATCAAAACACTGGTTTTTAATGG + Exonic
1175795974 20:61770950-61770972 ATGCACACACTGGTTTTCTCTGG - Intronic
1175858998 20:62139669-62139691 ATCAGAAAACTGATTTATTCTGG - Intronic
1177838623 21:26212662-26212684 ATCACAACTCTGATTTTCTCTGG - Intergenic
1177876155 21:26633891-26633913 ATCAGAACAATGGCTATCTATGG - Intergenic
1178076934 21:29021047-29021069 ATCAGAACAGTGGTTACCTTTGG - Intergenic
1178605508 21:34033258-34033280 ATCAGAACACTGGTTGTCTGGGG - Intergenic
1178685572 21:34708075-34708097 TTATGAACACTGGTTTTCTGAGG - Intronic
1179047460 21:37859392-37859414 CTCATAACAGTGGTTGTCTCTGG + Intronic
1180010235 21:45044667-45044689 TTCAGAACAGTGGTTTCTTCTGG + Intergenic
1180165599 21:46024777-46024799 ATGAAAATAATGGTTTTCTCTGG + Intergenic
1182382117 22:29899746-29899768 ATCAGAATAATGGTTATCTTTGG + Intronic
1182398185 22:30052347-30052369 ATCAGAATAATGGTTACCTCCGG - Intergenic
1183051766 22:35268249-35268271 ATCAGAACAGTTGTTGGCTCTGG - Intronic
1183107680 22:35626791-35626813 ATCAGGACAGTGGTTGTCTCTGG - Intronic
949500924 3:4679373-4679395 ATCACACCACTGGCTTTCCCGGG - Intronic
949596931 3:5557891-5557913 ATGAGAACTCTGGTTCTCTCTGG - Intergenic
950018946 3:9772844-9772866 ATGTGAACACTGGTTGTCTCTGG - Intronic
950819210 3:15740199-15740221 ATCAGAACAGTGGTTGCCTCTGG + Intronic
950891360 3:16407737-16407759 ATTAAAACACTTGTGTTCTCAGG + Intronic
951041978 3:17998095-17998117 AACAAAACACTCATTTTCTCAGG - Intronic
951085194 3:18504350-18504372 ATCAGGACAATGGTTGGCTCTGG - Intergenic
951166297 3:19487931-19487953 ATTATATCAATGGTTTTCTCGGG + Intronic
951864331 3:27290926-27290948 ATCAAAACACTGGTATCCCCTGG + Intronic
952030565 3:29137344-29137366 ATCAGAATACTGGTTTCATCAGG + Intergenic
952536327 3:34313303-34313325 GTCAGAACAGTGGTTATCTTTGG - Intergenic
953710320 3:45264480-45264502 ATCAGAACAATGGCTTCCTGGGG + Intergenic
954892099 3:53940092-53940114 AACAGAACGCTGCTTTTATCTGG - Intergenic
955296633 3:57741293-57741315 ATCAGAACAGTAGTTGTCTCTGG - Intergenic
955623235 3:60888720-60888742 ATAAGAACAATGGTTTTGTTTGG + Intronic
956142420 3:66159232-66159254 ATTAAAACACTGGTTTGCACAGG - Intronic
956857455 3:73289439-73289461 ATTTAAACGCTGGTTTTCTCTGG - Intergenic
957375557 3:79352685-79352707 AACAGATCACTGGCTTTCTGAGG - Intronic
959434875 3:106302296-106302318 CTCAGAAAAATGGTTTTATCTGG - Intergenic
959492999 3:107014127-107014149 ATCATAATAGTGGTTTTCTATGG + Intergenic
959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG + Intronic
960391923 3:117087905-117087927 AGCAGAACAGTGGTTGTCGCTGG - Intronic
961026867 3:123565995-123566017 GCCAGATCACTAGTTTTCTCTGG + Intronic
961083674 3:124047926-124047948 ATCAGCAAACGGGTTCTCTCTGG - Intergenic
961633138 3:128316240-128316262 CTCTTAACACTGGCTTTCTCTGG - Intronic
962418529 3:135206051-135206073 ATTAGAACAGTGGTTGCCTCTGG - Intronic
962684296 3:137831952-137831974 ATCAGAGCACCTGGTTTCTCAGG - Intergenic
964021255 3:152014318-152014340 ATCAGGACAATGGTTACCTCTGG - Intergenic
964820388 3:160762462-160762484 AACATAACACTGCTTTTCACAGG - Intronic
965096884 3:164240824-164240846 TTCAGAACAGTGGTTGCCTCTGG - Intergenic
965651829 3:170942409-170942431 ATCAGAAAAATTGTTTTCTCTGG + Intergenic
965732007 3:171782206-171782228 ATCAAAACAGTGGTTGCCTCTGG + Intronic
966012017 3:175090202-175090224 ATCACAAAACTCTTTTTCTCAGG - Intronic
966251700 3:177873434-177873456 ATCAGAGCAGTGGTTGCCTCTGG + Intergenic
967120816 3:186381249-186381271 ATCGGGAGACTGCTTTTCTCTGG - Intergenic
967648529 3:191956489-191956511 ATCAGAACATTGGTTCTTTGCGG + Intergenic
969244891 4:5925597-5925619 AGCATAACACTGGGTTTCTATGG + Intronic
970102407 4:12540073-12540095 ACCAGACCACTGATTTTATCTGG + Intergenic
971148229 4:24003024-24003046 ATCATAAAAGTGGATTTCTCTGG - Intergenic
971623646 4:28889652-28889674 ATCAAAAGACTGGTTTAATCTGG + Intergenic
972807999 4:42550092-42550114 TTCAGAACAGTGGTTGCCTCAGG - Intronic
972881751 4:43432925-43432947 GTCAGAACACAGGATTTCTAGGG + Intergenic
973620938 4:52724975-52724997 ATTAGAACATTGGTTGTCCCTGG - Intronic
973663222 4:53129941-53129963 ATACTAACAGTGGTTTTCTCTGG + Intronic
973985127 4:56343852-56343874 ATGTTAACACTGGTTGTCTCTGG - Intronic
974719406 4:65717517-65717539 AACAGAATTATGGTTTTCTCTGG + Intergenic
974743618 4:66041108-66041130 TTCATAAGACTGGCTTTCTCTGG - Intergenic
975978893 4:80132799-80132821 ATCAGATCAGTGGTTGCCTCTGG + Intergenic
978859666 4:113433084-113433106 ATCAGAACACTAATTTTCTCCGG - Intergenic
979195766 4:117917954-117917976 GTCAGATCAGTGGTTTTCTGGGG - Intergenic
979992122 4:127387707-127387729 ATCAGAACAATGGTTGCCTGTGG - Intergenic
980999669 4:139816617-139816639 AGCACAACACTGGACTTCTCAGG - Intronic
983096289 4:163566171-163566193 ATCAGAGCAATGCTTTTCTTTGG + Intronic
984053103 4:174891664-174891686 ATGACAACACTGGTTTTCCTGGG + Intronic
984121135 4:175746001-175746023 ATGAGAACCCTGGTCATCTCTGG - Intronic
984737467 4:183123537-183123559 ATCAGGATAGTGGTTTTCTGTGG + Intronic
985179563 4:187242069-187242091 ATCAGAATAGTGGTTTCCTGTGG - Intergenic
986205037 5:5615814-5615836 ATCAGAACAGTGGCTGTCTCTGG + Intergenic
987103259 5:14611630-14611652 AACAGAAAACTAGTATTCTCAGG + Exonic
987356983 5:17072406-17072428 ATCAGATGAGTGGTTTTCTAGGG - Intronic
990080023 5:51901120-51901142 ATAAGAACACTGTGTTTCTCTGG - Intergenic
990171139 5:53051082-53051104 ATTAGAACACTGTTTTTAACAGG - Intronic
990269606 5:54122078-54122100 TTTATAACATTGGTTTTCTCAGG - Intronic
990710913 5:58579432-58579454 ATCAGATCAATGATATTCTCTGG - Intergenic
990952915 5:61315824-61315846 ATCAAAACAGTGGTTGCCTCTGG - Intergenic
991045379 5:62217738-62217760 AGCAGAACAGTGGTGTTCTGTGG + Intergenic
991099013 5:62771155-62771177 ATCAGAACACTCATTTTTACTGG - Intergenic
991348681 5:65698016-65698038 ATCAAAACAGTGGTTACCTCTGG + Intronic
991463129 5:66880306-66880328 CTTAGAACAGTGGTTCTCTCTGG + Intronic
991954528 5:71979439-71979461 TTCAGGACACTGGTTATCTCTGG - Intergenic
992451332 5:76878975-76878997 ATCAGAACCCTGGTTTGTGCAGG + Intronic
993029757 5:82692279-82692301 GTCAGAATAGTGGTTATCTCAGG - Intergenic
994272437 5:97796248-97796270 ATCAGAAGACTTGATTTCACAGG - Intergenic
994781835 5:104098902-104098924 ATCACAAAAGTGGTTTTCACAGG + Intergenic
995485442 5:112635710-112635732 ATCATAACACAGATTTTCTTAGG + Intergenic
996362347 5:122663751-122663773 ATAAGAACATTAGTTGTCTCTGG + Intergenic
998047665 5:139002245-139002267 TTCAGAACAGTGGTTACCTCCGG + Intronic
998916681 5:147020343-147020365 ATCAGACCACTGACTTTCACTGG + Intronic
999778588 5:154830586-154830608 ACCAGAACACTGGTCTTGACTGG + Intronic
1000395889 5:160774352-160774374 ATCAGAACCCTGGATATCCCTGG - Intronic
1000600190 5:163264646-163264668 ATCAGAACAATGCTTACCTCTGG + Intergenic
1000818210 5:165950669-165950691 AATGGAACACTGGTTTTGTCTGG - Intergenic
1001561403 5:172671474-172671496 ATCAGAACAGTGGCTACCTCTGG - Intronic
1002475552 5:179463233-179463255 ATCATATCACTGGTCTTTTCAGG + Intergenic
1003123084 6:3333985-3334007 TTCAGAACACTGCTTTTCAAAGG - Intronic
1003584901 6:7379670-7379692 TTCAGTACACTGGTTATCTCTGG - Intronic
1004409121 6:15364052-15364074 GTCACAAGACTGGTTATCTCTGG - Intronic
1004934519 6:20494602-20494624 ATGCGAACAGTGGTTATCTCTGG - Intergenic
1006664465 6:35681442-35681464 ATCAGGACAGTGGTTGCCTCTGG - Intronic
1006995682 6:38257789-38257811 ATCAGAACAGTGGTTAGTTCTGG + Intronic
1007268304 6:40614458-40614480 ATCAGAACAGTGGTTACCTTGGG - Intergenic
1007825785 6:44599698-44599720 ATCAGAACAATGGTTACCTGTGG - Intergenic
1008008827 6:46442025-46442047 ATCAAAACTCTGACTTTCTCTGG + Intronic
1009434028 6:63597888-63597910 TACAGAACACTGATTTGCTCAGG + Intergenic
1011893680 6:92197900-92197922 GGCAGAATATTGGTTTTCTCTGG + Intergenic
1013313521 6:108919797-108919819 ATCAGAAAAATGGTTCCCTCTGG - Intronic
1013503205 6:110772529-110772551 ATCAGAGGAATGGTTTTCTTAGG - Intronic
1013984600 6:116175250-116175272 ATCAGATCATTAGTTTTCTTGGG - Intronic
1014283991 6:119475625-119475647 ATCAGAACAGTGGTTACCTTTGG + Intergenic
1014369432 6:120585729-120585751 ATAATAAAAATGGTTTTCTCTGG + Intergenic
1014400870 6:120988068-120988090 ATCACACCACTGGCTTTCTTGGG - Intergenic
1014672655 6:124325707-124325729 ATCAGAACAGTGGTCTTCTCAGG + Intronic
1015002425 6:128234494-128234516 ATCAGAACACTTGTTGCCTGTGG - Intronic
1015301467 6:131657347-131657369 ATCAGAACAGTGATTGTCTTTGG - Intronic
1015369263 6:132432887-132432909 ATCAGAAAACTTGTTTTAACTGG - Intergenic
1016077992 6:139820580-139820602 ATCATAGCACTGATGTTCTCTGG + Intergenic
1017060439 6:150479493-150479515 GTTAAAACACTGGTTTTCTGAGG + Intergenic
1017601274 6:156084403-156084425 AGCAGAACAGTGGTTTCCTGAGG - Intergenic
1017675590 6:156810577-156810599 TTTAGAACACAGGTTTCCTCAGG + Intronic
1018163444 6:161070276-161070298 ATCAGAACACTTTATTTTTCAGG - Intronic
1019943127 7:4306810-4306832 ATCAGAACAGTGGTTCCCTATGG - Intergenic
1022445019 7:30463003-30463025 ATCAGATCAATGGTTTCCTGAGG + Intronic
1023700235 7:42885142-42885164 GTCAGAATACTGGTTATATCTGG + Intergenic
1026385253 7:69840530-69840552 ATAAGAACACTGGGCTTCACAGG + Intronic
1026583387 7:71636311-71636333 ATTAGAACACTGCAGTTCTCTGG + Intronic
1028767702 7:94578630-94578652 ATCAGAACACTGCATCTCTCAGG - Intergenic
1029064998 7:97840541-97840563 ATAAGGACACTCCTTTTCTCTGG - Intergenic
1029192394 7:98781111-98781133 ATCAGAACACTGGATCTCCCTGG - Intergenic
1029991503 7:104966759-104966781 ATCAGAAAACTGGTCATCTCTGG - Intergenic
1030289732 7:107859946-107859968 AAGAGCACCCTGGTTTTCTCTGG - Intergenic
1031146053 7:117998163-117998185 ATCAGGACAGTTGTTGTCTCTGG + Intergenic
1031209768 7:118808194-118808216 CTAAGAACACTTCTTTTCTCTGG - Intergenic
1031354322 7:120771511-120771533 AACAGATCACTGGTTGGCTCCGG - Intergenic
1031891356 7:127296692-127296714 ATCAAAACACTGGTTTTGAATGG - Intergenic
1031894120 7:127328490-127328512 ATGAGAACAGTGGTTATATCTGG - Intergenic
1033401664 7:141031586-141031608 TTCAGAACAATGCTTATCTCTGG - Intergenic
1033821946 7:145145392-145145414 ATCAGAACAGTGGTTTCCTCTGG + Intergenic
1034087436 7:148333125-148333147 ATCAAAACACTCATTTTTTCAGG + Intronic
1034407348 7:150913917-150913939 ACCAGAACACTGTCTTTCCCAGG + Intergenic
1034753612 7:153593512-153593534 ATCAGAGCACTGATTCTCTAGGG + Intergenic
1035336229 7:158128761-158128783 ACCAGATCACTGGTTCTCTGGGG + Intronic
1035725161 8:1819845-1819867 ATCAGAACAGTGGTTATTTTTGG - Intergenic
1037243077 8:16799934-16799956 ATCAGCACAAGGGTTTTTTCTGG + Intergenic
1038153356 8:24962529-24962551 ATCAGAACAGTGGTTTCCTCAGG + Intergenic
1038380160 8:27085308-27085330 CACAGAATACTGGTTTTCCCAGG - Intergenic
1039088832 8:33806502-33806524 TTCAGAAAACTGGTTTCCCCTGG + Intergenic
1039450534 8:37671194-37671216 ATCAGAACAGTGGTTACCTTGGG + Intergenic
1041455870 8:58058973-58058995 ATCAGAACAATGATTTCTTCTGG - Intronic
1043500183 8:80846115-80846137 ATCAAAAAACTGGTTTAATCAGG - Intronic
1045108729 8:98919467-98919489 ATCAGAACAATGGTTGCCTAGGG + Intronic
1045184462 8:99823003-99823025 ATCAGAACACTGGTTTTCAAAGG - Intronic
1045380103 8:101615444-101615466 ATCAGAACACTTTTCTCCTCTGG + Intronic
1045383871 8:101652673-101652695 ATTTGAACACAGGTTTTCTGAGG - Intronic
1046548202 8:115678324-115678346 AATAGCACACTGGTTTCCTCTGG + Intronic
1047546592 8:125823572-125823594 ATCTGGACAATGTTTTTCTCAGG + Intergenic
1047774880 8:128061703-128061725 GTCAGTACAGTGGTTTTCTCTGG + Intergenic
1048197723 8:132346303-132346325 ATTTCCACACTGGTTTTCTCTGG + Intronic
1049928926 9:437467-437489 ATCAGAGCACTCCATTTCTCTGG - Intronic
1050219476 9:3370518-3370540 ATCAGAACAGTGTTTGTTTCTGG + Intronic
1051111816 9:13647709-13647731 ATCAGATCACTGGTGACCTCTGG + Intergenic
1051659862 9:19416009-19416031 ATGAGGACAGTGGTTATCTCTGG + Intronic
1053445252 9:38147681-38147703 ATCAGAGCAGTGGTTGCCTCTGG - Intergenic
1055050798 9:71978599-71978621 ATCAGAATAGTGGTTATCTTTGG + Intronic
1056153135 9:83807617-83807639 ATCAGGATACTTGTTATCTCTGG - Intronic
1056510895 9:87304641-87304663 TGAAGAACACTGGTTTTCTTTGG + Intergenic
1056538274 9:87550200-87550222 ATCAGAACACTGGTTTCCTTTGG - Intronic
1057215582 9:93226640-93226662 ATCAGAATAATGGTTACCTCTGG - Intronic
1058345289 9:103953592-103953614 AGCAGAACCTTGCTTTTCTCAGG + Intergenic
1058933080 9:109741158-109741180 ATCAGAACACTGGTTACCTCTGG - Intronic
1059288862 9:113203484-113203506 GTCAGAATATTGGTTATCTCAGG - Intronic
1059946641 9:119415415-119415437 ATCATAACACAGGTTTTTTCGGG - Intergenic
1060458958 9:123830319-123830341 ATCAGAACAGTTGTTGTCTCTGG + Intronic
1060691011 9:125660247-125660269 ATCAGAACAATGCTTGCCTCTGG + Intronic
1062007651 9:134249299-134249321 ATCAGGACAATGGTTTTGTGGGG + Intergenic
1186916258 X:14225073-14225095 ATCAGAACAGTGGTTGTCTCTGG + Intergenic
1187441019 X:19319917-19319939 ATCAGAACAGTGGTTACTTCTGG + Intergenic
1187611472 X:20948238-20948260 TTCAGAGCACCAGTTTTCTCTGG + Intergenic
1187683902 X:21797507-21797529 GTCAGAACACTGATTATCTCAGG + Intergenic
1187886520 X:23893906-23893928 AACAGAACAGAGGCTTTCTCTGG + Intronic
1188359657 X:29237072-29237094 ATAAAAACCCTGTTTTTCTCTGG - Intronic
1188588399 X:31804079-31804101 ATCATAACGCTGGTTAACTCTGG + Intronic
1188697027 X:33206563-33206585 CTAAGAACATTGGTTTTCTCAGG + Intronic
1188735020 X:33702547-33702569 CTCAGACACCTGGTTTTCTCTGG - Intergenic
1189263888 X:39699068-39699090 AGCAGAACAATAGTTTTCCCTGG - Intergenic
1189442882 X:41053141-41053163 AACAGAACAGTGGTTGCCTCTGG + Intergenic
1192305382 X:69953857-69953879 ATCAGAACAGTAGTTGTCTCAGG + Intronic
1192419899 X:71020388-71020410 ATCACAAAGGTGGTTTTCTCAGG - Intergenic
1192490489 X:71572170-71572192 TCCAGAACAGTGGTTGTCTCTGG - Intronic
1195091715 X:101466680-101466702 ATCAGATCAGTGGTTTTTTGGGG + Intronic
1195527265 X:105905723-105905745 AGCAGAAGACTTGTTTTCCCAGG + Intronic
1195654435 X:107321428-107321450 ATGAGAACACAGCTTTTCTGGGG + Intergenic
1195922164 X:109994693-109994715 ATCAGAACAATGGTTACCTCTGG + Intergenic
1195994227 X:110715522-110715544 CTCAAAACCTTGGTTTTCTCAGG - Intronic
1196893995 X:120315588-120315610 ATCAGAATAGTGGTTACCTCTGG - Intergenic
1196939589 X:120762280-120762302 GTCAGGACACTGGTTCTATCAGG + Intergenic
1197294860 X:124706478-124706500 TGCAGAATAGTGGTTTTCTCTGG - Intronic
1197632236 X:128874806-128874828 TTCAGAACAGTGGTTACCTCTGG - Intergenic
1197654011 X:129096520-129096542 TTCAGAACAGTGGTTGCCTCTGG - Intergenic
1197760645 X:130025471-130025493 ATCATAGCACCGGGTTTCTCTGG - Intronic
1198453934 X:136796750-136796772 ATCAGAATAGTGGTTCTTTCTGG + Intergenic
1198488314 X:137110809-137110831 ATCAGAACCATGGTTTCCTGTGG - Intergenic
1198488322 X:137110864-137110886 ATCAGAACCATGGTTTCCTGTGG - Intergenic
1198865900 X:141122523-141122545 AGCAGAACACTGGTCTTCTATGG + Intergenic
1198910651 X:141609899-141609921 ATCAGGAGACTGCCTTTCTCTGG + Intronic
1200226523 X:154420652-154420674 ATCAGCACAGTGATTTTCTGTGG - Exonic
1200516761 Y:4152909-4152931 ATCGGAACACTGGCTCTGTCAGG - Intergenic
1201611199 Y:15844931-15844953 ATCAAAACATTGGTTTTGCCTGG + Intergenic
1201652613 Y:16307105-16307127 ATCAGAACTCCAGGTTTCTCTGG + Intergenic
1202177927 Y:22114676-22114698 GTCAGAACACTGCTTTACTTTGG - Intergenic
1202213434 Y:22471719-22471741 GTCAGAACACTGCTTTACTTTGG + Intergenic