ID: 1166865965

View in Genome Browser
Species Human (GRCh38)
Location 19:45837692-45837714
Sequence AAATTTTACTTGAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166865961_1166865965 14 Left 1166865961 19:45837655-45837677 CCAGATCAAAGATGGCTGACTAA 0: 1
1: 0
2: 0
3: 14
4: 91
Right 1166865965 19:45837692-45837714 AAATTTTACTTGAAGGAAGTTGG 0: 1
1: 1
2: 2
3: 31
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166865965 Original CRISPR AAATTTTACTTGAAGGAAGT TGG Intronic
900843161 1:5072571-5072593 AAAGTTTTCTTGAAGTATGTGGG + Intergenic
901183612 1:7358103-7358125 AAATAGAACTTGAAGGAACTGGG - Intronic
905056913 1:35103101-35103123 AAATTTCACTTCAATGAATTTGG - Intronic
905475873 1:38227680-38227702 AACTTTTACTTAAGGGAAATGGG - Intergenic
906187029 1:43870187-43870209 AAAATTCATTTGAAGTAAGTAGG - Intronic
906812650 1:48844816-48844838 ATATTTTTCTTGAAGCAGGTAGG + Intronic
908632336 1:66123138-66123160 ATATTTTACTTGAAATAGGTAGG + Intronic
909148568 1:71970296-71970318 AAATGTTACTTCAAGGAATTTGG + Intronic
909424178 1:75502726-75502748 AATTTTTATTTTAAGAAAGTGGG - Intronic
909428452 1:75556179-75556201 TAATTTTGCTTGGAGGAAGAGGG - Intronic
909572557 1:77133537-77133559 AATTTTTAATTGATGGATGTAGG + Intronic
909643375 1:77890571-77890593 AAATTTCACTTGAAGTATTTAGG + Intronic
910332634 1:86092584-86092606 ACATTTTTCTTGAAGGACCTAGG + Intronic
910478101 1:87629345-87629367 CATTTTTACTTGAAAGAACTAGG - Intergenic
910836781 1:91521509-91521531 AAATTTTATTTGAAGATAATAGG + Intronic
911253988 1:95613229-95613251 ATATTTTACATGAAGCCAGTTGG - Intergenic
911356597 1:96828558-96828580 AATTTTTACTTGAATGAATTTGG - Intergenic
912435911 1:109660969-109660991 CAACATTACTTAAAGGAAGTTGG + Intronic
912437855 1:109674551-109674573 CAACATTACTTAAAGGAAGTTGG + Intronic
912440365 1:109693010-109693032 CAACATTACTTAAAGGAAGTTGG + Intronic
912443664 1:109717145-109717167 TAACATTACTTAAAGGAAGTTGG + Intronic
914983799 1:152439657-152439679 GAATTTCCCTTGAAGGAACTCGG - Intergenic
915050179 1:153061188-153061210 ATATATTATTTGAATGAAGTGGG + Intergenic
916371315 1:164098332-164098354 CAATTATACTTTAATGAAGTTGG - Intergenic
916417594 1:164607130-164607152 AATTTTATCTTGAAGGCAGTTGG + Intronic
918140611 1:181716545-181716567 AAATTTCACATGATGGAAGTAGG - Intronic
918473088 1:184895048-184895070 AAATTTTACTTGAAAGTAGAGGG - Intronic
918605643 1:186422149-186422171 AAATTTTTTTTAAATGAAGTAGG + Intergenic
919015204 1:192024683-192024705 AAAATTTAGTAGAAGAAAGTTGG + Intergenic
919340199 1:196296448-196296470 ATATATTACTGGAAGGAATTTGG + Intronic
919526479 1:198659072-198659094 TAATTTTACTTGAAATAAGTTGG - Intronic
921768480 1:219003651-219003673 AATTTTAACTTGAAAGATGTGGG - Intergenic
921936443 1:220801091-220801113 ATCTTTTACTTGAAGAAAGGTGG - Intronic
922316660 1:224448519-224448541 AAAGTTTTCTTGGAGTAAGTGGG + Intronic
923297053 1:232604184-232604206 AAAGTTGATTTGAAGGGAGTTGG - Intergenic
923534345 1:234837489-234837511 ACATCTTCCTTGAAGGTAGTAGG + Intergenic
923601083 1:235403540-235403562 AGCTTTTACAAGAAGGAAGTAGG - Intronic
923845443 1:237725920-237725942 AAATTTAAATTGAAGTATGTTGG + Intronic
1063279417 10:4609074-4609096 AATTTTTAATTGATGGAAGCAGG + Intergenic
1064585824 10:16838352-16838374 ACATTTTACTGGAATGAACTGGG + Intronic
1066350047 10:34628922-34628944 AAATCATATTTGAAGGATGTAGG - Intronic
1066528128 10:36304751-36304773 TAATTATTCTTAAAGGAAGTGGG - Intergenic
1068087211 10:52389312-52389334 AAATTTGCCATGAAGGAAATGGG - Intergenic
1068726723 10:60311517-60311539 AAAATTTTCTAGAAGGAACTAGG - Intronic
1069582495 10:69575206-69575228 AAATTTTCCTCCAAGGAAGAGGG + Intergenic
1070260184 10:74847244-74847266 AATTTTTACTTGATGAAATTTGG + Intronic
1070980491 10:80641868-80641890 AAATTTTAATTGATAGAAGTTGG - Intronic
1071496221 10:86169377-86169399 AATATTTACATCAAGGAAGTTGG - Intronic
1072301912 10:94070011-94070033 AGTTTTTAATTGAAGGAAGGAGG - Intronic
1072419501 10:95277932-95277954 AAATGTAAGTTGAAGAAAGTGGG - Intronic
1074166202 10:110877785-110877807 CTCTTTTACTTGGAGGAAGTAGG + Intronic
1074221602 10:111443662-111443684 AAGTATAACTTGAAGGAAATAGG + Intergenic
1074403560 10:113162116-113162138 AAATTTTACTTGTACCAGGTGGG + Intronic
1075101764 10:119511107-119511129 AAATTTAAGTTGGAGGAAGCAGG - Intronic
1075177953 10:120183402-120183424 AAATGGAACTTGAAGGAAATAGG - Intergenic
1075935756 10:126339810-126339832 AAATTTTATTTGAGTGAAGTGGG + Intronic
1075945448 10:126429105-126429127 ACATTTTACTTGCATGAACTTGG + Intronic
1076946899 10:133657721-133657743 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1078313355 11:10269021-10269043 AAAATCTCCCTGAAGGAAGTAGG + Intronic
1078986120 11:16600584-16600606 AAATATCAGTTGAAGAAAGTGGG - Intronic
1079209165 11:18445668-18445690 AATTTTTACTTAAAAAAAGTAGG + Intronic
1079288515 11:19163682-19163704 AAATGTTATTACAAGGAAGTAGG - Intronic
1079591333 11:22186556-22186578 AAATTATACTTCAATAAAGTTGG + Intergenic
1079643609 11:22835760-22835782 ACATTTTACTTTAAGGAAAAAGG + Intergenic
1080341284 11:31268287-31268309 AAATTTTGGTTGAAGTAAATGGG - Intronic
1083543274 11:63529878-63529900 AGCTTTTACCTCAAGGAAGTAGG + Intergenic
1087842236 11:102932397-102932419 AAATTTTATTTTAAGAAATTTGG + Intergenic
1088018825 11:105094042-105094064 CTATCTTAGTTGAAGGAAGTAGG + Intronic
1088024982 11:105168647-105168669 AACTGTTACTGGAAGGAAATGGG + Intergenic
1088299421 11:108340292-108340314 AAATAATATTGGAAGGAAGTTGG - Intronic
1089443700 11:118535034-118535056 AAATTTTACCTGAGGGAACAAGG - Exonic
1089932034 11:122322541-122322563 GAAGTTGAGTTGAAGGAAGTGGG - Intergenic
1092110017 12:5953414-5953436 AAATTTTTCTTCAAGGAAGAGGG - Intronic
1093658921 12:21731165-21731187 AAATTTTAACTGTAGGTAGTTGG - Intronic
1094004954 12:25739362-25739384 AGATTTTACTTAAATGAGGTTGG + Intergenic
1095088995 12:38086849-38086871 AAATTTTATTAGAAGAAAGGGGG + Intergenic
1095171124 12:39037629-39037651 GAATTTCCCTTGAAGGAATTCGG - Intergenic
1095459019 12:42421898-42421920 TAATTTTACTTTAAGGAAGATGG + Intronic
1095849091 12:46780945-46780967 AAAATTCACTAGAAGGATGTAGG - Intronic
1096440027 12:51633637-51633659 ACATTAAACTTGAAGGCAGTTGG + Intronic
1097197563 12:57251893-57251915 AAATTTTACAAGAAGGAGGGTGG - Intronic
1097627225 12:62015107-62015129 AAGTTTAAATTGCAGGAAGTTGG - Intronic
1097866500 12:64563517-64563539 GGATTTTACTTTAGGGAAGTAGG - Intergenic
1098358012 12:69629328-69629350 AAATTTTCCCTCAAGCAAGTAGG - Intergenic
1098815526 12:75156966-75156988 AAATATTTCTTGAAGTAAGTTGG - Intronic
1098946113 12:76591640-76591662 AAATTTTACTGGCAGAAAGCAGG + Intergenic
1099108526 12:78526003-78526025 AAGTTTCACTAGAACGAAGTTGG + Intergenic
1099138571 12:78940681-78940703 AAATTTTACTTAAAGTGACTAGG - Intronic
1099977549 12:89562002-89562024 AAATGTTTGTTGAATGAAGTGGG + Intergenic
1100343705 12:93706507-93706529 AAATATGTCTTGAAGGTAGTCGG + Intronic
1100504052 12:95202536-95202558 AAATTTTTTTTAAAGGAATTAGG - Intronic
1101057305 12:100931674-100931696 AGATTAAACATGAAGGAAGTGGG - Intronic
1102034397 12:109762559-109762581 AGGTCTTACATGAAGGAAGTGGG - Intronic
1102365837 12:112333905-112333927 AAACTTCACTTTAAGTAAGTGGG + Intronic
1104324101 12:127779675-127779697 AATTGTTAATGGAAGGAAGTAGG + Intergenic
1105606819 13:21932818-21932840 AAATTTTTCTTGAAGTCAGCAGG - Intergenic
1106931683 13:34672759-34672781 AAATTCTACTGGTAGGAAGTAGG + Intergenic
1107085193 13:36420283-36420305 AAATTTAATTTGATGGAAATAGG + Intergenic
1107176318 13:37403659-37403681 AAATTTTATTTCAATAAAGTTGG - Intergenic
1108930331 13:55809894-55809916 AAATGTTACTTGAAAAAAGGGGG + Intergenic
1109243067 13:59915119-59915141 AAAATTTTATTTAAGGAAGTTGG + Intronic
1110097445 13:71546085-71546107 ACATTTTACTTAAAGTAATTTGG + Intronic
1110242106 13:73280755-73280777 AAAATTTCCTTGTGGGAAGTGGG + Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1110784009 13:79501833-79501855 AAACTTTCCATGAAGGAAGTTGG + Intronic
1111159363 13:84373440-84373462 ATATTTCACTTAAAGGAAGTAGG + Intergenic
1111835405 13:93382846-93382868 AAATATTGCTTTAGGGAAGTAGG - Intronic
1112079291 13:95950996-95951018 AAATAATACTTGAAGAAATTAGG + Intronic
1112160963 13:96867634-96867656 AAATTTTAGTTTAAATAAGTTGG + Intergenic
1112320655 13:98404239-98404261 AAACTTTTCTTAAAGGAACTGGG + Intronic
1112717127 13:102199876-102199898 AAAGCTTGCTTGGAGGAAGTGGG - Intronic
1114127403 14:19745233-19745255 AAATCTTACTTTAAACAAGTAGG + Intronic
1115167983 14:30471164-30471186 AGATATTACCTGAGGGAAGTTGG - Intergenic
1115234761 14:31198186-31198208 ATATTCTACTTAAAGGAAATGGG + Intronic
1115907792 14:38220461-38220483 AAATTTTACTGGAAAATAGTAGG + Intergenic
1116724130 14:48540079-48540101 AAATTATACTGGAACCAAGTAGG - Intergenic
1116982757 14:51188887-51188909 GAATTTTGCTTGATGGAAGATGG - Intergenic
1117310370 14:54516169-54516191 AAATATTACCTGAAGGTAGATGG - Intronic
1117946918 14:61036903-61036925 ACATTTTAATGAAAGGAAGTAGG + Intronic
1118497948 14:66327547-66327569 GAATTTCACATGAAAGAAGTAGG + Intergenic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1121149551 14:91619352-91619374 TAAAATTACTTGAAGGAAATAGG + Intronic
1202920973 14_KI270723v1_random:30277-30299 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1202923944 14_KI270724v1_random:7304-7326 AAATTTTATTAGAAGAAAGAGGG + Intergenic
1123570847 15:21606874-21606896 AAATCTTACTTTAAACAAGTAGG + Intergenic
1123606961 15:22042227-22042249 AAATCTTACTTTAAACAAGTAGG + Intergenic
1124445608 15:29729113-29729135 ACATTTCACCTGAAGGAAGTTGG - Intronic
1125119104 15:36131887-36131909 TAATTCTACTTGAACAAAGTTGG - Intergenic
1125223141 15:37363985-37364007 AAATTTTACTTTGACAAAGTAGG - Intergenic
1126159155 15:45593613-45593635 ATACTTTACTTGCAGGAAGCTGG + Intronic
1127464163 15:59227510-59227532 AGATTTTTCCAGAAGGAAGTTGG + Exonic
1127725591 15:61746080-61746102 AAACTTTATTTTAAGGAGGTTGG - Intergenic
1128100286 15:64992998-64993020 AACTTTAGCTTGAAGGCAGTGGG - Intergenic
1128913190 15:71535248-71535270 ATATATTAAGTGAAGGAAGTCGG - Intronic
1130356556 15:83136827-83136849 AAATTTTTTTTGAAGGAAAATGG + Exonic
1130568461 15:85019423-85019445 AAATTTTATTTTAAAGAAATGGG + Intronic
1130657251 15:85800320-85800342 AAATTTTATTTGGGGGGAGTGGG + Intergenic
1131207490 15:90462974-90462996 AAATTTTACCAGAAGGATTTGGG + Intronic
1131212520 15:90510216-90510238 AAATTTTATTCCAAGGACGTGGG + Intergenic
1131267850 15:90928654-90928676 AAACTTTAGTGGAAGAAAGTAGG + Intergenic
1132138610 15:99369345-99369367 AAATTTTGCTATCAGGAAGTGGG - Intronic
1202979200 15_KI270727v1_random:333997-334019 AAATCTTACTTTAAACAAGTAGG + Intergenic
1133479188 16:6153241-6153263 AAATTTTTATTGGAGGAAATAGG - Intronic
1133479358 16:6155035-6155057 AAATTTTTATTGGAGGAAATAGG + Intronic
1133996163 16:10750224-10750246 AAAGTTTAATTTATGGAAGTTGG - Intronic
1134334499 16:13285346-13285368 AAATTTAAATTGAACGATGTTGG + Intergenic
1134434513 16:14243651-14243673 AAAGCTTACTTAAAAGAAGTTGG - Intronic
1135860085 16:26048386-26048408 GAATGTTACTTAAAGGAATTGGG + Intronic
1137976851 16:53039434-53039456 AACTTTTAATTGAAGCAATTAGG - Intergenic
1139139990 16:64249784-64249806 AAATTATACTTGAACTTAGTGGG - Intergenic
1139933360 16:70548098-70548120 ATATTGTACTTGAAGGAAAGGGG + Intronic
1140542881 16:75775668-75775690 AAATTCTACTTGAGAGAAGCTGG + Intergenic
1140652060 16:77098797-77098819 AAAATTTCCTTTAAGAAAGTTGG - Intergenic
1141064565 16:80903439-80903461 AAATTTTCTTTGAAGAAAATAGG + Intergenic
1144017846 17:11213562-11213584 AAATATAAAATGAAGGAAGTGGG + Intergenic
1146152744 17:30489934-30489956 TATTTTCACTTGAAAGAAGTTGG + Intronic
1147197716 17:38778770-38778792 AAATACTACTTCCAGGAAGTAGG - Intronic
1149336449 17:55640942-55640964 AAATTTTACTGGAAGGAGGTGGG + Intergenic
1149407197 17:56365281-56365303 AAATTTTATTTGAGGCAAGAGGG + Intronic
1149418512 17:56485538-56485560 AATTTTTACTTTAAGTATGTTGG + Intronic
1151117482 17:71754043-71754065 AAATTTTCTTTTAAGGCAGTAGG - Intergenic
1151454917 17:74220496-74220518 AAACTTTACTTCAAGGAAAGAGG + Intronic
1154091367 18:11366811-11366833 ACATTTTATTTGAAAGCAGTTGG + Intergenic
1154458386 18:14552073-14552095 CACTTTTACATAAAGGAAGTAGG - Intergenic
1155313540 18:24548466-24548488 GAAATTTACTTTAAGGAATTGGG + Intergenic
1155920117 18:31595205-31595227 AAATCTTACTGGAAGGCACTTGG + Exonic
1156055441 18:32997545-32997567 AGATTTTATTTTAAGGAATTGGG - Intronic
1156158390 18:34330730-34330752 ATATTTTACATGAAGAAATTAGG - Intergenic
1156814138 18:41288500-41288522 ATATTTTACTGGAATTAAGTTGG + Intergenic
1156978517 18:43256616-43256638 ATATTTCACTGGAAGAAAGTAGG - Intergenic
1157146951 18:45173503-45173525 AAAACTTACTGGATGGAAGTTGG + Intergenic
1157944752 18:51966723-51966745 AAATTTTTCTTACAGGAAATAGG - Intergenic
1158430846 18:57385953-57385975 ATGTCTTACTTAAAGGAAGTGGG - Intergenic
1158454991 18:57598216-57598238 AAATTATAATTGAACTAAGTTGG + Intergenic
1158823334 18:61186568-61186590 GAATTTTACTTTAATAAAGTAGG - Intergenic
1159036085 18:63278134-63278156 AAAATTCATTTTAAGGAAGTAGG - Intronic
1159270722 18:66146643-66146665 AAATTTCAGGTCAAGGAAGTGGG - Intergenic
1159510474 18:69392099-69392121 AAATAATATTTGAAGGAGGTAGG + Intergenic
1159735129 18:72086712-72086734 AAATTGAACTGGAAGGAACTTGG + Intergenic
1159795551 18:72838584-72838606 AAATTTTTCTAGTAAGAAGTGGG + Intronic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1165041364 19:33070147-33070169 GAATTTTACTTGGAGGAACTGGG - Intergenic
1166865965 19:45837692-45837714 AAATTTTACTTGAAGGAAGTTGG + Intronic
1168547148 19:57262752-57262774 GAGTTTCACTTGGAGGAAGTGGG + Intergenic
926434727 2:12826295-12826317 AAATTTTGCGTGAAAGAAGGGGG + Intergenic
927559359 2:24058966-24058988 ATATTTTAGTTGTAGGAATTAGG + Intronic
928265652 2:29809416-29809438 AAATTTTACTGGAACAAAGGAGG + Intronic
928841050 2:35605144-35605166 GAATTTTTCTTGTAGGAAGAGGG - Intergenic
928992298 2:37246513-37246535 AAATTTTTCTTGAATGAAGGGGG - Intronic
929263109 2:39888383-39888405 AAGTTTTACTGGAAGGACCTAGG - Intergenic
929306457 2:40368466-40368488 AAATTTTATTGGGAGGAACTGGG + Intronic
929376462 2:41292247-41292269 AAATTTATCTTCAAGAAAGTAGG + Intergenic
929850442 2:45583813-45583835 GAATATTCCTTGAAGTAAGTGGG - Intronic
929986511 2:46738775-46738797 TCATTTCACTTGAAGGAACTAGG + Intronic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
931151461 2:59578821-59578843 AAATATAACTTGAAAGAAGAAGG + Intergenic
931403888 2:61957061-61957083 TAGTTTTAATTGAAGGAAGATGG + Intronic
931636083 2:64341739-64341761 GAACTTTACTGGAAGGCAGTTGG - Intergenic
932551458 2:72773575-72773597 AAATTATACCTCAAGAAAGTCGG + Intronic
933289569 2:80423210-80423232 AAGTTTTACTGGAAGAAAGCAGG - Intronic
933634752 2:84695423-84695445 AAATCTTTCTGGAAGGTAGTTGG + Intronic
933678676 2:85079553-85079575 ACATTTTACTGGAAGGAAACAGG - Intergenic
937431318 2:121841059-121841081 AAATTTTACCTCAATAAAGTTGG - Intergenic
939302303 2:140360306-140360328 AAATTTCACTTAAAGCAAGGAGG - Intronic
939387357 2:141517825-141517847 AAATTTCATTTAAAGGATGTGGG + Intronic
939704042 2:145430167-145430189 AAATTTTAATTTAAAAAAGTGGG + Intergenic
939735404 2:145838203-145838225 GAAATTTAATTGAAGGAAGAAGG - Intergenic
939833721 2:147102969-147102991 AAGTTTTACTTGAAGATACTTGG - Intergenic
940115896 2:150207941-150207963 AAATTTTTCTTAAATGAATTTGG + Intergenic
940684233 2:156826347-156826369 AAATTTTACTTGAATTTAATTGG - Intergenic
940753161 2:157650593-157650615 AAATTTTGCTTGAAGGGGGCGGG + Intergenic
942719346 2:178933002-178933024 TAATATTATTTGAAGGAACTTGG + Intronic
943123116 2:183762412-183762434 ACATTTTATTTGCAGGCAGTAGG - Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
943522036 2:188963788-188963810 AAATTTTCTTTGAAGAAACTGGG + Intergenic
943783786 2:191853662-191853684 AAATAATGCTTGAAGGAAATGGG + Intergenic
943933191 2:193881646-193881668 TAATTTAACTTGATAGAAGTTGG - Intergenic
944346470 2:198671970-198671992 AAATTTTACTTGAATAAAGAAGG + Intergenic
944910137 2:204302833-204302855 AAGTCTTACTTGGAGGAAGGCGG - Intergenic
945427133 2:209720340-209720362 AAATTTTACTTGAAATAGGCCGG + Intronic
945535117 2:211007058-211007080 AAATTTTACATGCAGGAAAAAGG + Intergenic
945898811 2:215515217-215515239 AAACTTTAGTTGAAAGCAGTAGG - Intergenic
946991463 2:225334886-225334908 ACATTTTAATTGCAGGAACTAGG + Intergenic
947031917 2:225805890-225805912 AAAATTTACCTGAGGAAAGTCGG + Intergenic
948652445 2:239456942-239456964 AAATTTCACATGAAGACAGTGGG + Intergenic
1168954420 20:1824851-1824873 AAATGTTTCTAGAAGGAAGAAGG + Intergenic
1169076843 20:2765597-2765619 AGATTTCACTTCAATGAAGTGGG - Intergenic
1169104005 20:2978684-2978706 AAACTTTGCTGGAATGAAGTTGG + Intronic
1169402977 20:5299318-5299340 AAATTTCAATGAAAGGAAGTTGG + Intergenic
1169808302 20:9582055-9582077 AAATTTTATTTGAAAGAAAAGGG - Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171393759 20:24817759-24817781 AATTTTTACTTGGAGAATGTGGG - Intergenic
1174264518 20:49321692-49321714 AAATTTTAATTGAACTAAATGGG - Intergenic
1176815764 21:13601263-13601285 CACTTTTACATAAAGGAAGTAGG + Intergenic
1177608574 21:23415693-23415715 AAATTTTTTTTCAAGGAAATAGG + Intergenic
1177950090 21:27524502-27524524 AATTTCTACTTGACAGAAGTTGG - Intergenic
1178288080 21:31342837-31342859 ATCTTTAACTTCAAGGAAGTGGG + Intronic
1178449487 21:32682593-32682615 AAATCTTTCTTCAAGGAACTGGG + Intronic
1178669697 21:34579755-34579777 AAATGTAATTTGAAGGAAATGGG - Intronic
1179225562 21:39450081-39450103 AAATATTACTTGAAGAAAGTGGG - Intronic
1179385773 21:40940713-40940735 AAATTCTACTGGCAGGAAGCAGG + Intergenic
1181550702 22:23637557-23637579 AGTTTTCACTTGAGGGAAGTTGG - Intergenic
1181984136 22:26787607-26787629 GAATTTCCCTTGAAGGAACTCGG + Intergenic
1183129960 22:35824911-35824933 AAATTATTCTTGAATGAAGCTGG - Intronic
949094540 3:70756-70778 ATATTATAATTGAAGAAAGTTGG - Intergenic
950121941 3:10487848-10487870 AAATTTTACTCAGAGGCAGTGGG - Intronic
950130626 3:10543491-10543513 ACAATTTACTTGAAGGTAGTTGG - Intronic
951622075 3:24613386-24613408 AAATGTTTCCTGAAGGAAGATGG + Intergenic
951622538 3:24620629-24620651 ACATATTGCTTGAAGGAAATGGG - Intergenic
952699509 3:36311189-36311211 AAAATTTAGTTCAAGGAAATAGG + Intergenic
953590354 3:44246046-44246068 AATTTTTATTTGAAGTAATTAGG + Intronic
953837272 3:46357627-46357649 AAATTTGACGTGAAGCAAATTGG + Exonic
954991724 3:54846828-54846850 AAATTAGACTTGCAGTAAGTGGG - Intronic
955277585 3:57561659-57561681 AAGCTTTTCTTGAAGGGAGTGGG - Exonic
956080874 3:65554696-65554718 AAAGATTTCATGAAGGAAGTGGG - Intronic
956102701 3:65785192-65785214 TAATTTTTATTTAAGGAAGTAGG + Intronic
957080560 3:75632695-75632717 AAATTTTATTAGAAGAAAGAGGG + Intergenic
957246543 3:77723392-77723414 AAATTTTATGTGAAGCAATTTGG + Intergenic
957361068 3:79159044-79159066 AAATTTTACTTGAATAATATGGG - Intronic
959194677 3:103165067-103165089 AAAATTTACATGAAGAAAGATGG - Intergenic
959966131 3:112357375-112357397 AACATTTACTTCACGGAAGTTGG - Intronic
960454128 3:117849449-117849471 AAATTTCCCTTAAAGCAAGTTGG + Intergenic
960604831 3:119494668-119494690 ATAATTTATTTGAATGAAGTGGG + Exonic
961053953 3:123770680-123770702 AAAGTATAGTTGATGGAAGTTGG + Intronic
962055562 3:131867654-131867676 AATTTTTATTTGAGGGAGGTAGG + Intronic
962188010 3:133280474-133280496 AAAATTTTCTTGAAGGGAATGGG - Intronic
962959457 3:140297031-140297053 GAATTTCACCTGAAGGAAGCTGG - Intronic
964221456 3:154351428-154351450 AAATTTTATTTGAAAGATATAGG + Intronic
964373910 3:156030897-156030919 ACATTTCAATGGAAGGAAGTAGG + Intergenic
964423492 3:156529467-156529489 AAATTTTACCTCAATAAAGTTGG + Intronic
965918603 3:173883039-173883061 AAAATGTTCTTGAAGGAAATTGG - Intronic
966289487 3:178338755-178338777 AAATTTTGCTTGAAAGTAATAGG - Intergenic
967780211 3:193430114-193430136 AAATTCTATTTGAAAGAATTTGG - Intronic
970233520 4:13934549-13934571 AGATTTGACCAGAAGGAAGTAGG + Intergenic
970398130 4:15691485-15691507 AAATTCTACTAGCAGGAAATGGG - Intronic
970660201 4:18276893-18276915 AAAATTTACATGAAGAAAATTGG + Intergenic
971543042 4:27845806-27845828 AAATTGGACTTGGAGGAGGTGGG + Intergenic
971860766 4:32102426-32102448 AAAGTTTACTTGAACAAAATTGG + Intergenic
971944899 4:33261705-33261727 AAATTCTACCTGAATAAAGTGGG - Intergenic
972041136 4:34601330-34601352 AAATTTTAGTTGTAAGGAGTGGG - Intergenic
972098025 4:35373368-35373390 AAATATTACTTGAGGGATGGTGG + Intergenic
973017603 4:45160742-45160764 AAATTTCACTAGAAAGAACTTGG - Intergenic
974156216 4:58076505-58076527 AAGTTCTACTTAAAGTAAGTAGG + Intergenic
974173572 4:58295846-58295868 AAAATTAACTGGAAGGAAGCAGG - Intergenic
974854716 4:67446563-67446585 AAATTTAATTTGATGTAAGTGGG + Intergenic
975133733 4:70853549-70853571 AATTTTTACTTAGAGGAAGTTGG + Intergenic
975769198 4:77702937-77702959 AAATTATAACTGAAGGAATTTGG - Intergenic
976499635 4:85772543-85772565 ATATTTGACTTGATGGAACTAGG + Intronic
977448556 4:97163608-97163630 CTATTTTACTTGAAGGATCTAGG - Intergenic
977966722 4:103159214-103159236 AAGGTTTACTTGAAGAAATTGGG - Exonic
977975556 4:103261487-103261509 AGGTTTTACTTGAATGAAGCAGG + Intergenic
977994289 4:103483675-103483697 AAATTCTTCTTGGAGAAAGTAGG + Intergenic
979311727 4:119211723-119211745 AAAGTTTATTTGAAGAAAGAGGG - Intronic
979381434 4:120011352-120011374 AAATCTTCCTAGAAGTAAGTTGG + Intergenic
980736176 4:136892054-136892076 ACATTTTCCATGAAAGAAGTAGG + Intergenic
981189489 4:141844372-141844394 AAATTTGATTTGAAAGGAGTTGG + Intergenic
981683395 4:147426179-147426201 AAATTTTCCATGAAGGAGATGGG - Intergenic
981950887 4:150405713-150405735 ATATTTTACTGGAATTAAGTTGG + Intronic
982529604 4:156522565-156522587 AAAATTTACTTCAAGAGAGTTGG + Intergenic
983002757 4:162438817-162438839 AAATTTTGCATGAGGGAAGTAGG + Intergenic
983571962 4:169218866-169218888 AAATTTTGCTTTAAGTAATTAGG + Intronic
983574514 4:169246681-169246703 TAATTTGATTTGTAGGAAGTGGG - Intronic
984051206 4:174867618-174867640 AAATTGTACTTACAGGAAGCAGG + Intronic
984409119 4:179372231-179372253 AAATTCTACTGGCAGGAAGAAGG - Intergenic
984689480 4:182708947-182708969 ACATTTTACTAGAAAGCAGTGGG + Intronic
985436392 4:189933888-189933910 AAAGTTTACTTTGATGAAGTTGG - Intergenic
985450356 4:190058520-190058542 AAATTTTATTAGAAGAAAGAGGG - Intergenic
986090993 5:4506291-4506313 AAATTTTCCTTGCTGGAAGAAGG - Intergenic
987903671 5:24048968-24048990 AAATTTTACTTGGAAGAGATAGG + Intronic
987915661 5:24209832-24209854 AGATTATACATGAAGGAATTTGG - Intergenic
988184706 5:27845691-27845713 AAATTTTCATTGAACAAAGTGGG + Intergenic
988681207 5:33485834-33485856 GAGTTTTACTAGAAGGAAATCGG - Intergenic
990770747 5:59241694-59241716 AAATTTGACTTGAAATAAGTAGG + Intronic
991210038 5:64093333-64093355 AAATTTTACTTTAATGTGGTAGG + Intergenic
991284872 5:64961692-64961714 AAGTTTTAATTGAAGACAGTAGG + Intronic
991962281 5:72057114-72057136 AAATTATCCTTAAAGGAAGGAGG - Intergenic
992920361 5:81510464-81510486 AAATTTTACTTGGAGTAGGCTGG + Intronic
993277186 5:85875432-85875454 AAATTTTAATTGAAGCAAAAAGG + Intergenic
993512385 5:88787580-88787602 AAATTTTACTTCTAGGATATAGG - Intronic
993887703 5:93435679-93435701 AACTATGACTTGAAGGAAATGGG - Intergenic
993894554 5:93517632-93517654 AAATTTTAAAAGAATGAAGTAGG + Intergenic
994213115 5:97108207-97108229 AACTGTTACTAGAAGGAAGGTGG - Intronic
994243811 5:97455826-97455848 AAATTTTATTTGAAGCATGATGG - Intergenic
994429500 5:99639516-99639538 ATATTATACTTGAAGAAAATAGG + Intergenic
994502415 5:100596493-100596515 AACTTTTTCTAGGAGGAAGTAGG - Intergenic
995317372 5:110791114-110791136 AAATTATGCTTGAAGCAAGGTGG - Intergenic
995396861 5:111696421-111696443 AAAATTTACTTAAAGATAGTAGG + Intronic
996585416 5:125082618-125082640 AAATTATCCTTTAAGGAGGTTGG - Intergenic
996718310 5:126605333-126605355 AAATTTTTCTTTAAGGAACTGGG + Intronic
996806273 5:127457727-127457749 AAAATTTACTTCATGAAAGTGGG + Exonic
996812740 5:127536964-127536986 AGATTTTATTTGAAGTAAATGGG + Intronic
997370875 5:133358847-133358869 GCATTTTACTTAAAAGAAGTGGG - Intronic
997388701 5:133496176-133496198 ACATTCTACTTAAAGGAATTGGG - Intronic
998384911 5:141751520-141751542 ATAATTTACTAGAAGGAAGATGG + Intergenic
999519307 5:152334124-152334146 AAATTTTGCTTGAAGAATATTGG + Intergenic
1000480239 5:161764490-161764512 TAATGTTACATGAAGGTAGTAGG - Intergenic
1000832549 5:166121151-166121173 AGAATTTAGTTGAAGGAAGCAGG - Intergenic
1000977498 5:167781437-167781459 AAATAATATGTGAAGGAAGTAGG + Intronic
1002604541 5:180374704-180374726 AAGTTTTACCTGAATGAACTGGG - Intergenic
1003134421 6:3423309-3423331 TACTTTTTCTTGAAGGAAATAGG + Intronic
1003373637 6:5552881-5552903 AAATTTTGCTTCAGGGGAGTTGG - Intronic
1004704005 6:18106302-18106324 AAATTTTTTTTCAAGGAAGAAGG + Intergenic
1005237571 6:23782872-23782894 ATATTTTACTTTTGGGAAGTTGG - Intergenic
1007266691 6:40601670-40601692 AAACCTTACTTGATGGAGGTGGG - Intergenic
1008232320 6:48997422-48997444 AAATTTTTTTTGAGGGAACTAGG + Intergenic
1009334391 6:62468611-62468633 TTTTTTTACTGGAAGGAAGTAGG + Intergenic
1009348178 6:62643283-62643305 ATATTTTACTTGAAGACAGAGGG - Intergenic
1009835569 6:68996826-68996848 AAATCTTATTTGCAGGAGGTGGG - Intronic
1010211768 6:73367831-73367853 AAATTCTACTTCCAGAAAGTGGG + Intergenic
1010579636 6:77578800-77578822 AAGTTTTATTTCAAGGAATTTGG - Intergenic
1010702060 6:79062518-79062540 AAATTTTACTTTAAAGAAGATGG + Intronic
1011811394 6:91136121-91136143 AAAATATACTCGGAGGAAGTGGG + Intergenic
1012465561 6:99513454-99513476 AAATTTAAATTGATGGAGGTAGG - Intronic
1012578450 6:100832263-100832285 AAATGATGCTGGAAGGAAGTGGG + Intronic
1015398587 6:132762941-132762963 ATATTTTATTTTAAGGAAGCAGG - Intronic
1015992676 6:138963191-138963213 AAATGTTACAGGAAGGAAGTAGG - Intronic
1016699067 6:147033582-147033604 ATAATTTACTTAAAGGAAGCAGG + Intergenic
1017583559 6:155894816-155894838 AAATTTTATTTGAATGTATTAGG + Intergenic
1017673476 6:156790481-156790503 AATTTTGAGTTGAAGGAAATGGG + Intronic
1018486150 6:164242976-164242998 TAATGTTACTGTAAGGAAGTAGG - Intergenic
1019836312 7:3388405-3388427 AAATTTTATTTGAAGAGACTGGG + Intronic
1020497218 7:8870977-8870999 AAAGTTAACTTGAAGGAAGCAGG - Intergenic
1021423263 7:20469263-20469285 AAACTTAGCTTGAAGGAAGGAGG + Intergenic
1022213848 7:28238388-28238410 AAATTTTTCTTAAAGTAAGATGG - Intergenic
1022264496 7:28740864-28740886 AAATTTTAATTAAATGTAGTTGG + Intronic
1022801830 7:33783952-33783974 AAATATTCCTTGAAGTAACTGGG - Intergenic
1023427877 7:40058292-40058314 AAATTTTATTTGATTGCAGTGGG + Intronic
1025711659 7:63916700-63916722 AAAATTTATTTGGAGGAAGTGGG - Intergenic
1025854491 7:65265556-65265578 AGATTTTATTAGAAGGAAGAGGG + Intergenic
1027707912 7:81557029-81557051 AAATTTTAATTGAAGCAGTTCGG - Intergenic
1027818529 7:83012274-83012296 AATTGTTACTTGGAGGAAATAGG + Intronic
1027844830 7:83359668-83359690 AAATTTTCATTTCAGGAAGTAGG + Intergenic
1028315040 7:89391134-89391156 AATATTTCCTTGAAGCAAGTTGG + Intergenic
1028936995 7:96476309-96476331 AAGTTCTACTTGAAATAAGTCGG + Intergenic
1029225483 7:99024592-99024614 ACATTATACCTGAAGGAATTAGG + Intergenic
1030460894 7:109834637-109834659 AGTTTTTACTTAAAGGAAGCTGG - Intergenic
1030655869 7:112167214-112167236 AAAAATTCCTTGGAGGAAGTTGG - Intronic
1030944094 7:115694593-115694615 AAATTTGACTTGATTAAAGTAGG - Intergenic
1031822574 7:126522760-126522782 AAACTGTCCATGAAGGAAGTGGG - Intronic
1032926975 7:136617995-136618017 AAATTTTAGTTGAAGGATAGAGG + Intergenic
1033123841 7:138689878-138689900 AAATTATACTTGAGTGGAGTGGG + Intronic
1033580564 7:142729301-142729323 AGATTTTACTTGAAGAGATTTGG - Intergenic
1034141716 7:148824890-148824912 ATATTTTACTTTAATAAAGTTGG - Intronic
1034721995 7:153301832-153301854 AAAATTAAATTAAAGGAAGTGGG - Intergenic
1034786051 7:153926574-153926596 GACTGTTACTTGAAGGAAGGGGG + Intronic
1036480894 8:9138808-9138830 CAAGTATACTTGTAGGAAGTTGG - Exonic
1037281073 8:17242983-17243005 AAATTTAATTTGACGTAAGTGGG - Exonic
1038182252 8:25240293-25240315 AAATTACACTTGACGGAAGCTGG - Intronic
1038721883 8:30044396-30044418 AAATTTCAATTCTAGGAAGTAGG + Intergenic
1038926552 8:32146575-32146597 AGATTTTTCTTGAAGGGAATTGG + Intronic
1039285817 8:36039753-36039775 AAATTCTACTGACAGGAAGTAGG + Intergenic
1039673594 8:39633720-39633742 AAATTTTACTATAAATAAGTAGG - Intronic
1039684810 8:39788525-39788547 AAATTTTACTTATCTGAAGTGGG - Intronic
1041978442 8:63826747-63826769 AAATTTTACTTCAAGTCAGTTGG + Intergenic
1042516060 8:69660957-69660979 CAATTTTACTTGCAAGAAATGGG - Intergenic
1042590329 8:70392103-70392125 AAATTTTTCATAAAGAAAGTTGG + Intronic
1042695478 8:71549550-71549572 AAATTTTATTTGAGGGAGGAGGG + Intronic
1043363641 8:79504751-79504773 ACTTTTTATTTGAAGGCAGTAGG - Intergenic
1043957969 8:86384419-86384441 AGATTTTAATTTAAGTAAGTTGG + Intronic
1044410664 8:91879082-91879104 TTATTTTTCTTGAAGTAAGTAGG + Intergenic
1044536453 8:93361967-93361989 AAAATGTATTTGAAGGAATTAGG - Intergenic
1044572634 8:93736640-93736662 AAATGTTTCTTCAAGGTAGTTGG - Intronic
1045352370 8:101353497-101353519 AAATTTTATTTGAAAAAAGGAGG + Intergenic
1045916698 8:107480767-107480789 AAATTTTAATTTAAACAAGTGGG + Intronic
1046446392 8:114325917-114325939 ACATTGTGCTTGAAGGCAGTTGG + Intergenic
1046859564 8:119075221-119075243 AAATTCTACTTGTAGAAACTTGG + Intronic
1047838635 8:128721839-128721861 AAATTTTATTTTTAGTAAGTAGG - Intergenic
1048242631 8:132758205-132758227 AGACTTTACTTGGAGAAAGTTGG + Intronic
1048687626 8:136921736-136921758 AAATATGACTTGAAGTCAGTAGG + Intergenic
1050172999 9:2842370-2842392 AACTTTTTCCTGAAGGCAGTGGG - Intronic
1051493424 9:17692650-17692672 AAAAATTACTTGGAGAAAGTAGG + Intronic
1051835219 9:21329501-21329523 AAATATTACTGTAAGCAAGTGGG + Intergenic
1052048262 9:23820195-23820217 AGATTTTACTTGAGGGAATGGGG + Intronic
1052532240 9:29701489-29701511 AATTTTCACTTGAGGGAAGAAGG - Intergenic
1053080493 9:35172007-35172029 AAATTTTAAATGAAGGAAATAGG - Intronic
1055543807 9:77345276-77345298 AAAATGTACTTGAAGCATGTAGG + Intronic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1057882515 9:98803166-98803188 AAATTTTAATTTAAAAAAGTTGG - Intergenic
1058326710 9:103707426-103707448 AGATTCTACTGGCAGGAAGTAGG - Intergenic
1059149999 9:111940778-111940800 AAATGTTAAGTGAAAGAAGTTGG + Intergenic
1060955733 9:127637960-127637982 AAATTGTATTTGTGGGAAGTGGG - Intronic
1061458863 9:130720074-130720096 AAATGTTTGTTGAAGGAAGAAGG - Intronic
1203531593 Un_GL000213v1:148198-148220 CACTTTTACATAAAGGAAGTAGG - Intergenic
1186033288 X:5392848-5392870 ACATTGTACTTGCAGGAATTTGG + Intergenic
1186598930 X:11015443-11015465 AACTTTAACTTCAAGGAACTGGG + Intergenic
1187940183 X:24373626-24373648 AAATCTTACTGGATGGAATTGGG + Intergenic
1189752428 X:44235952-44235974 ATTTTTCCCTTGAAGGAAGTTGG - Intronic
1189789329 X:44588461-44588483 AAATTCTACTCACAGGAAGTAGG + Intergenic
1192034215 X:67545798-67545820 TAATTGTCCTTGGAGGAAGTGGG - Exonic
1193905893 X:87243681-87243703 ATCTTTTCCTTCAAGGAAGTGGG + Intergenic
1194042077 X:88953427-88953449 AAATTTTATGTTAAGAAAGTTGG - Intergenic
1194579762 X:95657732-95657754 TGATATTACTTGGAGGAAGTAGG + Intergenic
1196695415 X:118606468-118606490 AATTTTTACTTGAAAGAATAAGG + Intronic
1197506833 X:127316113-127316135 AAATTTTAGTGTAAGGAGGTAGG + Intergenic
1197948678 X:131870992-131871014 AAATTTTACATAAAGGAAATGGG - Intergenic
1198639479 X:138741114-138741136 TATTTTTGTTTGAAGGAAGTTGG - Intronic
1200172469 X:154087397-154087419 ATTTTTTACTTAAAGGAAGAGGG - Intronic
1201863044 Y:18620507-18620529 AAATTTAACTTAAAGGAAATTGG - Intergenic
1201870279 Y:18699871-18699893 AAATTTAACTTAAAGGAAATTGG + Intergenic