ID: 1166867428

View in Genome Browser
Species Human (GRCh38)
Location 19:45848485-45848507
Sequence TCTGTGCTTAGCCCTGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 15, 3: 79, 4: 628}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867428_1166867433 -9 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867433 19:45848499-45848521 AAGCACAGAGGACATACTCAGGG 0: 1
1: 0
2: 2
3: 18
4: 248
1166867428_1166867436 26 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1166867428_1166867437 30 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867437 19:45848538-45848560 ATAAACGGATGGTCAATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 176
1166867428_1166867434 15 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867434 19:45848523-45848545 ATGTCTGTTGAGTGAATAAACGG 0: 1
1: 3
2: 27
3: 173
4: 803
1166867428_1166867435 19 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867435 19:45848527-45848549 CTGTTGAGTGAATAAACGGATGG 0: 1
1: 0
2: 0
3: 35
4: 268
1166867428_1166867432 -10 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867432 19:45848498-45848520 TAAGCACAGAGGACATACTCAGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867428 Original CRISPR TCTGTGCTTAGCCCTGGGCT AGG (reversed) Intronic
900315323 1:2053432-2053454 TGTGTGCAAAGCCCAGGGCTTGG + Intronic
900556820 1:3284819-3284841 TCTCTGCTCTGCCCTGGCCTGGG - Intronic
900649248 1:3722953-3722975 TCTGTGCCTGGCACAGGGCTGGG + Intronic
900653724 1:3744780-3744802 ACTGTGTTCAGGCCTGGGCTGGG - Intergenic
900957792 1:5898275-5898297 TCCCTCCTTGGCCCTGGGCTTGG - Intronic
901309656 1:8259213-8259235 TATGTGCTGAGCCCTGTGTTTGG - Intergenic
901439759 1:9270720-9270742 TCTGTGCTCTGCCCCGCGCTAGG + Exonic
901844538 1:11973522-11973544 TTTGAACTTAGCCCTGGGCTGGG + Intronic
902180853 1:14687262-14687284 GCTGTGACTGGCCCTGGGCTAGG + Intronic
902470145 1:16643371-16643393 TCTCTGCCCAGCCCTGTGCTGGG - Intergenic
902628696 1:17692009-17692031 TCTCTTCTTAGCCCTGGTCAAGG - Intronic
902663937 1:17924413-17924435 CCAGTGCTGAGCCCTGGGCAAGG + Intergenic
902831161 1:19013773-19013795 CCTGGGCTTAGCACAGGGCTGGG - Intergenic
902836340 1:19049281-19049303 CCTGTGCCAAGCCCTGAGCTGGG - Intergenic
902873082 1:19325852-19325874 TCTGTGTCCGGCCCTGGGCTTGG + Intronic
903607347 1:24584646-24584668 TCTGTGGTCAGTGCTGGGCTAGG + Intronic
903689674 1:25163957-25163979 TCTCTGCTTAACCTTGGCCTTGG - Intergenic
903890883 1:26569750-26569772 TCTGTGCTAGGCCCTGCACTGGG + Intronic
903947206 1:26971416-26971438 TCAGTGCTTGGCCCAGGGCTAGG - Intergenic
904203896 1:28840039-28840061 TCTGAGCCTGGCCCTGTGCTGGG + Intronic
904391572 1:30189499-30189521 TCTGGGCCTAGCCCTGGGGCAGG - Intergenic
904407654 1:30303707-30303729 TCTGTGCTTGGCACTGTCCTAGG + Intergenic
904411324 1:30326652-30326674 TGTGTGCAGGGCCCTGGGCTAGG - Intergenic
904468746 1:30723139-30723161 CATGGGCTCAGCCCTGGGCTTGG + Intronic
904482774 1:30804597-30804619 TCTGTGCTGGGGCCTGAGCTTGG + Intergenic
904492191 1:30868039-30868061 TCTGTGCCTGGCTCTGTGCTTGG - Intergenic
904593069 1:31626066-31626088 TATGTGCTTGACCCTGTGCTGGG + Intronic
904624225 1:31793143-31793165 TCTGTGCCTGGCCCTGTGCAGGG - Intronic
904853508 1:33477760-33477782 TATGTGCTGAGCACTGTGCTAGG + Intronic
905340047 1:37272068-37272090 GGTGAGCTTGGCCCTGGGCTGGG + Intergenic
905480899 1:38261330-38261352 TCTGTGCCATGCCCTAGGCTGGG - Intergenic
905528235 1:38655625-38655647 TGTGGGCTTACCCCTGTGCTGGG + Intergenic
905785088 1:40749063-40749085 TATATGCCAAGCCCTGGGCTGGG + Intronic
906238088 1:44223752-44223774 CCTGTGCCTGGCCCTGTGCTGGG + Intronic
906301071 1:44682068-44682090 TCTGAGCCGAGCACTGGGCTTGG - Intronic
906400136 1:45498504-45498526 TCTGGGCTTGGGCTTGGGCTTGG + Intronic
906534740 1:46545160-46545182 ACTGTGCCCAGCCCTAGGCTGGG - Intergenic
906645925 1:47474833-47474855 TCTTTGCTTTGCCCTATGCTGGG + Intergenic
906665447 1:47618288-47618310 TCTGTGCTAGGCACTTGGCTGGG + Intergenic
906795667 1:48694705-48694727 TCTGTGCCAGGCCCTGGGCCAGG + Intronic
906802584 1:48750627-48750649 TCCGTGCCTAGCACAGGGCTCGG + Intronic
906802586 1:48750633-48750655 TCTGTTCCGAGCCCTGTGCTAGG - Intronic
906824354 1:48962670-48962692 TCTGTGCATAGGCCTGCACTTGG + Intronic
906978968 1:50607902-50607924 TCTGTGCTAAGCCCTAGTTTTGG - Intronic
907221076 1:52907326-52907348 TTTGTGCCAAGCCCTGTGCTGGG + Intronic
907274718 1:53310830-53310852 TCTGTGCTGGGCCCTGTGATGGG + Intronic
907434148 1:54433299-54433321 TCTGCTCTTAGCCCTGGGGGTGG + Intergenic
907812415 1:57884374-57884396 TCTGTGCCTAGCACTGTGCTAGG + Intronic
908776810 1:67648644-67648666 TCTGTGCCACGCCCTGTGCTGGG + Intergenic
909420285 1:75457008-75457030 TCTGTGCTTCCTCATGGGCTTGG - Intronic
910083394 1:83370576-83370598 TCTGTGCCAAGCACTGTGCTAGG + Intergenic
911924626 1:103814137-103814159 TCTGTGCTTGGCACTGTGCTGGG + Intergenic
912722835 1:112034528-112034550 TCTATGCATAGTCCTGGGATAGG + Intergenic
912825953 1:112903426-112903448 TGTGTGCCAGGCCCTGGGCTAGG - Intergenic
913184777 1:116360288-116360310 TCTGTGCTTAGCACTGATCGAGG - Intergenic
914462531 1:147898228-147898250 TGTGTGCTTGGCACTGTGCTGGG - Intergenic
915130703 1:153693621-153693643 CCTGTGCATGGCCGTGGGCTTGG - Exonic
915579929 1:156807506-156807528 TCTGTGCCAGGCACTGGGCTGGG + Intronic
915778161 1:158514137-158514159 TCTGTGAATAGCACTGTGCTGGG + Intergenic
915871138 1:159560722-159560744 CCTGTGCTTAGCACAGGGCCTGG - Intergenic
915918700 1:159958133-159958155 GCTGTGCACAGCCATGGGCTGGG + Intergenic
915921859 1:159981751-159981773 TCTGTGCTCAGTCATTGGCTGGG - Intergenic
916171773 1:162006618-162006640 CCGGTGCTCAGCCCAGGGCTGGG - Intronic
916535167 1:165697181-165697203 TGTGTGCTAAGCACTGTGCTAGG - Intronic
917306052 1:173626652-173626674 TCTGTGCTTATCCCTTTGCTTGG + Intronic
917431602 1:174975133-174975155 TCTGTACTTGGCATTGGGCTTGG + Intronic
917480016 1:175403797-175403819 TCTGTGCCTAGCACAGGGCTGGG + Intronic
917484500 1:175443494-175443516 TGTGTGCTTAGCTCTGTGGTTGG + Intronic
918048084 1:180953385-180953407 TGTGTGCCTCCCCCTGGGCTGGG - Intergenic
918116606 1:181503333-181503355 CCTGTTCTTAGCCCTGGCCTGGG + Intronic
919232285 1:194789531-194789553 TCTTTAATTATCCCTGGGCTGGG - Intergenic
919827523 1:201514011-201514033 TATGTGCCAAGCACTGGGCTAGG + Intergenic
920025203 1:202988915-202988937 CCTCGGCTTAGGCCTGGGCTAGG + Intergenic
920048685 1:203150346-203150368 TGTGTGCTCTGCCCTGGCCTGGG + Intronic
920275303 1:204800006-204800028 TCTGTGCCTGGCTCTGGGCTTGG + Intergenic
920741128 1:208582226-208582248 TCAGTGCTTAGCCCTGTACTTGG - Intergenic
921913763 1:220582450-220582472 TCTTTGCCTACCCCTGTGCTGGG + Intronic
922555733 1:226530793-226530815 TCTGTGCTCAGCCCTGGGTGTGG + Intergenic
923273453 1:232377432-232377454 TAAGTGCCTAGGCCTGGGCTGGG - Intergenic
923363091 1:233231999-233232021 TATGTGCATGGCACTGGGCTAGG - Intronic
924474492 1:244371293-244371315 TCTGAGCAGAGCCCTGAGCTGGG + Intronic
924535823 1:244934872-244934894 TCAGTGCTTACCACTGTGCTTGG - Intergenic
1063709757 10:8465792-8465814 CCTGTGGTTAGCCTTGGTCTAGG + Intergenic
1064243323 10:13650039-13650061 TCTGAGCATAGCCCTGGGAAAGG - Intronic
1064269985 10:13856380-13856402 TATGTGCCTGACCCTGGGCTAGG + Intronic
1066596041 10:37050864-37050886 TCTGTGCTTGACCCTGTCCTAGG + Intergenic
1067430067 10:46236962-46236984 TCTGTGCTCAGCCTTGAACTTGG - Intergenic
1067453038 10:46394022-46394044 TCTGTGCTTACACCTGGTCACGG + Intergenic
1067467383 10:46511108-46511130 TCTGTGCTGGGCCCTGGGAATGG + Intergenic
1067619803 10:47873497-47873519 TCTGTGCTGGGCCCTGGGAATGG - Intergenic
1069089084 10:64177582-64177604 TCTATCCTTAGCCCTGGATTAGG + Intergenic
1069551977 10:69370566-69370588 TATGTGCTGAGCTCTGTGCTAGG + Intronic
1070154811 10:73826856-73826878 TCCATGCCTAGCCCTGGGTTTGG - Intronic
1070642829 10:78181569-78181591 TCTGTGCCTAGCACAGGGCTGGG - Intergenic
1070714407 10:78708616-78708638 TCTGTGCCAGGCCTTGGGCTAGG + Intergenic
1070752046 10:78969671-78969693 TCTGTGCTCAGCCTTGGGCTGGG + Intergenic
1070754128 10:78981271-78981293 TGTGTGCTGAGCACTGAGCTAGG - Intergenic
1070762862 10:79035585-79035607 TCTGTGCCCAGCCCTGGGGTGGG + Intergenic
1071215716 10:83398616-83398638 TATGTACATGGCCCTGGGCTGGG + Intergenic
1071253112 10:83841082-83841104 TGTGTGCTTGACCCTGTGCTAGG - Intergenic
1072237399 10:93465439-93465461 TGTGTGCCAGGCCCTGGGCTGGG - Intronic
1072608008 10:96999883-96999905 TATGTGCCTAACCCGGGGCTGGG - Exonic
1072608264 10:97001100-97001122 TCTGCGCATAGCGCTGGGCGTGG - Exonic
1072785429 10:98276566-98276588 TCTGTGCTAAGTCTTGGGCATGG + Intergenic
1072853276 10:98920123-98920145 TCTGTGCTTAGTCATTGCCTGGG - Intronic
1073097116 10:100986736-100986758 ACTGTGCTTGCACCTGGGCTGGG + Exonic
1073445880 10:103580052-103580074 TGTGTGCCCAGCCCTGGGCAGGG - Intronic
1073463243 10:103678536-103678558 TCAGTGCTCAGCCCTGGCCCTGG + Intronic
1074684610 10:115949400-115949422 TCTCTGGTAAGCTCTGGGCTTGG + Intergenic
1074774787 10:116759525-116759547 TCTGGGCTTACCTCTGAGCTGGG + Intergenic
1075236222 10:120731803-120731825 GCTGTGCCAAGCACTGGGCTAGG + Intergenic
1075391903 10:122098096-122098118 TGTGTGCTGGGCCCTGGGCTGGG - Intronic
1076162984 10:128260306-128260328 TCTGTGCATACCCCTTAGCTAGG + Intergenic
1076307816 10:129477062-129477084 TCTGTGCTCTGCCCTGAGGTTGG + Intronic
1076401597 10:130188943-130188965 GCTGTGCTTAGGCCTGGGGTGGG + Intergenic
1076871784 10:133198176-133198198 TCTGTGCTGGGCCCTGGAATGGG - Intronic
1076892938 10:133293666-133293688 TCAGTGCTCAGCCCCTGGCTGGG - Exonic
1077653727 11:3998527-3998549 TCTGTGCCGGGCCCTCGGCTTGG + Intronic
1077660579 11:4065098-4065120 AGTGTGCTTAGTCCTGGGCTAGG + Intronic
1078101900 11:8334886-8334908 TCTGTGCCTGGCCCTGGGTTGGG + Intergenic
1078159467 11:8828356-8828378 GCTTTGCTTTGCCCAGGGCTGGG - Intronic
1078535596 11:12170891-12170913 CCTGTGCCAAGCCCTGTGCTGGG - Intronic
1079100177 11:17536461-17536483 TCTGTGCTTGGCCCAGGGAAGGG - Intronic
1080110974 11:28567514-28567536 TATGTACTGAGCACTGGGCTAGG + Intergenic
1080742367 11:35078492-35078514 TCTGTGCTCAGCCCTTCTCTGGG - Intergenic
1080896086 11:36449763-36449785 GCTGTCCTCAGCCCTTGGCTTGG - Intronic
1081444331 11:43115864-43115886 TCTGTGCTTAGCACAGTGCATGG + Intergenic
1081665193 11:44912514-44912536 CCTGTGGATAGCCCTGGTCTGGG - Intronic
1082966532 11:58971999-58972021 TCTGTCCCTAGCCCGTGGCTAGG - Intronic
1082990039 11:59199494-59199516 TGTGTCCTTAGACCTGGGTTTGG - Intronic
1083146855 11:60766454-60766476 TCTATGCTAAGCACTGTGCTGGG - Intronic
1083298795 11:61729451-61729473 TGTGTGCTGGGCCCTGGGCTGGG - Intronic
1083745906 11:64736416-64736438 TCTAAGCATGGCCCTGGGCTCGG - Intronic
1083982515 11:66184822-66184844 TCTGTACTTAGCTCTGTGCTAGG - Intronic
1084177768 11:67432409-67432431 TCGGTGCCTGGCCCTGTGCTGGG - Intronic
1084406720 11:68978572-68978594 TTTGTTCATTGCCCTGGGCTGGG - Intergenic
1084419029 11:69051056-69051078 TCTGTGCTGAGGCCTGTGCCAGG + Intronic
1084432224 11:69117489-69117511 CCTGTGCTCAGCCCTGAGCGAGG + Intergenic
1084458451 11:69282829-69282851 ACTGTGCTGAGCCCTGGGCTGGG - Intergenic
1084933386 11:72574317-72574339 GATGTGCTGTGCCCTGGGCTGGG - Intergenic
1085154627 11:74282273-74282295 TCTGTGCTAAGCACTGTGCTAGG + Intronic
1085266980 11:75242850-75242872 GCTGTGCTTGTCCCTGGGATGGG - Exonic
1085445259 11:76597147-76597169 TCTCTGCTGGGCCCTGTGCTTGG - Intergenic
1085462527 11:76702665-76702687 TCTGTGCCTGACCCTGTGCTGGG - Intergenic
1085464223 11:76713278-76713300 TCCATGCTTAGCCTTGTGCTTGG - Intergenic
1085893683 11:80611263-80611285 TCTGTGCTTGACCCTGTCCTAGG - Intergenic
1086145688 11:83548930-83548952 TCTGTGCTGAGACTTGGTCTGGG - Intronic
1086169627 11:83821057-83821079 TGTGTGCCTAGCACTGGGTTAGG + Intronic
1086690150 11:89780630-89780652 TGTGTGATTAGCTCTGGGCCTGG + Intergenic
1086698511 11:89872342-89872364 TGTGTGATTAGCTCTGGGCCTGG - Intronic
1086707653 11:89972144-89972166 TGTGTGATTAGCTCTGGGCCTGG + Intronic
1086715704 11:90059327-90059349 TGTGTGATTAGCTCTGGGCCTGG - Intergenic
1086930322 11:92685669-92685691 TTTGTGCTTAGCACAGGGCCTGG - Intronic
1087315716 11:96600044-96600066 GCTGTGCTTAGTCATAGGCTAGG + Intergenic
1087996992 11:104821628-104821650 TATGTGCTAAGCACTGTGCTAGG - Intergenic
1088064638 11:105701262-105701284 TCTGTGCTTAACACAGTGCTTGG + Intronic
1088598445 11:111456474-111456496 TGCCTGCTCAGCCCTGGGCTGGG - Intronic
1088882775 11:113984511-113984533 TCTGTGCCAGGCCCTGTGCTGGG - Intronic
1089043699 11:115480388-115480410 CCTGGTCTTAGCCCTGGCCTTGG + Intronic
1089124994 11:116170658-116170680 CCAGTGCCTAGCCCTGTGCTTGG + Intergenic
1089309874 11:117551004-117551026 TCTGTCCTCAGCCATGGGCTGGG + Intronic
1089342267 11:117766151-117766173 TCTGTGCGGAGGCCTGTGCTGGG - Intronic
1089343107 11:117773011-117773033 GCTGTGCTTTGCCCAGGGCAGGG - Intronic
1089778168 11:120853877-120853899 TGTGTGCTCAGCACTGGGCTAGG - Intronic
1089814901 11:121163879-121163901 TATGTGCTTAGCACTGTGCTAGG + Intronic
1090240074 11:125175546-125175568 TCTGTGCTGAGCCCTGTGCTGGG + Intronic
1090393621 11:126405448-126405470 CCTGAGCTTAGCCCATGGCTGGG + Intronic
1090416457 11:126543840-126543862 TCTCTGCTCGGCCTTGGGCTGGG + Intronic
1090613447 11:128492875-128492897 TGTGTGTTTAGCCATGTGCTGGG - Intronic
1091140643 11:133231577-133231599 GCTGTGCTTAACACTGAGCTAGG - Intronic
1091347146 11:134863190-134863212 ACTGTGCACAGCCCTGAGCTGGG + Intergenic
1091437016 12:480982-481004 TGTGTGCTTAGCCCAGGGGTGGG + Intronic
1091622001 12:2096001-2096023 TCTGTGCCTAGCCCAGAGCCTGG - Intronic
1091778345 12:3199104-3199126 TGTGTGCTAAACCCTGGGCCAGG - Intronic
1092132314 12:6121108-6121130 GCTGAGCTTAGCCCTGGTGTGGG - Intronic
1092654340 12:10668896-10668918 TCTGTGCCTACTTCTGGGCTGGG - Intronic
1094385949 12:29894252-29894274 TCAGTACTTAGCCCTAGGCTGGG - Intergenic
1094424672 12:30305583-30305605 TCAGTTCTTAGCTCTGGCCTGGG - Intergenic
1095945969 12:47753579-47753601 TCTGTGTCTGGCACTGGGCTGGG - Intronic
1095950524 12:47779453-47779475 TCTGTGCTCAGCTCTGGGATGGG + Intronic
1096186432 12:49584707-49584729 TCTGGGCTCAGCTCTGGACTTGG - Intronic
1096235369 12:49922697-49922719 TATGTGCTAGGCACTGGGCTGGG + Intergenic
1096463119 12:51833702-51833724 TCTCTGCTTAGCCGTTGCCTCGG + Intergenic
1096550699 12:52369950-52369972 GCAGTGCTGAGCCCAGGGCTGGG + Intergenic
1097445354 12:59664885-59664907 TCTCTTCTTAGCCCTGAGCCTGG + Intronic
1098231117 12:68372788-68372810 TCAGTGCTTAGCCCAGTGCCTGG - Intergenic
1098234120 12:68402099-68402121 TCTGTGCCAAACCCTGTGCTCGG + Intergenic
1098884352 12:75945246-75945268 TATGTGCTAAGCACTGTGCTAGG + Intergenic
1100201675 12:92305501-92305523 GCTGTACTTTCCCCTGGGCTGGG + Intergenic
1100243494 12:92733290-92733312 TGTGTGCTCAGCTCTGGGGTAGG - Intronic
1100330915 12:93581366-93581388 TCTGCTCTAAGCACTGGGCTTGG - Intronic
1101078504 12:101156474-101156496 TCTGTTTATTGCCCTGGGCTTGG - Exonic
1101406728 12:104435279-104435301 CCTGAGCTTAACCCTGGGATAGG - Intergenic
1102468131 12:113142506-113142528 TGTCTGCTTTGCCCTGGTCTTGG - Intergenic
1102470783 12:113158782-113158804 TGTGTGCCTGGCCCTGTGCTGGG - Exonic
1103042202 12:117705020-117705042 TTTGTGCCAGGCCCTGGGCTAGG + Intronic
1103470455 12:121176184-121176206 TCTCTGCTGGCCCCTGGGCTAGG - Intronic
1103494613 12:121352056-121352078 TCTGTGCGGAACCCTGGGCTTGG - Intronic
1104312960 12:127670900-127670922 TCAGTGCTCAGCCCGTGGCTGGG - Intergenic
1104831012 12:131751469-131751491 TGTGTGCTTAGCTCTGGGGAGGG - Intronic
1105285319 13:18998621-18998643 TCTGTCTTTAGCCCTGGGCATGG - Intergenic
1106218366 13:27722912-27722934 TTGGTGCTTAGCTCTGGGTTTGG + Intergenic
1106614162 13:31310887-31310909 TCTGTGCTCAGCCCATAGCTGGG - Intronic
1108185976 13:47888787-47888809 TCTGTGCTTGGGGCTGGGCAGGG - Intergenic
1109728776 13:66382311-66382333 TCTTTCCTTACCCATGGGCTAGG - Intronic
1110517169 13:76427678-76427700 TCTGTGCCCAGCACTGTGCTAGG + Intergenic
1111555483 13:89875846-89875868 TCCGTGCTTAGCTGAGGGCTTGG - Intergenic
1112442700 13:99435655-99435677 TGTGTGCATAGCACTGCGCTTGG - Intergenic
1112972712 13:105280533-105280555 TATGTGATAGGCCCTGGGCTAGG - Intergenic
1114218608 14:20676908-20676930 TCACTGCCTAGCACTGGGCTGGG - Intergenic
1114487716 14:23073266-23073288 TTTGTGTTAGGCCCTGGGCTAGG - Intronic
1114650944 14:24284352-24284374 TGTGTGCTCAGCACTGGGCAGGG - Intergenic
1114666664 14:24381432-24381454 TCTGTGCCAAGCCCTGTGCTAGG + Intergenic
1114668770 14:24398198-24398220 TCTGGGACTAACCCTGGGCTAGG - Intergenic
1119082587 14:71709692-71709714 ACTGGGCTTAGGTCTGGGCTGGG - Intronic
1119466024 14:74859373-74859395 TTTGTGCCTAGCCCAGTGCTAGG + Intronic
1119466025 14:74859379-74859401 TATGTTCCTAGCACTGGGCTAGG - Intronic
1119726200 14:76923116-76923138 TTTCTGCTTAGCTCTGGCCTTGG - Intergenic
1120190384 14:81435394-81435416 TGAGTGCTTAGCGCTGTGCTGGG + Intronic
1120219742 14:81718847-81718869 TCTCTCCTTTGCTCTGGGCTTGG + Intergenic
1120988064 14:90351498-90351520 TCTCTCCTAAGCACTGGGCTAGG - Intergenic
1121059401 14:90891183-90891205 TCTGTGCCAGGCCCTGGGGTAGG - Intronic
1121175820 14:91889963-91889985 TCTGTGCCAAGGCCTGGGATTGG - Intronic
1121276320 14:92670467-92670489 TCAGGGCTTAGCCCTGAGCCTGG + Intronic
1121278869 14:92686015-92686037 TCTGTCCCAGGCCCTGGGCTTGG - Intronic
1121700954 14:95953651-95953673 TCTGTGCTTGGCCCTGGACTGGG - Intergenic
1121870726 14:97404468-97404490 TCTGTGCAAGGCCCTTGGCTGGG + Intergenic
1122087681 14:99318813-99318835 GGTGTGCTTGGCCCTTGGCTGGG - Intergenic
1122199821 14:100115627-100115649 TCTCTGCTAAGCCCAGGGCCAGG + Intronic
1122215621 14:100202011-100202033 TGTGTGCTTGGCACTGTGCTGGG - Intergenic
1122350126 14:101084202-101084224 TCTGTGCCTGGCTCTAGGCTGGG + Intergenic
1122485602 14:102077553-102077575 TCCGTGCCTAGCCCTTGGTTGGG + Intergenic
1122606324 14:102949022-102949044 TCTGGGCTCAGGCCGGGGCTGGG - Intronic
1122771965 14:104101579-104101601 TCTGTGCTGAGCCCTGACCCCGG + Intronic
1122818422 14:104326969-104326991 TCTGTGCTTAGCCCTGAGGCTGG + Intergenic
1124208061 15:27740227-27740249 TCTGTGACCAGCCCTGTGCTTGG + Intergenic
1125180033 15:36871903-36871925 TATGTGCCTGGCCCTGTGCTAGG - Intergenic
1125597011 15:40893842-40893864 TCTGTGCCAGGCCTTGGGCTGGG - Intergenic
1127801206 15:62478862-62478884 TATATGCTTAGTTCTGGGCTGGG + Intronic
1127857372 15:62963438-62963460 ACTGAGCTGAGCCCTGAGCTAGG - Intergenic
1128142126 15:65309675-65309697 TCTCTGCTGGGCCCTGGGCCTGG + Intergenic
1128519118 15:68364017-68364039 TATGTGCTAAGCCCAGTGCTGGG - Intronic
1128536133 15:68491980-68492002 TCTGTGCCTGTCACTGGGCTTGG - Intergenic
1128645609 15:69376723-69376745 TCTGGGCTCAGCCCTGGCTTTGG + Intronic
1128866305 15:71117183-71117205 TCTGTGCCCAGCACTGGGCGGGG + Intronic
1129156357 15:73720694-73720716 TCTGTGCCCGGCTCTGGGCTTGG - Intergenic
1129412948 15:75359849-75359871 TCTGGGCTCAGCCCTGGGGTTGG + Intronic
1129448358 15:75634616-75634638 TCTGTGCCAAGCACTGGGCTAGG + Intergenic
1129546224 15:76398449-76398471 TCTGTGCCAGGCCCTGTGCTAGG - Intronic
1129691825 15:77718103-77718125 TGTGAGCTCAGGCCTGGGCTGGG - Intronic
1129714216 15:77837637-77837659 TGTGTGCCCAGCCCTGTGCTTGG + Intergenic
1129787734 15:78320629-78320651 TCTGTGCCATGCCCTGGGCTAGG + Intergenic
1130867338 15:87944069-87944091 CCTGTCCTTAGCCCTGGGTAGGG + Intronic
1130920133 15:88336817-88336839 TATATGCTTAGCACTGGGCCTGG - Intergenic
1130980596 15:88809509-88809531 TATGTGCCTGGCCCTGGGTTAGG - Intronic
1131124948 15:89851901-89851923 TCTGTACTTAGCACTGTGCTTGG - Intronic
1131393550 15:92068982-92069004 TCTGTGCTAGGCACTGTGCTGGG + Intronic
1131404531 15:92153728-92153750 TCTATGCTCAGCCCTGGGGAAGG + Intronic
1132555025 16:568551-568573 CCTGGGCTGGGCCCTGGGCTTGG + Exonic
1132584833 16:701583-701605 CCTCTGCTTGGCCCTGGGCCCGG + Intronic
1133929419 16:10220073-10220095 CCTGTGGTTAGCACTTGGCTTGG - Intergenic
1133984959 16:10661402-10661424 TCTGTGCTGAGATCTGGGGTGGG - Intronic
1133989473 16:10693445-10693467 TCTGTGCTTCGCCCTGTCCTAGG + Intronic
1134051341 16:11139891-11139913 TATGTGCTAGGCACTGGGCTAGG + Intronic
1134064772 16:11220975-11220997 TGAGTGCTTGGCCCAGGGCTTGG + Intergenic
1134138092 16:11693127-11693149 TATGTGCCTGGCCCTGTGCTAGG - Intronic
1134679486 16:16114270-16114292 TATGTGCTAAGCACTGTGCTGGG - Intronic
1135772648 16:25229002-25229024 TCTGGGGTTAGGCCTTGGCTGGG + Intergenic
1136072311 16:27795137-27795159 TCTGTGCTGGGCCAGGGGCTGGG - Intronic
1136156172 16:28383720-28383742 TATGTGCTGAGCACTAGGCTGGG + Intronic
1136206914 16:28731568-28731590 TATGTGCTGAGCACTAGGCTGGG - Intronic
1136412542 16:30085761-30085783 CCTGTGTTTGGCCCTGGGCGGGG - Intergenic
1137504545 16:49041649-49041671 TTTGTGCCTGGCCCTGGGCAAGG - Intergenic
1137727817 16:50668936-50668958 TCAGTGCTGAGGCCTGGGCAGGG - Intronic
1137744501 16:50810712-50810734 TCTGTGCATAGCCCTGGACACGG - Intergenic
1138473899 16:57259323-57259345 TCTGTGGCCAGTCCTGGGCTGGG + Intronic
1138497485 16:57417005-57417027 TCTGTGCTCAGCCCTTAGCTGGG - Intergenic
1139153501 16:64413316-64413338 TGTGTGCCTAACCCTGGGCAAGG - Intergenic
1139263839 16:65621668-65621690 TCTCTGCTAAGCCCTGTACTGGG + Intergenic
1140304325 16:73788596-73788618 TGCGTGCTAAGCACTGGGCTGGG - Intergenic
1140530105 16:75658272-75658294 TCTGTGCTTAGTCCTCACCTTGG + Intronic
1141240861 16:82263977-82263999 TTACTGCTTAGCTCTGGGCTGGG - Intergenic
1141448549 16:84080613-84080635 TGTGTGCTTAGTCATTGGCTGGG - Intronic
1141568929 16:84922571-84922593 TCTGTGCTTAGCACAGCACTTGG - Intergenic
1141586242 16:85035293-85035315 TCCATGCTGAGCACTGGGCTAGG - Intronic
1141635018 16:85310043-85310065 CCTGGGCTTATGCCTGGGCTCGG - Intergenic
1141818495 16:86429315-86429337 TCTGCCCTTATCCCTGAGCTGGG + Intergenic
1143114914 17:4576883-4576905 GCTGGGCTGAGCCCTGGGCCTGG - Intergenic
1143168470 17:4911399-4911421 TGAGTGCTTAGCCCTGGCCCTGG - Intergenic
1143588734 17:7866861-7866883 TCTGGGCTGGGCACTGGGCTAGG - Intronic
1144770564 17:17757207-17757229 TGGGTGCTCAGCCCTGGGCCTGG + Intronic
1144785310 17:17828061-17828083 GCTGTGGTCAGCCCTGTGCTGGG - Intronic
1144971106 17:19110497-19110519 TCTGTGCCCAGCACAGGGCTTGG + Intergenic
1144971107 17:19110503-19110525 TCTGTGCCAAGCCCTGTGCTGGG - Intergenic
1144991408 17:19236660-19236682 TCTGTGCCCAGCACAGGGCTTGG + Intronic
1144991409 17:19236666-19236688 TCTGTGCCAAGCCCTGTGCTGGG - Intronic
1145009685 17:19360836-19360858 TCTGTGCCCAGCCCTGTGCCAGG - Intronic
1146285618 17:31572458-31572480 ACTCTGCATGGCCCTGGGCTGGG - Intronic
1146791297 17:35752197-35752219 TCTGTGCTGAGCACTTTGCTGGG - Intronic
1147166271 17:38595174-38595196 TCTGTGCCAGGCACTGGGCTAGG - Intronic
1147368462 17:39974832-39974854 TATGTGCTGGGCCCTGGGTTGGG + Intronic
1147670724 17:42175423-42175445 TCTGGGCATAGCCCTGTGCTAGG - Intronic
1148202282 17:45757112-45757134 TCTATGCCTGGCCCTGAGCTAGG - Intergenic
1148216753 17:45837547-45837569 TGTGTGCTCAGCACTGTGCTAGG + Intergenic
1148262806 17:46198075-46198097 TTTGTGCCAGGCCCTGGGCTAGG - Intronic
1149408030 17:56374982-56375004 TCTATGCATAGCACAGGGCTGGG + Intronic
1149492960 17:57098369-57098391 TCTGCCCTTAGTCCTGGGCCTGG + Intronic
1149997971 17:61414757-61414779 CCTGTGCTTAGCTCAGGGCATGG + Intergenic
1150310529 17:64125450-64125472 TCTGTGCCCAGCCGTGGGTTGGG - Intronic
1150576519 17:66435547-66435569 TGTTTACTTAGCCCTGGACTAGG + Intronic
1151559685 17:74863621-74863643 CCTGTGCTTAGTGCTGGGATTGG - Intronic
1151624369 17:75267506-75267528 TCTGTGCTTGTGCCAGGGCTGGG + Intronic
1152318616 17:79595376-79595398 TCAGTGCTTAGCCCAGTGCCTGG - Intergenic
1153524314 18:5980058-5980080 TCTGTGCTGAGCTCTGTGCCAGG - Intronic
1153750170 18:8221356-8221378 TGTGAGCTCAGCACTGGGCTAGG - Intronic
1155038074 18:22042115-22042137 TCTGTGCCAAGCACTGTGCTAGG - Intergenic
1156465008 18:37343134-37343156 GCTGTGCTTATGCCTGTGCTGGG + Intronic
1156887858 18:42156414-42156436 ACTGTGCTTAGTCATTGGCTGGG - Intergenic
1157682471 18:49617740-49617762 TCTGTGCCTAGCCTTGGGCTGGG + Intergenic
1157699955 18:49756001-49756023 TGTGTGCTGGGCCCTGTGCTAGG - Intergenic
1159219073 18:65436600-65436622 TCTGAGGTTAGCCCTTGGCTAGG - Intergenic
1159594187 18:70367012-70367034 TCAGTGCTTAACACAGGGCTTGG - Intergenic
1160777976 19:865269-865291 TGTGTGCAGAGCCCTGGGCCGGG + Intergenic
1160848094 19:1175454-1175476 TCTGTGCTTGGTCATGAGCTGGG + Intergenic
1160897371 19:1408940-1408962 TGTGTTCTCAGCGCTGGGCTTGG + Intronic
1161319429 19:3634136-3634158 CCTGTGCCTAGCCCTGAACTTGG - Intronic
1161456410 19:4371892-4371914 TCTGTGCCTGGCACTGGGCGAGG - Intronic
1161767076 19:6213879-6213901 GCCGGGCTTAGCCCTGGGCCGGG - Intronic
1161902802 19:7132103-7132125 GCTGTGCTTAGCACTGAGCATGG - Intronic
1162402278 19:10453446-10453468 TCTGTGTGTGGCCCAGGGCTGGG + Intronic
1162540824 19:11294936-11294958 TCTCTGTCCAGCCCTGGGCTGGG - Intergenic
1162873251 19:13601503-13601525 TTTGTGCCTGGCCCTGTGCTAGG + Intronic
1163623178 19:18372838-18372860 TGTGGGCTGAGCCCTGGACTGGG + Intergenic
1163724224 19:18913435-18913457 TCTGTGCCCAGCCCTGGCCAGGG + Intronic
1163769513 19:19182354-19182376 TGTGTGCCTGGCCCTGGGCTGGG - Intronic
1164784479 19:30919245-30919267 TGTGTGCTCAGCCCTGGTCATGG - Intergenic
1164811960 19:31164472-31164494 TCTGTGCCAAGCACTGTGCTAGG - Intergenic
1165096891 19:33414330-33414352 TCTGGGCTTAGCCTGGGGCCAGG - Intronic
1165413761 19:35678424-35678446 TATATGCTTAGCCCCGTGCTGGG - Exonic
1165485160 19:36090998-36091020 TCAGTGCTTAGCACAGGGCCTGG + Intronic
1165831956 19:38734918-38734940 TCTGGGCCAAGCCCTGTGCTAGG + Intronic
1165907164 19:39201110-39201132 TCCGTTCACAGCCCTGGGCTGGG - Exonic
1165946971 19:39449448-39449470 TCTGTGCTTGGCCTTGGGCTGGG + Intronic
1165994878 19:39836894-39836916 TCTGTGGCCAGCCCTGGGCCGGG + Intronic
1166007864 19:39919531-39919553 TCTGTGCCTGGCCTTGAGCTGGG + Intronic
1166046792 19:40234728-40234750 TCTGAACTCAGCCCAGGGCTGGG - Intronic
1166127706 19:40725570-40725592 GCAGTGCTTAGGCCTGGGCCTGG + Intronic
1166341019 19:42136939-42136961 TCAGTGCCAAGCCCTGTGCTGGG + Intronic
1166365730 19:42277639-42277661 TGTGTGCCTAACCCCGGGCTTGG + Intronic
1166703709 19:44896702-44896724 TGTGTGCCCAGCCCTGGGCTGGG + Intronic
1166721088 19:44996337-44996359 TCTGTGTTTGGCCCTATGCTGGG - Intergenic
1166747988 19:45151058-45151080 TCTGGGCAGAGCCCTGGGCTGGG - Exonic
1166854946 19:45778755-45778777 TCTATGGTTATCTCTGGGCTGGG - Intronic
1166867428 19:45848485-45848507 TCTGTGCTTAGCCCTGGGCTAGG - Intronic
1167012216 19:46816174-46816196 TGTGTGCTCAGGCCTGTGCTAGG - Intergenic
1167015712 19:46839690-46839712 TCTGTGCCTGGCCCTGTGCTGGG + Intronic
1167016160 19:46842431-46842453 TCTGTGATCAGCCCAGTGCTAGG - Intronic
1167054950 19:47104443-47104465 TCTGTACCTGGCCCTGTGCTGGG - Intronic
1167101146 19:47404913-47404935 TCTGTGCCCAGCCCTGTGCTGGG - Intronic
1167124386 19:47539209-47539231 TCTGTGCCAGGCCCTGTGCTGGG - Intronic
1167264178 19:48475193-48475215 TCTGTGCCAGGCCCTGAGCTGGG + Intronic
1167310855 19:48737168-48737190 TCTGTGCCAAGCCCTGTGCTAGG + Intronic
1167425773 19:49429001-49429023 TCTGGCCTGAGCCCTGGGGTGGG + Intergenic
1167565789 19:50255859-50255881 TCTGTGCTTAGGGCAGGGCCAGG - Intronic
1167646988 19:50711300-50711322 TCTGAGCTTGGCCCTGGGGGAGG + Intronic
1167780384 19:51594997-51595019 TCTTTCCTGAACCCTGGGCTGGG - Intergenic
1168061653 19:53896317-53896339 TCTGTGCCAAGCCTTGAGCTAGG + Intronic
925216356 2:2098993-2099015 TCTGTGCTCCGTGCTGGGCTGGG - Intronic
925874999 2:8303897-8303919 TCTGTGCCAGGCCCTGTGCTAGG - Intergenic
926313773 2:11694664-11694686 CATGTGCTCAGCCCTGTGCTAGG - Intronic
926688359 2:15715842-15715864 TCTGTGCCAGGCCCTGAGCTTGG - Intronic
926799507 2:16647500-16647522 CGTGTGCTAAGCTCTGGGCTGGG - Intronic
926973393 2:18489133-18489155 TGTGTGCTCATTCCTGGGCTAGG + Intergenic
927147241 2:20174245-20174267 TCTGTGCCCTGCCCTGGGCATGG + Intergenic
927376144 2:22416849-22416871 TTTATGCTTAGCCCTGTGCCTGG - Intergenic
927877310 2:26666859-26666881 TCTGTGCTCAGTCATTGGCTTGG - Intergenic
929239338 2:39637606-39637628 TTTGTGCTTAGCACAGTGCTTGG + Intergenic
929528105 2:42725192-42725214 TCTGTGCTTAGCACAGTACTTGG + Intronic
930826849 2:55703720-55703742 TCTGTTCCTGGGCCTGGGCTTGG + Intergenic
931073326 2:58680692-58680714 TCTGTGCCTGGCTCTGTGCTAGG - Intergenic
931228012 2:60350884-60350906 TATGTGCCTAGCCCTGAGCTAGG - Intergenic
931430046 2:62202134-62202156 TGTGTGCCTAGCACTGTGCTTGG + Intronic
931857529 2:66318909-66318931 TTTGTGCTTAACACTGTGCTTGG - Intergenic
932218968 2:69985583-69985605 TATGGGCTCAGCTCTGGGCTGGG + Intergenic
932343489 2:70981008-70981030 TCTGTGGTGTGACCTGGGCTTGG + Intronic
932793361 2:74674612-74674634 GCTGTGCTTCGACCTGAGCTTGG + Exonic
932832414 2:75003727-75003749 TCTGTGCTTGACCCTGGACTGGG + Intergenic
933427703 2:82133872-82133894 TCAGTGCTTAATCCTGGGCCAGG - Intergenic
933769276 2:85733037-85733059 TCCTGGCCTAGCCCTGGGCTTGG + Intergenic
935346287 2:102111538-102111560 CCTGTGCTAAGCCCTGTGCTAGG + Intronic
935377991 2:102420231-102420253 TCTATGCTTATCCCTGAGCAGGG + Intronic
935743400 2:106170645-106170667 TCTGTTCTTTGGTCTGGGCTGGG - Intronic
936039799 2:109141495-109141517 TGTGGGCTCAGCTCTGGGCTGGG - Intronic
936151895 2:110026392-110026414 TCTGTGCTAAGCCCTGTGCTGGG + Intergenic
936192778 2:110344977-110344999 TCTGTGCTAAGCCCTGTGCTGGG - Intergenic
936896069 2:117429032-117429054 TGTGTGCCCAGCACTGGGCTTGG + Intergenic
937299870 2:120832575-120832597 GGTCTGCTCAGCCCTGGGCTGGG - Intronic
937355137 2:121193555-121193577 TATGTGTTTGGCCCTGTGCTGGG + Intergenic
938074364 2:128323788-128323810 GCCGTGCTGAGCCCTGGCCTAGG - Intergenic
938104345 2:128520006-128520028 TCTGTGCTCAGCCCTGGTCCAGG - Intergenic
938116119 2:128603906-128603928 TGTGTGCAGAGCCCTGGGCTGGG - Intergenic
939032836 2:137096878-137096900 TATGTGCTAAGCCCTGGGCCTGG - Intronic
939113412 2:138033816-138033838 TCTGTGCTTAGCCTGTGGCTAGG - Intergenic
940908390 2:159189014-159189036 TTTGTGCTTAGCGCTCAGCTCGG + Intronic
945007509 2:205424281-205424303 TCTGTGTTTATCCCTGTCCTAGG + Intronic
946042018 2:216790804-216790826 TCAGTGGTTAGCCCTAAGCTGGG + Intergenic
946178830 2:217937923-217937945 TTTGTGTTCAGTCCTGGGCTTGG - Intronic
947813450 2:233020336-233020358 ACTGTGCTGAGTCCTAGGCTGGG + Intergenic
948162419 2:235835674-235835696 TTGGTGCTTAGCCCTGTGCTGGG + Intronic
948756799 2:240164816-240164838 CCTGTGCCCAGCCCTGTGCTGGG - Intergenic
1168812166 20:711099-711121 TCTGTGCTGAGCTTGGGGCTGGG + Intergenic
1169191235 20:3660290-3660312 CCTGTGCTGAGCCCTGTGCTAGG - Intronic
1169765878 20:9147511-9147533 TCTGTGCTCAGCTATGGGTTGGG + Intronic
1169812265 20:9620265-9620287 TGTGTCCTCAGCACTGGGCTTGG + Intronic
1170309550 20:14977210-14977232 TGTTTGCTTTGCCCTGGGCAGGG - Intronic
1170590649 20:17768839-17768861 ACCGTGCCAAGCCCTGGGCTAGG - Intergenic
1170592655 20:17782725-17782747 TCTGTTCTTGGCCCTGGTCAGGG - Intergenic
1170824200 20:19779384-19779406 TCTGGGCCAGGCCCTGGGCTGGG + Intergenic
1171010245 20:21505694-21505716 TCCGTGCTGAGGCCTCGGCTAGG - Intergenic
1171433736 20:25103888-25103910 TCTGTGCTATGCCTTGGGGTTGG - Intergenic
1172056720 20:32159351-32159373 TCTGTGCTGGGCCCCGAGCTGGG - Intronic
1172122193 20:32604969-32604991 TCTGAGTTTAGTCCTGGGCTTGG - Intronic
1172230318 20:33331938-33331960 TCTGTGCCTGGCCCGGTGCTGGG + Intergenic
1172426278 20:34858420-34858442 TCTGTGCCAAGCCCTATGCTGGG - Intronic
1172449463 20:35011671-35011693 TGTGGGCTTGGCTCTGGGCTGGG - Intronic
1172589415 20:36106682-36106704 TCGAGGCTTAGCTCTGGGCTAGG + Intronic
1172621149 20:36319512-36319534 TCTGTGAGCTGCCCTGGGCTAGG - Intronic
1172876578 20:38168073-38168095 TCTGTGCTAAGCCCTGTGCTGGG - Intergenic
1172941121 20:38655499-38655521 TGTGTGCCTGGCACTGGGCTAGG + Intergenic
1173163461 20:40669802-40669824 TCTGTGCCCAGCCCTGGGCGGGG - Intergenic
1173494102 20:43506773-43506795 TCTGTGCCCCGCTCTGGGCTAGG + Intergenic
1173655880 20:44700036-44700058 TAAATGCTTAGCCCAGGGCTTGG - Intergenic
1173666220 20:44765254-44765276 CCTGTGCTTTGCTCTGGGCAAGG - Intronic
1173849344 20:46208087-46208109 TATGAGCCTAGCCCTGTGCTGGG - Intronic
1173849481 20:46208941-46208963 TGAGTGCTGAGGCCTGGGCTAGG + Intronic
1174033361 20:47649142-47649164 TCTGTGCTCAGGACAGGGCTTGG + Intronic
1174265012 20:49325063-49325085 TGTGTGCAGAGCACTGGGCTGGG - Intergenic
1174395988 20:50247196-50247218 GCTGTCCTGACCCCTGGGCTGGG - Intergenic
1174525874 20:51170758-51170780 TATGTGCTTAGCACTGTCCTAGG + Intergenic
1174899312 20:54481654-54481676 TCTGTGCTGGGCCCTGCACTAGG - Intronic
1175401492 20:58702000-58702022 TCTGTGCTCAGGCCTGGGCTGGG + Intronic
1176205232 20:63884633-63884655 TCTCTGCTCAGTCCTGGGGTTGG + Intronic
1177192137 21:17863841-17863863 TATGTGCCTAGCACTGTGCTAGG - Intergenic
1177229537 21:18302001-18302023 TCTGTTCTTAGCCCCTGACTAGG + Intronic
1177917135 21:27102873-27102895 TCTGTGCCCAGCACTGGTCTAGG + Intergenic
1179809227 21:43859599-43859621 TCTCTGCTGACCCCTGGGATGGG + Intergenic
1179971474 21:44838407-44838429 TCTGTGCATGCCCCTGGCCTTGG - Intergenic
1180023853 21:45147439-45147461 TCTGTGCTTAGCTCCCTGCTGGG - Intronic
1180100071 21:45579810-45579832 GATGTGCTTACCCCTGGGATGGG + Intergenic
1180207455 21:46269960-46269982 TCTGTGCTTTGCCGTGTGCTAGG - Intronic
1181000096 22:19984015-19984037 TCTCTGCTGGGCCCTGGGCGGGG + Intronic
1181521375 22:23450516-23450538 ACTGTGCTAACCCCAGGGCTGGG + Intergenic
1181681963 22:24501625-24501647 TGTGTGCTGTGCCCTGGGCCAGG - Intronic
1181791367 22:25269549-25269571 ACCGTGCCCAGCCCTGGGCTGGG + Intergenic
1181793757 22:25288382-25288404 TCTGTGGTGTGGCCTGGGCTTGG - Intergenic
1181888788 22:26042775-26042797 TATGTGCTAGGCACTGGGCTAGG + Intergenic
1182109937 22:27715776-27715798 TCTGAGCTGATCCCAGGGCTGGG - Intergenic
1182433330 22:30313889-30313911 TCTGTGCTCAGCCCTGTGCTGGG - Intronic
1182497275 22:30718489-30718511 TGTATGCTTGGCACTGGGCTTGG + Intronic
1182540228 22:31035995-31036017 TATGTGCTAACTCCTGGGCTAGG - Intergenic
1182805913 22:33070231-33070253 CCTGTGCTTGGCACTGGGCCAGG + Intergenic
1182953046 22:34395701-34395723 TCTGTGCCAGGCCCTGTGCTAGG - Intergenic
1183780582 22:39996126-39996148 TGTGTGCCTGGCCCTGTGCTGGG + Intronic
1184407741 22:44309459-44309481 ACCGTGCTCTGCCCTGGGCTCGG - Intronic
1184884055 22:47331434-47331456 TCTGTCCCCAGTCCTGGGCTGGG - Intergenic
949513160 3:4784037-4784059 TGTGTGCTAGGTCCTGGGCTGGG + Intronic
950203321 3:11059855-11059877 TCTGTGACTTGCCCTGTGCTAGG + Intergenic
950521666 3:13501305-13501327 TCTGTGCCTGGCCTTGTGCTGGG + Intronic
950584841 3:13884912-13884934 ACTGTGCTGGGCCCTGGGCTGGG + Intergenic
952314738 3:32222921-32222943 TCTGTGCTAGCCCCTGTGCTAGG + Intergenic
952492730 3:33887554-33887576 TCTGTGCCGGACCCTGGGCTAGG + Intergenic
953133754 3:40165197-40165219 GGTGTGCAGAGCCCTGGGCTGGG + Intronic
953212843 3:40891646-40891668 TGTGTGCTCAGCTCTGTGCTAGG - Intergenic
953507292 3:43498588-43498610 TCTGTGCTAAGCTTTGGACTTGG - Intronic
953753448 3:45627133-45627155 TCTGTGCGTAGGGGTGGGCTTGG + Intronic
953877723 3:46675954-46675976 GCTGAGCTTGGCCCTGGACTCGG - Intronic
954279834 3:49569462-49569484 TCTATCCTCAGCCCTGGGCATGG - Intronic
954299283 3:49690882-49690904 TCTCTGCCCAGCCCTGTGCTGGG + Intronic
954628542 3:52035957-52035979 TCTGAGCCTGACCCTGGGCTGGG - Intergenic
954710139 3:52501510-52501532 CCTGTGCTCAGCTCTGGGCCAGG + Intronic
955116394 3:56009010-56009032 GATGTGCTTGGCACTGGGCTGGG - Intronic
955228820 3:57081496-57081518 GCTGTGCTTGGCCCTGAGGTGGG + Intergenic
955352661 3:58205510-58205532 TATGTGATTAGCTCTCGGCTTGG - Exonic
955433574 3:58874862-58874884 TCTGTGTCAAGCACTGGGCTAGG - Intronic
955897311 3:63714154-63714176 TGTGTGCTAAGCCCTAGCCTGGG - Intergenic
956531176 3:70220904-70220926 CCTGAGCTTAGCACAGGGCTTGG + Intergenic
956992410 3:74782298-74782320 TTTTTTCTTATCCCTGGGCTTGG + Intergenic
958154897 3:89743928-89743950 ACTGTGCTCAGCCATTGGCTGGG - Intergenic
959121373 3:102236559-102236581 TCTGTGCAAAACCATGGGCTGGG - Intronic
959527198 3:107390313-107390335 TCTCTGCTTACATCTGGGCTGGG - Intergenic
959857656 3:111178488-111178510 TGTATGTTCAGCCCTGGGCTGGG + Intronic
961519926 3:127461201-127461223 TCTGTGCTAGGCCCTGTGCTGGG + Intergenic
961584073 3:127907954-127907976 TCTGTGCCAAGCACTGTGCTGGG + Intergenic
961655243 3:128438299-128438321 TCTGAGCTGGGCCCAGGGCTGGG - Intergenic
961718150 3:128873053-128873075 ACTGTACTGAGCCCTGGCCTTGG - Intergenic
961969161 3:130941315-130941337 TGTGTGCTAAGCCCTGTTCTGGG + Intronic
962355975 3:134694536-134694558 TCTGTGCCTGGGCCTGTGCTGGG + Intronic
962637401 3:137345275-137345297 TCAGTGCTTAGCACAGAGCTTGG - Intergenic
962828467 3:139119742-139119764 TATGTGCTTGGCCCTGTGCTGGG + Intronic
962843391 3:139254985-139255007 CCAGTGCTTAGCCCAGGGCTGGG + Intronic
962851292 3:139310073-139310095 TCTGTGTTAGGCCCCGGGCTGGG - Intronic
963083281 3:141414408-141414430 TCTTTACTTTTCCCTGGGCTGGG - Intronic
963283907 3:143413990-143414012 TATGTGTCTAGCCCTGGGCCAGG - Intronic
964420699 3:156499789-156499811 CTTGTGCTTGGCTCTGGGCTGGG - Intronic
965899018 3:173615915-173615937 TCAGTGCAGAGCCCTGGGGTAGG + Intronic
967018755 3:185504282-185504304 TCTGTGCCTAGCATTGTGCTAGG + Intergenic
967457451 3:189704658-189704680 TCTGTGCTGAGCACTGTGCTAGG - Intronic
967596041 3:191327928-191327950 TCTCTGCCTAGCACTGGGGTGGG + Intronic
968045898 3:195623863-195623885 TCTCTGCTCAGCCCTGGGGGCGG + Intergenic
968810458 4:2797417-2797439 TGTGTACTGGGCCCTGGGCTAGG + Intronic
968816744 4:2825270-2825292 TCTATGCCAAGCCCGGGGCTGGG - Intronic
969058319 4:4415642-4415664 TCTGTCCTTCTCCCTGGGCGGGG + Intronic
969351967 4:6603330-6603352 CCTGGGCCCAGCCCTGGGCTGGG + Intronic
969377320 4:6771510-6771532 TGTGTGCCAGGCCCTGGGCTGGG + Intergenic
969471392 4:7391458-7391480 TCAGTGCCAAGCCCTGTGCTGGG - Intronic
971659165 4:29389841-29389863 TCTTTGCTCATTCCTGGGCTTGG + Intergenic
972785503 4:42323121-42323143 TCTTTGAGTAGCCCTGGTCTAGG - Intergenic
973131932 4:46658559-46658581 TCTTTGCTCAGACCTGGACTTGG + Intergenic
976346053 4:84002926-84002948 TCTGTGCCAGGCCCTGTGCTAGG + Intergenic
976366522 4:84239104-84239126 CCTGTGCATAGCACTGTGCTGGG + Intergenic
977539213 4:98295482-98295504 TGTATGTTTAGCACTGGGCTGGG + Intronic
980167399 4:129245857-129245879 TCTGTGCATAGCGCTGTGCACGG + Intergenic
981425639 4:144599976-144599998 TCTGTGCTAAGCACTGCTCTAGG + Intergenic
981902085 4:149878678-149878700 TTTGTGCTGAGCACTGGTCTAGG - Intergenic
982751651 4:159169080-159169102 TCTGTGCAAAGCACTGTGCTGGG - Intronic
983128827 4:163988698-163988720 TCTTTGTTTAGACCTGAGCTTGG - Intronic
983394648 4:167178144-167178166 TTTGTGGTGAGCTCTGGGCTGGG - Intronic
986245486 5:6003114-6003136 TCTATGCTGAGCACTGGGCTAGG - Intergenic
987027672 5:13943878-13943900 GCTGAGCTGAGCCCTGTGCTAGG + Intronic
991029948 5:62072218-62072240 TATGTGCCTGGCCCTGTGCTGGG - Intergenic
992385553 5:76280787-76280809 ATTGTGCTTAGACCTAGGCTTGG - Intronic
992562372 5:77965323-77965345 TATGTGCTAAGCACTGTGCTAGG + Intergenic
993075939 5:83231399-83231421 TGTGTGCACAGCACTGGGCTTGG - Intronic
995446825 5:112254185-112254207 TCTGGGCTTAGTCCTGTGTTAGG + Intronic
997359551 5:133285988-133286010 TCTGTGCCAAGCCCTGTCCTGGG + Intronic
997709250 5:135990240-135990262 TCTGTGCCAGGCCCTGTGCTAGG + Intergenic
998405427 5:141871736-141871758 TCAGGGCTTAGCCCTGGACCTGG + Intronic
998715337 5:144877401-144877423 TGTGTGCCAAGCCCTGTGCTAGG + Intergenic
999189199 5:149733589-149733611 CCTTTGCTTAGCTCTTGGCTAGG + Intronic
999718489 5:154380958-154380980 AATGTGCTTAGTACTGGGCTGGG - Intronic
999889412 5:155960388-155960410 CCTGGGCTTGGCGCTGGGCTAGG - Intronic
1000313356 5:160065534-160065556 TCTGTGCTTAGGTCTGGGTTAGG + Exonic
1000956798 5:167553478-167553500 TCTGTGCCTAGCTCTGGGCTGGG + Intronic
1001420982 5:171586951-171586973 TCTGCTCTTGGCCATGGGCTGGG - Intergenic
1001429731 5:171649859-171649881 TCTGAGCTCAGTCCAGGGCTGGG + Intergenic
1001489420 5:172145058-172145080 TCTGATCTTAGCCCTGATCTTGG - Intronic
1001666583 5:173438263-173438285 TCTGTGCTATGCCATGTGCTGGG + Intergenic
1001713178 5:173794175-173794197 TCTGTGCCCAGCTCTGTGCTGGG + Intergenic
1001961597 5:175883235-175883257 GCTGTGGATCGCCCTGGGCTGGG + Exonic
1002049374 5:176561407-176561429 ACTGGGCTCAGCCCTGTGCTTGG + Intronic
1002065054 5:176647715-176647737 TCTGCGCCTTGCCCTGTGCTGGG + Intronic
1002071040 5:176679148-176679170 TCTGTGCTGGGCCCTGGCTTGGG - Intergenic
1002163985 5:177333278-177333300 TCTGTGCCTAGCCATGGGCTGGG - Intronic
1002203075 5:177542393-177542415 TATGTGCCTAGCACTGGACTAGG - Intronic
1002327500 5:178419432-178419454 TCTGTGCCAGGCACTGGGCTCGG + Intronic
1002894332 6:1367557-1367579 TCTGTGGGTTGGCCTGGGCTGGG - Intergenic
1002932061 6:1641550-1641572 TCAGTGCTTAGCACTGGGGAAGG + Intronic
1003053838 6:2802138-2802160 TCTGTGGGCAGCCCTGGGATGGG - Intergenic
1004360713 6:14968287-14968309 TGTGTGCCAAGCACTGGGCTAGG + Intergenic
1004363822 6:14995394-14995416 TCTGCACTAAGCCCTCGGCTGGG - Intergenic
1004493283 6:16138677-16138699 TCTGTGCCCAGCCCTAAGCTGGG - Intronic
1005797341 6:29379749-29379771 TGGGTGCTTAGACCTGAGCTGGG - Intronic
1006400003 6:33812213-33812235 TCTGTGCTTGGCACTGGGTGAGG + Intergenic
1006458038 6:34143249-34143271 CCTCTGCTCAGCACTGGGCTGGG - Intronic
1006512295 6:34528282-34528304 TGTGTGCTTGGCGCTGTGCTGGG + Intronic
1007186913 6:39979537-39979559 TCTGTGCTAGGGCCTGTGCTGGG + Intergenic
1007323909 6:41045940-41045962 TCTGTGCTCTGCCCTGTCCTGGG - Intronic
1007424362 6:41737063-41737085 TCAGCTCTGAGCCCTGGGCTGGG + Intronic
1007472063 6:42097476-42097498 TCTGTGCTTAGACCCCTGCTAGG + Intergenic
1007695144 6:43727260-43727282 TCTGTGCCAGGCCCTGTGCTAGG - Intergenic
1010368744 6:75083181-75083203 TTTGTGCTTAGCCCCTGGTTTGG + Intergenic
1011739323 6:90343794-90343816 TCTGAGCATGGCCTTGGGCTAGG - Intergenic
1011749653 6:90442402-90442424 TCTGTGCACAGTCCTGAGCTGGG + Intergenic
1012452787 6:99371204-99371226 TATCTGCTTGGCCCTGGGTTAGG + Intronic
1013103497 6:107007319-107007341 TATATGCTTAGCACTGGGCCTGG - Intergenic
1014207084 6:118667752-118667774 TCTGTGCATTGGACTGGGCTGGG - Intronic
1014439390 6:121456508-121456530 TATGTGCTTAGCACTGTGTTAGG - Intergenic
1014509258 6:122300904-122300926 TCTGTGATTAGTCATTGGCTGGG + Intergenic
1015492306 6:133839412-133839434 TCTGTGCCAAGCACTGGGCTGGG - Intergenic
1015538472 6:134290899-134290921 TATGTGCTGAGCCCTCTGCTAGG - Intronic
1015994618 6:138985407-138985429 TCTCTACTTAACACTGGGCTAGG - Intronic
1016947077 6:149545418-149545440 ACTGGGCTAAGTCCTGGGCTTGG - Intronic
1017032685 6:150238060-150238082 GTTGTGCTCAGCCCTGGGCAGGG - Intronic
1017114104 6:150960680-150960702 TCTCTGCTTCTGCCTGGGCTGGG + Intronic
1017118063 6:150997252-150997274 ACTGTGCTGAGCCCTGGACAAGG + Intronic
1017552053 6:155519422-155519444 TCTGTGCTTGGCACTTTGCTTGG - Intergenic
1017657952 6:156648055-156648077 TCTGTGCCAAGCACTGTGCTGGG + Intergenic
1017674178 6:156796820-156796842 GCTCTGCTAAGCCCTGGGGTGGG + Intronic
1017907787 6:158768714-158768736 TCTGTGCTAGGTCCTGGGCATGG + Intronic
1018243433 6:161800564-161800586 TCTGTGCCCAGCACTGGGCATGG - Intronic
1019299136 7:294812-294834 CCTGTGCCAAGCCCTGTGCTGGG + Intergenic
1019506517 7:1394104-1394126 TATGTGCTCAGTCCTGTGCTGGG + Intergenic
1019589930 7:1825868-1825890 ACTGTGCTCATCCCAGGGCTGGG - Intronic
1019598492 7:1869428-1869450 GCTGTGCCCAACCCTGGGCTGGG - Intronic
1019684951 7:2376554-2376576 TCACTGCTGAGCCCTGGGCCGGG - Intronic
1019782871 7:2954596-2954618 TCTGTGCTGAGCACTGTGCTGGG + Intronic
1019933823 7:4241634-4241656 GCTGTGCTTAGGGCTGAGCTGGG - Intronic
1020478443 7:8627088-8627110 TGTGTGCCAAGCACTGGGCTGGG - Intronic
1021182261 7:17520390-17520412 CCTGTGCTAGGCCCTGTGCTAGG + Intergenic
1021386074 7:20032333-20032355 TCTGTGCTCAGCTCTGTGCCTGG - Intergenic
1021624133 7:22576069-22576091 TCTGTGCTCAGCCCTGGTGTAGG + Intronic
1021963142 7:25892188-25892210 ACTGGGCTTAGGCCTGGCCTGGG - Intergenic
1022965490 7:35467777-35467799 TGTGTGCCTTGCCCTGTGCTAGG + Intergenic
1023506047 7:40900585-40900607 TCTGTGCCCAAGCCTGGGCTGGG + Intergenic
1024354937 7:48404942-48404964 TCTGGGCTTTGGCCTGGCCTGGG + Intronic
1026445362 7:70479961-70479983 TCTGTGTTTAGCACAGTGCTTGG - Intronic
1026535813 7:71237726-71237748 TGTGTGCTAAGCTCTGTGCTGGG - Intronic
1027192029 7:76002236-76002258 TCTGTGCTGAGCCCAGTGCCTGG + Intronic
1029149090 7:98467459-98467481 AATGTCCTTAGCCCAGGGCTAGG - Intergenic
1029666431 7:101998076-101998098 TCTGTGCTAGGTCCTGGGCTGGG - Intronic
1030505645 7:110418464-110418486 TATGTGCCTTGCCCTGTGCTAGG - Intergenic
1030695332 7:112579043-112579065 TCTATGCTTTGCCCTGCTCTAGG + Intergenic
1031370695 7:120961865-120961887 TCTGTGGTTAGCCCTGTTTTAGG + Intronic
1032021194 7:128407973-128407995 GCTGGGCTCAGCCCTGGGTTAGG + Intronic
1033381974 7:140830395-140830417 TCTGTGCCTAGAACTGGGGTTGG - Intronic
1033980446 7:147157706-147157728 TCTGTGCCAGGCACTGGGCTAGG - Intronic
1034136135 7:148771948-148771970 TGTGTGCCTGGCCCTGTGCTAGG + Intronic
1034423669 7:151001905-151001927 GCTGTGCGTAGCTCTGGGCCCGG - Exonic
1036502408 8:9325799-9325821 TCTGTTCTTTGCTCTGTGCTTGG - Intergenic
1038316435 8:26488550-26488572 TATGTGCTCGGCCCTGTGCTAGG - Intronic
1039424743 8:37476628-37476650 TCTGGGCTGAGCCCTGGGTAGGG - Intergenic
1041487382 8:58393775-58393797 TGTGTGCTTGGGACTGGGCTAGG + Intergenic
1041721812 8:60982989-60983011 TTTCTGCTTAGCCCTGGGGATGG - Intergenic
1041825484 8:62091385-62091407 TCTGTGCCCAGCACTGTGCTAGG - Intergenic
1042194508 8:66220975-66220997 GCCATGCTCAGCCCTGGGCTGGG + Intergenic
1042275023 8:66995562-66995584 TATGTGCCAAGCACTGGGCTGGG + Intronic
1042417153 8:68534377-68534399 TCTATGCTAAGCACTTGGCTGGG + Intronic
1043340823 8:79236907-79236929 TCTGTGCCTGGCACTGTGCTAGG + Intergenic
1043395598 8:79832687-79832709 TCTTTCCTCAGCCCTGGACTTGG + Intergenic
1043709412 8:83396359-83396381 TCAGTGCTCAGCTCTGTGCTAGG - Intergenic
1044827082 8:96208899-96208921 TCTGTGCCAAGCACTGGTCTAGG - Intergenic
1045379959 8:101613462-101613484 TCTGTGCTTGGCATTGTGCTGGG - Intronic
1045476597 8:102557868-102557890 TCTGTGCTTCCCCTTGGCCTTGG + Intronic
1045501365 8:102746726-102746748 TCTGTTCTAAGCACTGGGCATGG - Intergenic
1045648404 8:104321269-104321291 TCTGTGCCTGGCTCTGGGCTTGG + Intergenic
1046621107 8:116530622-116530644 TCTGTGCCCAGCACTGTGCTTGG - Intergenic
1046650416 8:116831429-116831451 TCTGTGATTAGCCAAGGGGTGGG - Intronic
1047211948 8:122847553-122847575 TCTGGGCTTGGCACTGGGCCTGG - Intronic
1047772693 8:128043051-128043073 ACTGTGCTCAGCCTTGGACTAGG + Intergenic
1048126630 8:131642793-131642815 ACTGTGCTCAGTCCTTGGCTTGG - Intergenic
1048141149 8:131795834-131795856 TCTGTGTCAAGCCCTGGTCTAGG - Intergenic
1048201460 8:132377658-132377680 ACTGTGCTTAGCCTTGGACATGG - Intronic
1048890272 8:138940573-138940595 TCTCTGCTTAGCGCTGTGCCGGG - Intergenic
1049435445 8:142584184-142584206 ACAGAGCTTATCCCTGGGCTTGG - Intergenic
1049454329 8:142679326-142679348 TGTGGGCTGAGCCCTGGGCTAGG - Intronic
1050274335 9:3981168-3981190 TCTGTGCTCAGCCCTCTACTGGG + Intronic
1052780735 9:32780014-32780036 TGTGTGCTTAGCATTGTGCTGGG - Intergenic
1053026224 9:34730509-34730531 TATGTGCTCAGCCCTAAGCTGGG + Intergenic
1053072560 9:35109888-35109910 TGTGTGCTTACCCCTGTACTTGG - Exonic
1053151166 9:35744141-35744163 TGTGTGCCCAGCCCTGAGCTAGG - Intronic
1053266917 9:36721858-36721880 ACTGTGCTCAGTCATGGGCTTGG - Intergenic
1053270322 9:36745176-36745198 TGTGTGCCAAGCACTGGGCTTGG + Intergenic
1053293045 9:36894687-36894709 TCTGTGCTGGGCCCTGTGCTAGG - Intronic
1053318615 9:37075232-37075254 TCTGTGCTTGGCCTTGGGCTAGG + Intergenic
1053322761 9:37114934-37114956 TCTGTGCTTGGCCTTGGGCTAGG + Intergenic
1053413315 9:37929537-37929559 TCTGGGCTGAGCACTGAGCTAGG + Intronic
1053487259 9:38469304-38469326 TCTGAGCTGAGTCCTGGGCCAGG - Intergenic
1053667321 9:40325268-40325290 ACTGGGCTAAGCCCTGGGCCAGG + Intronic
1054378466 9:64465296-64465318 ACTGGGCTAAGCCCTGGGCCAGG + Intergenic
1054517289 9:66051015-66051037 ACTGGGCTAAGCCCTGGGCCAGG - Intergenic
1054898668 9:70343233-70343255 TATGTGCTGGGCCCTTGGCTAGG - Intronic
1056458842 9:86789896-86789918 TGTGAGCTTGGCCCTGTGCTAGG + Intergenic
1057242835 9:93427263-93427285 TCAGTGCTTAGAACTGTGCTTGG - Intergenic
1057310615 9:93940753-93940775 TCTGTGATTAGGCATGGGCAAGG - Intergenic
1057618216 9:96612524-96612546 TCTGTGCTCAACCCTGGGATGGG + Intronic
1057845080 9:98516721-98516743 TCTGTGCCAAGCCTTGTGCTGGG - Intronic
1057872356 9:98727913-98727935 GCTGTGCAGAGCCCAGGGCTCGG - Intergenic
1057903323 9:98965993-98966015 TCTGGACTTGGCGCTGGGCTGGG - Intronic
1057926896 9:99160357-99160379 TCTGAGCCAAGCCCTGGACTAGG - Intergenic
1058416961 9:104799247-104799269 TCTGTGCTGAGTGCTGGGCTTGG + Intronic
1058873531 9:109222760-109222782 TATGTGCCTAGCACTGTGCTAGG + Intronic
1058907535 9:109494081-109494103 TAGGCACTTAGCCCTGGGCTAGG + Intronic
1058907646 9:109494871-109494893 TCTGTGCTCACACCTGGTCTTGG + Intronic
1059342202 9:113603734-113603756 TCTGTCCTCAGGCCTGGCCTCGG - Intergenic
1059466006 9:114469326-114469348 TCTGTGCTAGGCCTTGTGCTGGG + Intronic
1059609848 9:115880668-115880690 TATGTGCCTGGCCCTGTGCTAGG - Intergenic
1060197965 9:121635486-121635508 TGTGTGCTTAGCCCCGTGCAGGG + Intronic
1060264111 9:122100345-122100367 TCTGTGCTGGGCCCTGTGCTGGG - Intergenic
1060265051 9:122107183-122107205 TCTGTGCCAAGGCCTGTGCTGGG + Intergenic
1060426581 9:123511492-123511514 GCTGTCCTCAGCCCTGTGCTGGG - Intronic
1060518988 9:124283218-124283240 TATGTGCCAGGCCCTGGGCTAGG - Intronic
1060784021 9:126434925-126434947 TGTATGCTAGGCCCTGGGCTGGG - Intronic
1060874741 9:127074652-127074674 TCTGTGCCTAGCACTTTGCTAGG + Intronic
1061054743 9:128216459-128216481 TGTGTGCTAAGCCCTGTCCTGGG + Intronic
1061220625 9:129248441-129248463 TCTTTTCTTAGCCCTAGGATAGG - Intergenic
1061608729 9:131731688-131731710 TGTGTGGTTTGCCCAGGGCTGGG - Intronic
1061676867 9:132222350-132222372 TATGTGCTTAGCTCTGGGAAAGG - Intronic
1061729207 9:132600487-132600509 CCTGTCCTTGGCCCAGGGCTCGG - Intronic
1061943849 9:133897537-133897559 GCTGGGCTCAGCTCTGGGCTGGG - Intronic
1062076514 9:134592858-134592880 TCTGTGCTCAGACCTGGGAGAGG + Intergenic
1062105203 9:134751389-134751411 TCTGTGCTAGGCCCTCTGCTGGG + Intronic
1062386439 9:136313516-136313538 TCTGTGCACAGCCCTGGGCCAGG - Intergenic
1062413198 9:136434880-136434902 CCTGTGCCTGGCCCTGAGCTTGG - Intronic
1062439324 9:136562667-136562689 TTGGTGCTTGGCCCTGGGCCTGG + Intergenic
1062710865 9:137974538-137974560 TCTCTGCTTATCCCAGGTCTGGG + Intronic
1187136208 X:16550167-16550189 TCTGGGATTCGCCCTGGGCATGG - Intergenic
1187700365 X:21959415-21959437 GCAGTGCTCAGCCATGGGCTTGG + Intronic
1189146842 X:38664280-38664302 TCTGTGCCTGGCACTGTGCTAGG + Intronic
1189536029 X:41936417-41936439 CCTGTGCTGAGCACTGTGCTAGG - Intergenic
1190598217 X:52066889-52066911 ACAGTGCTGAGCCCTGGGCCAGG - Exonic
1190610607 X:52187184-52187206 ACAGTGCTGAGCCCTGGGCCAGG + Exonic
1190734903 X:53249881-53249903 TCACTGCATAGCCCTGGGCAAGG - Intronic
1192039224 X:67599568-67599590 TCTGTGCCTAGCCCAGTGCCTGG + Intronic
1192170002 X:68848341-68848363 TCTGTGCTAAACTCTGTGCTGGG - Intergenic
1192287834 X:69757002-69757024 TCTGTTCTTATCCATGGGTTGGG + Intronic
1192733461 X:73825490-73825512 TCTGTGCCTGTCCCTGTGCTAGG - Intergenic
1195281497 X:103338857-103338879 TCTGTGCTGAGCCGTGGGATTGG - Intergenic
1195862779 X:109399253-109399275 TCTGTGCCTAGCACAGGGCATGG - Intronic
1196090456 X:111735876-111735898 TCTGTGCACAGCCCTGTACTGGG + Intronic
1196271025 X:113710935-113710957 TCAGTGGTTAGCACAGGGCTTGG + Intergenic
1196941701 X:120783338-120783360 ACTGTGCTTAGCTCCGTGCTTGG + Intergenic
1197520550 X:127491376-127491398 TCTGAGCTTAGCCCAGCACTAGG + Intergenic
1197764038 X:130047891-130047913 TCTGTGCCTAGCCCTGTGTTAGG - Intronic
1197854950 X:130904375-130904397 TTTGTGCAAAGCTCTGGGCTAGG + Intergenic
1198252568 X:134894842-134894864 TCTGTGCCAGGCCCTGTGCTAGG + Intronic
1198377227 X:136052124-136052146 CCTGGGCTGAGCCCTGGGCCAGG + Intergenic
1199395121 X:147327815-147327837 TGTGTGCTTAGTTCTAGGCTAGG + Intergenic
1199780139 X:151051075-151051097 TCTGTGCTGAGCACTGTGCTTGG + Intergenic
1199807593 X:151315837-151315859 TCAGTGCTTTGCACTGAGCTGGG + Intergenic
1199822730 X:151465290-151465312 TCTGTGCCAGGCCCTTGGCTAGG - Intergenic
1199856650 X:151764305-151764327 CCTGTGCTGAGCCCTGGGAGAGG + Intergenic
1199976396 X:152897350-152897372 TGTGTGCAAGGCCCTGGGCTGGG - Intergenic
1200132772 X:153860213-153860235 AAGGTGCTTAGTCCTGGGCTGGG + Intergenic