ID: 1166867430

View in Genome Browser
Species Human (GRCh38)
Location 19:45848490-45848512
Sequence TGTCCTCTGTGCTTAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867430_1166867437 25 Left 1166867430 19:45848490-45848512 CCCAGGGCTAAGCACAGAGGACA No data
Right 1166867437 19:45848538-45848560 ATAAACGGATGGTCAATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 176
1166867430_1166867436 21 Left 1166867430 19:45848490-45848512 CCCAGGGCTAAGCACAGAGGACA No data
Right 1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1166867430_1166867434 10 Left 1166867430 19:45848490-45848512 CCCAGGGCTAAGCACAGAGGACA No data
Right 1166867434 19:45848523-45848545 ATGTCTGTTGAGTGAATAAACGG 0: 1
1: 3
2: 27
3: 173
4: 803
1166867430_1166867435 14 Left 1166867430 19:45848490-45848512 CCCAGGGCTAAGCACAGAGGACA No data
Right 1166867435 19:45848527-45848549 CTGTTGAGTGAATAAACGGATGG 0: 1
1: 0
2: 0
3: 35
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867430 Original CRISPR TGTCCTCTGTGCTTAGCCCT GGG (reversed) Intronic
No off target data available for this crispr