ID: 1166867431

View in Genome Browser
Species Human (GRCh38)
Location 19:45848491-45848513
Sequence ATGTCCTCTGTGCTTAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867431_1166867434 9 Left 1166867431 19:45848491-45848513 CCAGGGCTAAGCACAGAGGACAT 0: 1
1: 0
2: 3
3: 26
4: 206
Right 1166867434 19:45848523-45848545 ATGTCTGTTGAGTGAATAAACGG 0: 1
1: 3
2: 27
3: 173
4: 803
1166867431_1166867436 20 Left 1166867431 19:45848491-45848513 CCAGGGCTAAGCACAGAGGACAT 0: 1
1: 0
2: 3
3: 26
4: 206
Right 1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1166867431_1166867437 24 Left 1166867431 19:45848491-45848513 CCAGGGCTAAGCACAGAGGACAT 0: 1
1: 0
2: 3
3: 26
4: 206
Right 1166867437 19:45848538-45848560 ATAAACGGATGGTCAATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 176
1166867431_1166867435 13 Left 1166867431 19:45848491-45848513 CCAGGGCTAAGCACAGAGGACAT 0: 1
1: 0
2: 3
3: 26
4: 206
Right 1166867435 19:45848527-45848549 CTGTTGAGTGAATAAACGGATGG 0: 1
1: 0
2: 0
3: 35
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867431 Original CRISPR ATGTCCTCTGTGCTTAGCCC TGG (reversed) Intronic
902258068 1:15203685-15203707 ATGTCCTCAGTGCTTAGATCAGG + Intronic
902605297 1:17565778-17565800 ATGTCCTCAGTGCCCAGCCACGG - Intronic
903021513 1:20398668-20398690 ATGTCCACTGTGCCTGGCCTTGG + Intergenic
904327799 1:29738860-29738882 CTGTCCTCAGTGCTTGGCCCAGG - Intergenic
904374554 1:30072071-30072093 ACTTCCTATGTGCTTAGCCCTGG - Intergenic
905091997 1:35437184-35437206 ATGTCCGATGTGCTGAGCTCAGG + Intronic
905852681 1:41285895-41285917 CTGCCCTCTGAGCTTAGCCCTGG - Intergenic
906380178 1:45327593-45327615 GTGTCCTCTGCGCCTGGCCCCGG + Exonic
907330651 1:53669176-53669198 ATGTCCTCTGTGCCTGGCCCTGG + Intronic
907622884 1:55999862-55999884 ATGTCCACTGGGATTAGTCCTGG - Intergenic
910898899 1:92097923-92097945 ATGTCCTCTGTGCTCCCACCAGG - Intronic
911609458 1:99944711-99944733 ATCTCCTCTTTGATTAGCCAGGG + Intergenic
913259091 1:116982479-116982501 AGGTCCTCTGTGCTGAGCAGGGG + Intronic
916818351 1:168374581-168374603 ATGTGCTCTTTTCTTTGCCCTGG - Intergenic
919652383 1:200163365-200163387 ATCTCCTCTGTGCTGAGCACTGG + Intronic
919910302 1:202106904-202106926 CTGTCCTCTCTTCTTAGCACAGG - Intergenic
919984745 1:202665387-202665409 TTGTCATATGTACTTAGCCCAGG - Intronic
920196379 1:204230060-204230082 ATCTCCTCTGTGCCTAGCACTGG - Intronic
923340254 1:233000676-233000698 GTGTCCTCTGTGCCGAGCTCAGG - Intronic
1063546484 10:6986858-6986880 ATGTCCTCTGTGCATTGCTCTGG - Intergenic
1067206360 10:44217764-44217786 ATCTCCTCTGTACTGAGACCTGG + Intergenic
1067453036 10:46394016-46394038 CTTTCCTCTGTGCTTACACCTGG + Intergenic
1068893398 10:62172180-62172202 AACTCCTCTTTCCTTAGCCCTGG - Intergenic
1069487884 10:68836522-68836544 CTGTCCTTTGTGCTTAGTGCTGG + Intronic
1072793355 10:98335548-98335570 ATGTCCTCTCTGCATAGCCTGGG - Intergenic
1072794391 10:98343352-98343374 ATGTGCTCTTTAATTAGCCCTGG - Intergenic
1075644447 10:124088338-124088360 CTGTGCTCTGTGCTGAGCGCTGG + Intronic
1076429117 10:130389219-130389241 AGCTCCTCTCTGCATAGCCCTGG - Intergenic
1078101897 11:8334880-8334902 GTGTGCTCTGTGCCTGGCCCTGG + Intergenic
1078623023 11:12926225-12926247 AAATCCTCATTGCTTAGCCCAGG - Intronic
1079100180 11:17536467-17536489 AAGTGATCTGTGCTTGGCCCAGG - Intronic
1079326764 11:19499723-19499745 ATATCCTCAGTGCCTGGCCCAGG + Intronic
1082085520 11:48046488-48046510 ATCTACTCTGTGCTGGGCCCTGG + Intronic
1083202523 11:61129233-61129255 ATGTCCTGTGTCCTCAGCCTTGG + Intergenic
1085169966 11:74441537-74441559 AATTCCTCTGTGCTTTGGCCAGG - Intergenic
1085202877 11:74712406-74712428 TTTTCCCCTGTGCTTGGCCCAGG - Intronic
1085380424 11:76112065-76112087 ATGTACTAAGTGCTTGGCCCAGG + Intronic
1089389823 11:118093197-118093219 GTGTCCACCGTGCTTAGCCGTGG + Intronic
1089751359 11:120653717-120653739 GTGTCCTCAGTGCCTAGCACAGG - Exonic
1090456172 11:126851583-126851605 ATGTCCTCTCTGCCCGGCCCTGG + Intronic
1091171633 11:133525009-133525031 ATGTTCTCAGTGCCTAGCACGGG - Intronic
1094374370 12:29774548-29774570 ATGTGCTGTGTGCTTAGCATTGG - Intronic
1095699878 12:45180208-45180230 ATATCCTCAGTGCTTTTCCCAGG + Intergenic
1095720940 12:45399704-45399726 AACTCCTCTGTTTTTAGCCCTGG - Intronic
1097004063 12:55902284-55902306 GTGGCCTCAGGGCTTAGCCCTGG + Exonic
1098453473 12:70646211-70646233 CTGTCTGCTGTGCTTAGCCGGGG + Intronic
1103575141 12:121871864-121871886 ATGTCCTCTGTTCCTGGCACCGG + Intergenic
1103741901 12:123096700-123096722 AGGTCCTCACTGCTCAGCCCAGG - Intronic
1104759370 12:131287741-131287763 ATGTCCTCTGTGCAGAGCCCGGG + Intergenic
1104759385 12:131287798-131287820 ATGTCCTCTGTGCAGAGCTCGGG + Intergenic
1104759397 12:131287855-131287877 ATGTCCTCTGTGCAGAGCTTGGG + Intergenic
1104759451 12:131288248-131288270 ATGTCCTCTGTGCAGAGCTCAGG + Intergenic
1104759460 12:131288305-131288327 ATGTCCTCTGTACAGAGCTCGGG + Intergenic
1105779088 13:23690726-23690748 ATGTGCTCTATGTTTATCCCAGG + Intergenic
1106030648 13:25999149-25999171 GTGTCCTCTGTTTTCAGCCCAGG + Intronic
1107270985 13:38615846-38615868 CTTTCCTCTGTGCATACCCCCGG + Intergenic
1115857742 14:37649365-37649387 GTTTCCTTTGAGCTTAGCCCTGG + Intronic
1116805955 14:49494094-49494116 ATGTGCTCTGGCCTTGGCCCTGG - Intergenic
1117982551 14:61356369-61356391 ATTTCTTTCGTGCTTAGCCCTGG + Intronic
1118881365 14:69829269-69829291 ATGTCTTCAGTGCCTAGCACAGG - Intergenic
1119525707 14:75320757-75320779 CTCTCCTCTGTGGTTACCCCAGG - Intergenic
1120416224 14:84221526-84221548 ATGTCATCTGTGCCAAGCCAAGG - Intergenic
1120762308 14:88296036-88296058 ACTTCCTCTGTGTATAGCCCAGG - Intronic
1121700957 14:95953657-95953679 ATCTCCTCTGTGCTTGGCCCTGG - Intergenic
1121835471 14:97088421-97088443 ATGTGCTCTGTGCTAAGCGCTGG + Intergenic
1124460736 15:29888978-29889000 ATGTGCTCTGTGGATAGCCAAGG + Intronic
1128526259 15:68414388-68414410 ATGTCCCCTTTGCTGAGTCCTGG - Intronic
1128746519 15:70118875-70118897 AAATCCTCTGTGCTCAGCCTGGG - Intergenic
1128866300 15:71117177-71117199 ATCTCCTCTGTGCCCAGCACTGG + Intronic
1130196546 15:81784859-81784881 AGGGCCACTGTGCTTTGCCCTGG - Intergenic
1130544154 15:84842483-84842505 CTGTCCTCTGTCCCTACCCCTGG - Intronic
1130906860 15:88246851-88246873 CTGACCTCTCTGCTCAGCCCTGG + Intronic
1132809080 16:1789072-1789094 CTGTCATCTGTGTTTAGCTCGGG + Exonic
1134431475 16:14211888-14211910 ATGGGCTCTGTGCTTAACCATGG - Intronic
1136779467 16:32887252-32887274 GTGTCACCTGTGCTTAGACCAGG + Intergenic
1136891149 16:33974266-33974288 GTGTCACCTGTGCTTAGACCAGG - Intergenic
1137719588 16:50620265-50620287 ATCTCCACTGTGCCTGGCCCAGG + Intronic
1139134327 16:64183175-64183197 ATGTCCTCTTTGCTGTGCCAGGG - Intergenic
1139474717 16:67197403-67197425 AATTCCTCAGTGCTGAGCCCAGG - Intronic
1141065361 16:80909421-80909443 TTGTGCTCTGTGCTGGGCCCTGG - Intergenic
1141196408 16:81864827-81864849 GTGTCCTCCCTGCTCAGCCCGGG - Intronic
1141450145 16:84093994-84094016 CTGTCCTCTTTTCTTAGCCTTGG - Intronic
1203081883 16_KI270728v1_random:1149340-1149362 GTGTCACCTGTGCTTAGACCAGG + Intergenic
1142643678 17:1299215-1299237 CTATGCTCTGTGCTTGGCCCTGG + Exonic
1142956888 17:3528661-3528683 ATGTCTTCAGTGCTTAGCCTGGG - Intronic
1143163526 17:4886262-4886284 ATGCCCTCTGTGCTCAGGCTTGG + Intronic
1143509242 17:7386448-7386470 ATGTAGTCTGTGCTGGGCCCAGG - Intronic
1146416527 17:32638697-32638719 AAGTCCTCTGTGCTTCTCTCTGG - Intronic
1146729981 17:35184907-35184929 ATGTCATCTGGGCTATGCCCTGG + Intronic
1147688705 17:42302210-42302232 TTGTCCTCAGTGCGTAGCACAGG - Intronic
1149993797 17:61396741-61396763 ACGTCCCCTGAGCTTAGCCTGGG + Intergenic
1153477558 18:5513472-5513494 ATCTCCTCTGTGACTAGGCCAGG + Intronic
1154092400 18:11378083-11378105 TTGCCCTCTGTCATTAGCCCTGG - Intergenic
1157101996 18:44739274-44739296 ATGTCCTGTGTCCTAATCCCTGG - Intronic
1157523222 18:48359769-48359791 ATGTCATTTGTGCTGAGGCCAGG + Intronic
1158562401 18:58525925-58525947 ATCTGCTCTGTGCTTAGTACTGG + Intronic
1160236671 18:77091010-77091032 ATGTCCTGTGAGCACAGCCCAGG - Intronic
1160965319 19:1744749-1744771 CTGTCCTCTGAGCCTGGCCCAGG + Intergenic
1162323926 19:9987138-9987160 ATGACCTCTGTGCTTGGCTATGG + Intronic
1162350264 19:10144611-10144633 ATGTCCTGTGTGCTTTCCCTTGG + Intronic
1163769507 19:19182342-19182364 ATGTCCCCAGTGCCCAGCCCAGG + Intronic
1164302570 19:23974677-23974699 ATTGCCTGTGTGCTGAGCCCAGG + Intergenic
1164645496 19:29856263-29856285 TTGTACTCTCTGCTCAGCCCCGG - Intergenic
1165946968 19:39449442-39449464 AAGTCTTCTGTGCTTGGCCTTGG + Intronic
1166626946 19:44366586-44366608 ATGTCCTCTGTGATTCGTGCAGG - Intronic
1166867431 19:45848491-45848513 ATGTCCTCTGTGCTTAGCCCTGG - Intronic
1167512286 19:49901674-49901696 ATGGCCTTTATGGTTAGCCCAGG + Exonic
1167740187 19:51320121-51320143 GTGTCCACTGTGTTTAGCTCGGG + Intronic
925254692 2:2473155-2473177 ATAATCTCTGTGCTGAGCCCTGG - Intergenic
926677408 2:15637754-15637776 AAGTCCCCAGTGCTGAGCCCAGG - Intergenic
927111944 2:19869691-19869713 ATGTCCTCAGTGCTGAGGGCAGG - Intergenic
927871210 2:26625225-26625247 ATTCCCTCTGTGCATAGCGCTGG + Intronic
928175728 2:29033206-29033228 CTGTCCTCTGTGCTCACACCTGG + Intronic
928193775 2:29197676-29197698 ATGTCCTCTGTCCCATGCCCAGG - Exonic
931083353 2:58800851-58800873 ATGTCCTCAGTGCTCAGCTCTGG - Intergenic
932832412 2:75003721-75003743 GTGTTCTCTGTGCTTGACCCTGG + Intergenic
936026625 2:109035583-109035605 CTTTCCTCTGTGCTTTGACCAGG - Intergenic
936272270 2:111058020-111058042 ATTTCCTCTGTGCACAGCTCTGG + Intronic
936744356 2:115556590-115556612 ATTTTCTCTGTGCTTAGCAAAGG + Intronic
937005093 2:118504328-118504350 ATGTCCTTTGTCTTTAACCCAGG + Intergenic
937377920 2:121350432-121350454 ATGGCCTCTGAGCCCAGCCCTGG - Intronic
938104346 2:128520012-128520034 CTCTGCTCTGTGCTCAGCCCTGG - Intergenic
939034096 2:137110248-137110270 TTGTCCTCGGTGCTTAGCTGTGG + Intronic
939571005 2:143839631-143839653 ACTTCCACTGTGCTTTGCCCTGG + Intergenic
941589874 2:167406502-167406524 ATTTCCTGTGTGCTTGGCGCTGG - Intergenic
942710496 2:178829590-178829612 ATTTTCTCTGTGCTTATCACAGG - Intronic
944671759 2:201999945-201999967 ATTTCCTCTGTGCCTAACACTGG + Intergenic
946385636 2:219382841-219382863 ACCTACTCTGTGCTGAGCCCTGG + Intronic
946445082 2:219731755-219731777 ATTTTCTCTGTGCTTATACCTGG + Intergenic
947618614 2:231574506-231574528 CTGTCCTCTTTGCTGAGCCACGG + Intergenic
947706801 2:232282792-232282814 AAGTGCTCTCTGCTTAGCACAGG - Intronic
948158281 2:235802090-235802112 ATCTGCTCTGTGCACAGCCCTGG + Intronic
1171875424 20:30570688-30570710 ATGTCCTCTGTGATTCGTGCAGG + Intergenic
1174434594 20:50497046-50497068 ATGTCCCCAGGGCCTAGCCCAGG - Intergenic
1175930176 20:62490153-62490175 GGGTACTCTCTGCTTAGCCCAGG + Intergenic
1176050408 20:63116322-63116344 CTGTACTCTGTGCCTAGCTCTGG - Intergenic
1177694001 21:24548596-24548618 ATGTCTTCTGGTCTTAGCCTTGG - Intergenic
1179149508 21:38797736-38797758 GTGTCCTCACTGCTTAACCCAGG + Intergenic
1179241622 21:39597902-39597924 ATGTCATCAGTGCTGAGCTCTGG - Exonic
1180825225 22:18856829-18856851 AGGTCCTCTGTGCATGGGCCCGG + Intronic
1181187504 22:21117718-21117740 AGGTCCTCTGTGCATGGGCCCGG - Intergenic
1181211694 22:21292775-21292797 AGGTCCTCTGTGCATGGGCCCGG + Intergenic
1181397815 22:22634111-22634133 AGGTCCTCTGTGCATGGGCCCGG - Intergenic
1181500560 22:23313481-23313503 AGGTCCTCTGTGCATGGGCCCGG - Intronic
1181651594 22:24261947-24261969 AGGTCCTCTGTGCATGGGCCCGG + Intergenic
1181705781 22:24648792-24648814 AGGTCCTCTGTGCATGGGCCCGG - Intergenic
1182549336 22:31092534-31092556 ATGCCCTCTGTGCTAAACCAGGG + Intronic
1183322469 22:37173365-37173387 CTGTCCCCTGTGCTTAGCACAGG + Intronic
1184389181 22:44193062-44193084 TTGGCCTCTGTGCTGAGCCCAGG + Intronic
1184674126 22:46031259-46031281 GCGTCCTCGGTGCCTAGCCCAGG - Intergenic
1184973256 22:48042980-48043002 TTGTCCTCTGTGCCTGGACCTGG + Intergenic
1185379794 22:50503159-50503181 ATTGCCTCTGTGATTGGCCCAGG - Exonic
1203215259 22_KI270731v1_random:2657-2679 AGGTCCTCTGTGCATGGGCCCGG - Intergenic
1203275371 22_KI270734v1_random:82732-82754 AGGTCCTCTGTGCATGGGCCCGG + Intergenic
950852588 3:16076935-16076957 GTATCCTGTGTGCTTTGCCCAGG - Intergenic
952516075 3:34105800-34105822 ATGTCCTCTGTGCCTCTCCTCGG - Intergenic
953422106 3:42762163-42762185 ATGTGCTGTGGGCTGAGCCCAGG + Intronic
957412165 3:79856273-79856295 ATGTCCTCTGTTCTTTCCCATGG - Intergenic
958460275 3:94385667-94385689 ATGTCCTGAGTGCTTTGCCTAGG - Intergenic
959583000 3:108001134-108001156 ATGGCCTCTGTGCTTTGCAGAGG + Intergenic
961438747 3:126937992-126938014 TTGTCCTCTGCGCATAGCCTGGG - Intronic
961779547 3:129313693-129313715 GTGTCCTCAGAGCTTGGCCCAGG + Intergenic
962677176 3:137765559-137765581 CTGTCCTCTGAGCCTAGCCCCGG + Exonic
962843385 3:139254979-139255001 TTGTCCCCAGTGCTTAGCCCAGG + Intronic
963329071 3:143894123-143894145 ATATTCTTAGTGCTTAGCCCAGG - Intergenic
968960751 4:3742259-3742281 ATGCCTTCTGTGCTTAGACCAGG + Intergenic
971007457 4:22391217-22391239 TTGTCCTCTCTGCTGAGCCCTGG + Intronic
971093355 4:23370865-23370887 ATGTGCTCTGTGCATAGAGCAGG + Intergenic
975984561 4:80190338-80190360 ATTTCCTCCCTGCTTCGCCCAGG + Intronic
976614241 4:87059886-87059908 TTGTCCTTTGTGTTTAGCACAGG + Intronic
977357332 4:95963982-95964004 ATTTCCTCTGGGCTAAGACCAGG + Intergenic
980528731 4:134022761-134022783 ATGTCTTCTATGCTTTTCCCGGG + Intergenic
980749019 4:137064415-137064437 ATGTCCTCTGATTCTAGCCCCGG - Intergenic
984126056 4:175812372-175812394 AAGTCCTCAGAGCTTAGCTCAGG + Intronic
986456414 5:7924969-7924991 ATGTCCTCTCTCCTGAGTCCTGG - Intergenic
986576181 5:9215097-9215119 ATCTCCTGTCTGCTTTGCCCAGG - Intronic
987780535 5:22428636-22428658 CTTTACTATGTGCTTAGCCCTGG + Intronic
989798166 5:45501259-45501281 ATTGCCTCTGTCCTAAGCCCTGG - Intronic
992023222 5:72645791-72645813 ATGTACTCACAGCTTAGCCCTGG + Intergenic
994833740 5:104820647-104820669 ATGTGTTCTCTGCTTAGGCCAGG - Intergenic
995454261 5:112335150-112335172 CTGTACTCTGTGCCAAGCCCTGG - Intronic
995800142 5:115985046-115985068 ATGTGATGTGTACTTAGCCCAGG + Intronic
997422543 5:133780565-133780587 ATGTCTTCTGTGCTAAGTGCTGG - Intergenic
998405424 5:141871730-141871752 ACCTCCTCAGGGCTTAGCCCTGG + Intronic
999732300 5:154483780-154483802 ATGTCGTCTGAGCTTCGTCCCGG + Intergenic
999768559 5:154757519-154757541 ATGGCCTCTGGTCGTAGCCCTGG + Intronic
1001198058 5:169691445-169691467 ATGTGCTCTGTGCTAAGCACTGG + Intronic
1002163990 5:177333284-177333306 CTGCCCTCTGTGCCTAGCCATGG - Intronic
1003598487 6:7496360-7496382 GTGTCCACTGTGCTTAGCTGTGG - Intergenic
1004114381 6:12751475-12751497 TTGACCCCTTTGCTTAGCCCAGG + Intronic
1006597474 6:35203866-35203888 TTGTCCTCTGTGGTTGGCCAGGG + Intergenic
1009377919 6:62994392-62994414 ATTTCCTCTCTGCATTGCCCTGG + Intergenic
1014287655 6:119518875-119518897 ATGTCCTCTGTACTCTGTCCAGG + Intergenic
1017656135 6:156631382-156631404 GTGTCCTGCGTGCTTAGACCAGG + Intergenic
1020260496 7:6528252-6528274 CTCTCCTATGTGCTGAGCCCTGG - Intronic
1021624131 7:22576063-22576085 CTATCCTCTGTGCTCAGCCCTGG + Intronic
1023615781 7:42017898-42017920 ATGTGATCTGTGCTTGGCCTTGG + Intronic
1029660559 7:101958269-101958291 ATGTCATCTGTGCTGAACCCTGG + Intronic
1029747182 7:102522611-102522633 ATGTCCTGAGTGCTTGCCCCAGG - Intergenic
1029765135 7:102621700-102621722 ATGTCCTGAGTGCTTGCCCCAGG - Intronic
1030261711 7:107572048-107572070 ATGTCCTCCCTGCTAAGCACAGG + Intronic
1030539221 7:110808539-110808561 ATGCCCCCTGTGCACAGCCCTGG - Intronic
1030543915 7:110868573-110868595 ATGTCTCCTTTGCCTAGCCCAGG - Intronic
1030894493 7:115040504-115040526 ATGTTCTTTGTCTTTAGCCCAGG - Intergenic
1031099343 7:117460248-117460270 ATTTCCTTTTTGCTTAGTCCCGG - Intergenic
1032355804 7:131209515-131209537 ATGTCCTCTGTTATCAGCTCGGG + Intronic
1032366574 7:131305751-131305773 ATGGCCTGTCTGCTTACCCCTGG + Intronic
1034169795 7:149054199-149054221 CTGTCCTCTGTCCTTCTCCCAGG + Intergenic
1035225007 7:157428072-157428094 ATGCCCCCTGTGGTGAGCCCAGG - Intergenic
1037573882 8:20182651-20182673 AGGTACTCTGTTCTAAGCCCAGG + Intronic
1037750784 8:21680814-21680836 ATCTCCCCTGTGCTGAGCCTGGG - Intergenic
1038602865 8:28965153-28965175 GTGTCCTCTGTGCCTTGCACAGG + Intronic
1038699373 8:29835577-29835599 GTGTCCTCTTCACTTAGCCCAGG + Intergenic
1041196030 8:55402274-55402296 AACTGCTCTGTGCTGAGCCCTGG + Intronic
1041366282 8:57108743-57108765 GTGTCCTCTTTCCTCAGCCCAGG + Intergenic
1044130627 8:88519345-88519367 ATGTCCTCTTTGTCTTGCCCTGG - Intergenic
1047800956 8:128309308-128309330 ATTTACTCTGTGGTGAGCCCAGG + Intergenic
1048790935 8:138102718-138102740 ATGTTCTCTGTTCTGAGGCCCGG + Intergenic
1048993620 8:139775586-139775608 ATGTCCTCGGGACTCAGCCCTGG - Intronic
1049370196 8:142260715-142260737 GTGCCCTCTGTGCTTCCCCCAGG - Intronic
1052785393 9:32823422-32823444 CTGTCTTCTGTGCAGAGCCCCGG + Intergenic
1053163689 9:35829928-35829950 CTGTTCTCTGTCCTTGGCCCAGG + Exonic
1057191265 9:93088889-93088911 ATGGCCTCTGTGCTAGGCCCAGG + Intergenic
1057201574 9:93143272-93143294 CTGTCCTCTGCTCTTTGCCCCGG + Intergenic
1058525840 9:105857062-105857084 ACCCCCTCTCTGCTTAGCCCCGG - Intergenic
1060770378 9:126327467-126327489 GTGTCCTCTCTGCTGTGCCCAGG - Intronic
1061169884 9:128946498-128946520 ATGACCTGTGTGCTGAGCCTTGG - Exonic
1062710863 9:137974532-137974554 TTGTCATCTCTGCTTATCCCAGG + Intronic
1190299403 X:49047841-49047863 ATGTCCTATGTCCTAATCCCTGG + Intergenic
1192016095 X:67333201-67333223 GTTTCCTATGTTCTTAGCCCTGG - Intergenic
1192639142 X:72846472-72846494 ATGGCCTCTGGGCTTTGCCCTGG - Intronic
1192642569 X:72874333-72874355 ATGGCCTCTGGGCTTTGCCCTGG + Intronic
1195079145 X:101354897-101354919 ATGTCCTCAGTGCTTTACCTAGG - Intronic
1197504364 X:127283156-127283178 ATGTTCTCTTTGCTTAGCCTTGG - Intergenic
1199875039 X:151922229-151922251 CTGTCCCCTGTTCTTAGCTCAGG + Intronic
1200100288 X:153686746-153686768 GTGTCACCTGTGCTTAGACCAGG - Intronic