ID: 1166867436

View in Genome Browser
Species Human (GRCh38)
Location 19:45848534-45848556
Sequence GTGAATAAACGGATGGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867430_1166867436 21 Left 1166867430 19:45848490-45848512 CCCAGGGCTAAGCACAGAGGACA No data
Right 1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1166867428_1166867436 26 Left 1166867428 19:45848485-45848507 CCTAGCCCAGGGCTAAGCACAGA 0: 1
1: 0
2: 15
3: 79
4: 628
Right 1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1166867431_1166867436 20 Left 1166867431 19:45848491-45848513 CCAGGGCTAAGCACAGAGGACAT 0: 1
1: 0
2: 3
3: 26
4: 206
Right 1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867436 Original CRISPR GTGAATAAACGGATGGTCAA TGG Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
906141917 1:43539007-43539029 AAGAATGAACGGATGGGCAATGG - Intronic
908572907 1:65427623-65427645 GTGGAAAAACGTTTGGTCAAGGG - Intronic
908578247 1:65484854-65484876 TTGAAGAAAAGGATGGTTAAAGG + Intronic
911385607 1:97171172-97171194 GCCAATAAACGGAAGGTCCATGG + Intronic
919896991 1:202015182-202015204 GTGAAGAGAAGGATGGTCAGAGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924564515 1:245185664-245185686 GTGAATAAACTGGTGGTAAATGG - Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1066562117 10:36680837-36680859 ATGATTAAAGGGATTGTCAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1080594244 11:33755429-33755451 ATGAATCAAAGGATGTTCAAAGG + Intronic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1099473206 12:83075560-83075582 GTGAATAAACCTAAGATCAAAGG - Intronic
1101200109 12:102426910-102426932 GTGAATAAAAAGAATGTCAAAGG - Intronic
1103211730 12:119172067-119172089 ATCAATAAACGGATTGTAAAAGG - Intergenic
1105201000 13:18177613-18177635 GACAGTAAAAGGATGGTCAATGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1120301846 14:82717470-82717492 GTGAATAAACAAATCTTCAAAGG - Intergenic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126419553 15:48457066-48457088 TAGAATAGAGGGATGGTCAAGGG + Intronic
1126531020 15:49711161-49711183 GTGAACAAAGGAAAGGTCAAAGG - Intergenic
1131217235 15:90548331-90548353 GGGAACAATCTGATGGTCAAGGG + Intronic
1131650974 15:94399427-94399449 GGGAATAAACTGAGGGTCAGAGG - Intronic
1135044009 16:19139907-19139929 GTGAATAAACTGAGGTTCAGAGG - Intronic
1138164133 16:54784440-54784462 GTGGTGAAATGGATGGTCAAGGG + Intergenic
1140906163 16:79411072-79411094 GTGAATAAAGGCAAGATCAAAGG - Intergenic
1149064275 17:52461536-52461558 ATGAATTAACAGATTGTCAAGGG - Intergenic
1152165390 17:78701492-78701514 GGGAATGACTGGATGGTCAAGGG - Intronic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
934476879 2:94599549-94599571 GTGGATACACGGGTGGTTAATGG - Intronic
937567970 2:123319232-123319254 GTGAATAAACAGATTGGAAATGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1173865461 20:46309625-46309647 GTGATTAAATGGCTGGTCATTGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1181592312 22:23893069-23893091 GGGAATAAAGGGATAGTGAAAGG + Intronic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
953275209 3:41489045-41489067 GTGGATAAACTGAGGGTCAGGGG - Intronic
953593793 3:44287912-44287934 GTGAATAAAAGGCAGCTCAAGGG - Intronic
953628372 3:44589706-44589728 GGATATAAACTGATGGTCAAAGG - Intronic
962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG + Intergenic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
966338085 3:178893301-178893323 GGGGATACACGGATGGTTAATGG + Intergenic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
970507962 4:16752040-16752062 GCGAATAAATGCATGGTCCAGGG + Intronic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
985193327 4:187401427-187401449 GTGAATAAAAGCATGGACACCGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
1001573166 5:172744169-172744191 GTGAATAAAGGGCTGGGCACAGG + Intergenic
1001771440 5:174300075-174300097 CTAAATAAAGGGATGGCCAAGGG + Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1020653046 7:10898048-10898070 GAGTATAAAAGGATGGTTAACGG + Intergenic
1022290425 7:28997252-28997274 GTGAATAAACGTATGCAAAAAGG + Intronic
1023835890 7:44066898-44066920 GTGAATCAACTCTTGGTCAAAGG - Intronic
1026105723 7:67419277-67419299 GTGAAGAAACAGAGGGTCTAGGG + Intergenic
1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG + Intergenic
1027361910 7:77417489-77417511 GTGAATAAAAGGAAGGCCACTGG + Intergenic
1028335640 7:89651190-89651212 GTGAATAAAAGGATGGACTTTGG - Intergenic
1030303108 7:107993715-107993737 GTGATTAAACTGATGCTCATCGG - Intronic
1030626238 7:111848909-111848931 GCAGATAAAGGGATGGTCAATGG - Intronic
1031945138 7:127831674-127831696 GTGATGAAACAGATGCTCAAAGG + Intronic
1034879611 7:154753214-154753236 GGGAATAAACGGGTGGTGCATGG + Intronic
1038385084 8:27136402-27136424 GTGAAAAAAATGAAGGTCAAGGG + Intergenic
1038901091 8:31844629-31844651 GTGAGTAAACTGATGCTCAAAGG - Intronic
1043463039 8:80479613-80479635 TAGAATAAATGGAAGGTCAAGGG + Intergenic
1046376480 8:113388440-113388462 GTGACAAATCAGATGGTCAAAGG - Intronic
1047054749 8:121151651-121151673 GAGAATAAACGGTTGTTCTAAGG - Intergenic
1047791344 8:128206783-128206805 GTGATTAAAGGCATGGTCACAGG + Intergenic
1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050230468 9:3519415-3519437 ATTAAAAAAGGGATGGTCAAAGG + Intronic
1052609894 9:30758859-30758881 GTAAATAAATGGACGGTCCATGG - Intergenic
1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG + Intronic
1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG + Intergenic
1053931175 9:43114855-43114877 GTGGATACACGGGTGGTTAATGG + Intergenic
1054282528 9:63138403-63138425 GTGGATAGACGGGTGGTTAATGG - Intergenic
1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG + Intergenic
1054392295 9:64626535-64626557 GTGGATACACGGGTGGTTAATGG + Intergenic
1054426943 9:65131746-65131768 GTGGATACACGGGTGGTTAATGG + Intergenic
1054503432 9:65889794-65889816 GTGGATACACGGGTGGTTAATGG - Intronic
1055267954 9:74519874-74519896 GTGAATTAAAGAATGATCAACGG - Intronic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1062190644 9:135246243-135246265 ATGAATAAACGGATAATCAATGG + Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1185450015 X:276826-276848 GTGAATCAACGGAAGGACAGGGG - Intronic
1185762670 X:2700597-2700619 GTGCATTAACGGATGGATAAAGG - Intronic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1193698693 X:84739190-84739212 GTGGAGAGATGGATGGTCAAGGG - Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG + Intergenic
1194921219 X:99767661-99767683 GTGAGTAGAAGGATGGTCACTGG + Intergenic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1198521106 X:137453441-137453463 GAGATCAAACGGATGATCAAAGG - Intergenic
1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG + Intronic
1202579446 Y:26363968-26363990 GTGAATAAAAGCATGGGGAATGG - Intergenic