ID: 1166867957

View in Genome Browser
Species Human (GRCh38)
Location 19:45852466-45852488
Sequence TCTGTCAGTCACTCACATCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867950_1166867957 1 Left 1166867950 19:45852442-45852464 CCCCTACACCACACCCCTTTCTC 0: 1
1: 0
2: 0
3: 41
4: 438
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867947_1166867957 8 Left 1166867947 19:45852435-45852457 CCCCTTTCCCCTACACCACACCC 0: 1
1: 0
2: 3
3: 62
4: 742
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867949_1166867957 6 Left 1166867949 19:45852437-45852459 CCTTTCCCCTACACCACACCCCT 0: 1
1: 1
2: 2
3: 83
4: 965
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867946_1166867957 14 Left 1166867946 19:45852429-45852451 CCACATCCCCTTTCCCCTACACC 0: 1
1: 0
2: 8
3: 115
4: 1086
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867951_1166867957 0 Left 1166867951 19:45852443-45852465 CCCTACACCACACCCCTTTCTCT 0: 1
1: 0
2: 0
3: 45
4: 464
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867953_1166867957 -7 Left 1166867953 19:45852450-45852472 CCACACCCCTTTCTCTTCTGTCA 0: 1
1: 0
2: 4
3: 74
4: 673
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867948_1166867957 7 Left 1166867948 19:45852436-45852458 CCCTTTCCCCTACACCACACCCC 0: 1
1: 0
2: 5
3: 66
4: 773
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1166867952_1166867957 -1 Left 1166867952 19:45852444-45852466 CCTACACCACACCCCTTTCTCTT 0: 1
1: 0
2: 3
3: 65
4: 571
Right 1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867957 Original CRISPR TCTGTCAGTCACTCACATCC AGG Exonic
900299095 1:1967874-1967896 TCACTCACTCACTCACATCCAGG - Intronic
901892732 1:12281714-12281736 CCTGTCAGTCATTCACATAATGG + Intronic
902290746 1:15433089-15433111 TATGTCAGTGACTCACAGCCTGG + Intergenic
904223902 1:28998266-28998288 ACTGTCAGTCTCTCAACTCCAGG - Intronic
907550240 1:55298964-55298986 TCTGCCATTCACTCACAAACTGG + Intergenic
908113656 1:60920860-60920882 TGTCTCTGTCACTCACATGCTGG + Intronic
913461744 1:119093864-119093886 TCTGTCAGAAATTCACATCCAGG + Intronic
921511368 1:216034669-216034691 TCTGTCAGTCAGTGGTATCCTGG - Intronic
922831149 1:228555266-228555288 TCTCTCAGCCCCTCACACCCAGG + Intergenic
1063259921 10:4376457-4376479 TCTGTCAGTTACTTACATAGAGG + Intergenic
1065078304 10:22102845-22102867 TCTGTAAGTCTCTAACTTCCTGG + Intergenic
1065778282 10:29142881-29142903 TCTGCCAGTCAATGACCTCCCGG - Intergenic
1065854955 10:29822585-29822607 CCTGTCATTCACTCACCTGCTGG + Intergenic
1066304379 10:34125798-34125820 ACTTTCAGTCACTCCCAACCTGG + Intronic
1069754847 10:70767744-70767766 CTTGTCAGTCACTCAGAGCCAGG + Intergenic
1072230552 10:93410832-93410854 CCTGTCAGTCATTCACATCCTGG + Intronic
1073439219 10:103542824-103542846 ACTGTAAGTCACTGACACCCGGG + Intronic
1077550155 11:3196621-3196643 TCTGACAGTCCCCCACACCCAGG - Intergenic
1081585782 11:44382653-44382675 TCTGTCAGCCCCTCACATGCCGG - Intergenic
1083674733 11:64319013-64319035 TCTGTCTTTCACTCACTTCCTGG + Intronic
1084584501 11:70049613-70049635 TCGTTCATTCACTCACTTCCTGG - Intergenic
1084864924 11:72047786-72047808 TTTCTCTGTCACTTACATCCTGG - Intronic
1089639051 11:119835036-119835058 TTTCTCTGTCTCTCACATCCAGG + Intergenic
1089912578 11:122116871-122116893 TCTGTAAGTCACCCAGATCTGGG - Intergenic
1090915795 11:131160873-131160895 TCTGTCACTGACACACTTCCTGG + Intergenic
1097232691 12:57522277-57522299 TCTGCCTGTCACTGACAACCTGG - Intronic
1097832791 12:64243172-64243194 TTTCTCAGTCATTCACTTCCAGG - Intergenic
1098640734 12:72835736-72835758 ACTTTCAGTCACACACAGCCTGG + Intergenic
1098819694 12:75211218-75211240 TGTGTTAGTAACTCACATGCTGG - Intergenic
1102343884 12:112145794-112145816 TCTGTATGCCACTCACATCATGG - Intronic
1105296802 13:19094810-19094832 CCTTTCAGTCACTGACTTCCAGG - Intergenic
1109423321 13:62142153-62142175 ATTATCAGTCTCTCACATCCTGG - Intergenic
1111728604 13:92043852-92043874 GCTGTCAGCTACTCACATCTAGG - Intronic
1120458262 14:84759818-84759840 TCTGTCACCATCTCACATCCTGG + Intergenic
1121442338 14:93956965-93956987 TCTGTCAGTCAGTCTCTCCCTGG - Intronic
1121586869 14:95068599-95068621 TCTGTCATTCTCTCACATTCTGG - Intergenic
1130300937 15:82679713-82679735 TCTGTCCCTCACTCACCTTCAGG + Exonic
1132300514 15:100772664-100772686 TGTGTCAGGCACTCACTTCCAGG - Intergenic
1134813617 16:17188054-17188076 TCTTTTAGTCACTCAGAGCCAGG - Intronic
1138230331 16:55331580-55331602 ACTATCAGTCACTGAAATCCAGG + Intergenic
1138321813 16:56120452-56120474 TCTGTTGGTCACTAATATCCAGG + Intergenic
1138693351 16:58789345-58789367 TGTGTAAGTCACTCACAATCAGG - Intergenic
1139305782 16:65985076-65985098 TCTGGCAGTCAGTCACATTCTGG + Intergenic
1139464055 16:67144701-67144723 ACTGTCAGGCACTCAGAGCCAGG + Intronic
1140671112 16:77279952-77279974 GGTGTCAGTCACCCAGATCCAGG + Intronic
1140720771 16:77769857-77769879 TCAGTCAGTCACTTACACACTGG + Intergenic
1146140718 17:30365635-30365657 TCTCACTGTCACTCTCATCCTGG - Intergenic
1146945290 17:36869455-36869477 TCAGTCAGTCACTCACAGCATGG + Intergenic
1147641437 17:42003617-42003639 TCTGTCACTCACTCACTGCCAGG + Intronic
1148208685 17:45795169-45795191 TCAGTCAGTCTCCCACCTCCTGG - Intronic
1151350835 17:73531164-73531186 TCTGGGAGGCATTCACATCCAGG - Intronic
1152114874 17:78379196-78379218 ACTCTCCGACACTCACATCCTGG - Intronic
1152281344 17:79386535-79386557 TCTGTCACTCACTGACATCATGG - Intronic
1153355370 18:4128770-4128792 TCTGTCGTTCACTCTCATCTTGG - Intronic
1154309703 18:13257580-13257602 TCACTCAGTGTCTCACATCCAGG - Intronic
1156697210 18:39781548-39781570 TCTATCAATCACTCACAATCTGG + Intergenic
1157571280 18:48713955-48713977 TCCGTTACTCACTCACAGCCTGG + Intronic
1158326636 18:56320069-56320091 TCTCTCAGTTTCTCACATACAGG + Intergenic
1159924021 18:74250717-74250739 TGTGTCAGTTGCTCACCTCCTGG - Intergenic
1160244979 18:77150698-77150720 TGTGTCAGGCACACACATCTCGG - Intergenic
1160251139 18:77204414-77204436 TCATTCATTCACTCACATCGAGG - Intergenic
1160338855 18:78068942-78068964 TGTTTCAGGCACTCACATGCAGG + Intergenic
1160972487 19:1775688-1775710 TCTGTCACTCCCTCCCCTCCGGG - Exonic
1161321103 19:3641939-3641961 TCTGGCTGTCACTCCCAGCCCGG + Intronic
1162057168 19:8071659-8071681 TCTGTCACCCCCTCACCTCCTGG - Intronic
1162725696 19:12688824-12688846 TCTCCCAGTCACTCCCATGCAGG + Intronic
1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG + Exonic
1167094929 19:47370169-47370191 CCTGTCACTCACGCACAACCAGG - Intronic
1168682741 19:58327658-58327680 TCTGTCAGTCACACACTCCATGG - Intronic
926318700 2:11732416-11732438 TCTGTCAGTCCCTGACTTCAAGG - Intronic
927407922 2:22793294-22793316 TCTGTCAATCCCTCAACTCCAGG + Intergenic
927694325 2:25230058-25230080 TCTACCAGTCAATCACACCCAGG + Exonic
928397780 2:30956129-30956151 TCTGTCAGCCTCTCATAGCCTGG - Intronic
929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG + Intergenic
930774018 2:55155012-55155034 TCTGTCTATCCCTCAAATCCTGG + Intergenic
931437633 2:62262698-62262720 TCTTACAGTCATTCACATCTTGG + Intergenic
932443264 2:71752084-71752106 TCTTTCTTTCACTAACATCCTGG + Intergenic
935132834 2:100274260-100274282 TCTCTCAGTCACTCAGAGCAGGG - Exonic
935185754 2:100731285-100731307 TCTGTCAGCCAGTCACAATCTGG - Intergenic
935259861 2:101344657-101344679 CCTCTCAGTCTCCCACATCCTGG - Intergenic
936015395 2:108955013-108955035 TGTGCCAGTCACTCATAGCCTGG - Intronic
940293559 2:152099617-152099639 GCTGCGAGTCACACACATCCAGG + Intergenic
941688247 2:168469931-168469953 TCTGCCACTCACTCAGGTCCTGG + Intronic
944948426 2:204717833-204717855 CTTGTCAGTCACTGACAACCAGG + Intronic
945917349 2:215717914-215717936 CCTGTCACTCACTCCCTTCCAGG + Intergenic
946625971 2:221612716-221612738 TCAGTCAGGGACTGACATCCTGG + Intergenic
946827552 2:223694580-223694602 TCTGTCAATGATTCTCATCCCGG + Intergenic
946873560 2:224106550-224106572 CCTGTCTGTCACTGACATTCAGG + Intergenic
947459050 2:230286659-230286681 TCAGCCCTTCACTCACATCCAGG - Intronic
1169495291 20:6109356-6109378 TCTGTCACTGCCTCACCTCCAGG - Intronic
1170656484 20:18291651-18291673 TCTGTGTGCAACTCACATCCTGG + Intronic
1170670360 20:18427234-18427256 TCTGTCAGTCATTCAGCTACAGG + Intronic
1173004641 20:39130561-39130583 TCTCTCACTCACTCACTTCTAGG + Intergenic
1173166888 20:40691873-40691895 TCCGTCATTCACCCACAGCCTGG - Intergenic
1173343062 20:42171434-42171456 TGTATCAGTCACCCACTTCCTGG - Intronic
1173524239 20:43719854-43719876 TCTGTGAGCCTCTCACCTCCAGG - Intergenic
1173690028 20:44953448-44953470 TCTGTAAGTCCCTCAAATGCTGG + Intronic
1174837574 20:53872821-53872843 CCTGTGAGTCTCCCACATCCTGG - Intergenic
1175399364 20:58692205-58692227 CCTGTCACCCTCTCACATCCAGG + Intronic
1175484037 20:59332010-59332032 TCTGTCAGTCCCTGAGCTCCTGG - Intergenic
1176039605 20:63058337-63058359 CCTGTCAGTCACTCACACTGAGG + Intergenic
1181775776 22:25159172-25159194 TTTGTCAGGCACTCCCAGCCGGG + Intronic
1185125375 22:49007549-49007571 TCTGCCGGCCTCTCACATCCAGG - Intergenic
1185406743 22:50656481-50656503 TCTGGGAATGACTCACATCCAGG - Intergenic
949934075 3:9102885-9102907 TCTGTGAGTCACTCCCACCAAGG + Intronic
951564184 3:23996440-23996462 TCTATGATTCACTCAGATCCAGG - Intergenic
953330972 3:42052842-42052864 TCTGATAGCCACTGACATCCTGG - Intronic
954526640 3:51277752-51277774 ACTGTTAGTAACTAACATCCAGG + Exonic
959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG + Intergenic
963640404 3:147854756-147854778 TCTGTCACTCTCTGACACCCAGG - Intergenic
964339282 3:155691147-155691169 TTTGTCAGACTCTCAAATCCAGG - Intronic
965115233 3:164479612-164479634 TCTGTGATTCACTCACACCATGG + Intergenic
965223028 3:165952264-165952286 TTTTTCAGTCACACACTTCCTGG + Intergenic
965423498 3:168492343-168492365 TCTGTAAGTCACACATATCTTGG - Intergenic
965722771 3:171680009-171680031 TCTGTCAGTGGCTCAGATTCTGG + Intronic
966318236 3:178672845-178672867 TATCTCAGCCACTCACTTCCAGG + Intronic
968855363 4:3116290-3116312 AATGTCAGTCATTCACATGCAGG - Intronic
969330007 4:6469132-6469154 TTTGTTAGTCATTCACATCTTGG - Intronic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
972195107 4:36645071-36645093 TCAGTAAGTCTCTCACATGCAGG + Intergenic
975021139 4:69490432-69490454 TCTGGCAGTCTCTCGCATTCTGG - Intronic
978958937 4:114651631-114651653 TCTGTCATTCTCTGACACCCAGG + Intronic
987023178 5:13895924-13895946 TCTTTCACTCACACACATACAGG + Intronic
995510808 5:112907272-112907294 TCTGGCAGTCACACTGATCCTGG + Intronic
997720405 5:136074016-136074038 TTTGTCAGTCAATGTCATCCTGG - Intergenic
998222157 5:140292391-140292413 TCAGTCAGACACACACATACAGG + Intronic
999769029 5:154761239-154761261 CCTGGCAGGCACTCACTTCCGGG - Intronic
1001098423 5:168794409-168794431 TCTGTGAGTCACTCAGAGCTGGG - Intronic
1001386341 5:171342685-171342707 ACTGACAGTAACTCAAATCCGGG + Intergenic
1005016857 6:21382738-21382760 TTTGTCAGTCACTCCCCTCTAGG - Intergenic
1017014541 6:150089363-150089385 TTTGACAGTCACTCAGATTCCGG - Intergenic
1017441876 6:154472129-154472151 TCTGTCAGTAAAGCCCATCCAGG - Intronic
1017526924 6:155249291-155249313 TCTGTCAGTCAGTCATGTACTGG + Intronic
1018856211 6:167677203-167677225 TCTGTCATCCACCCACACCCTGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019870578 7:3757306-3757328 TCTCTCTGTCACTCAACTCCTGG + Intronic
1020049017 7:5069654-5069676 TCTTTCACTCACTTACATCTGGG - Intronic
1021103916 7:16615553-16615575 TCTCTCGCTCACTCACTTCCAGG + Intronic
1021478407 7:21088729-21088751 TCTATCAGAGACACACATCCTGG + Intergenic
1022516845 7:30980371-30980393 TCTGTCCGGGACTCACACCCAGG + Intronic
1023330682 7:39113319-39113341 ACTGTCAGACAATCTCATCCTGG + Intronic
1024271088 7:47642084-47642106 TCTGTCAGTCACGCCCCTTCTGG + Intergenic
1026467366 7:70665940-70665962 TCTGTCAGCCACATGCATCCTGG - Intronic
1030522294 7:110612883-110612905 TCTGTCAGTCAGGCAGATCCAGG - Intergenic
1032490585 7:132321305-132321327 TCTTACATTCACACACATCCTGG - Intronic
1037498122 8:19460487-19460509 ACTGTCATTCACCCTCATCCTGG - Intronic
1039559464 8:38501138-38501160 TCTGTGAGTCTCTCATTTCCAGG - Intergenic
1044330397 8:90913552-90913574 TCTGCCAGTCTCTCAAATACAGG + Intronic
1047904926 8:129462793-129462815 TCTGGCAGTCAGGCACCTCCTGG - Intergenic
1049081840 8:140449330-140449352 TGTGTCAGTCACTGGCCTCCTGG - Intronic
1050073096 9:1837112-1837134 TTTCTCAGTGACTGACATCCTGG - Intergenic
1051227799 9:14920950-14920972 TTTCCCAGTCAGTCACATCCTGG - Intergenic
1052405162 9:28050282-28050304 TCTGTAAGGAACTCACATGCTGG + Intronic
1052843170 9:33311098-33311120 TCTTTCAGTCTCTGCCATCCAGG + Exonic
1057881233 9:98794415-98794437 TGTGTCTGTCCCTCACATCGGGG - Intronic
1059724614 9:116993986-116994008 TCTGTCAGAGCCTCACATCCTGG + Intronic
1060051497 9:120381832-120381854 AATGTCCGTCACCCACATCCTGG - Intergenic
1060790187 9:126480667-126480689 GCTCTCAGTCACTCAGACCCAGG - Intronic
1062066122 9:134527278-134527300 TCACTCAGTGACTCACCTCCTGG - Intergenic
1062097800 9:134711930-134711952 CCTGTCAGGCACTCACAGACAGG - Intronic
1186827856 X:13359890-13359912 TCTGTCAGTAATGCACATCATGG + Intergenic
1189528660 X:41855359-41855381 TCTGTCCGTCAATGACATCCAGG + Intronic
1190521672 X:51285133-51285155 TCTCTCAGTTACCCACAACCTGG - Intergenic
1192170653 X:68852530-68852552 TCTGGCAGTCCCTTACATGCAGG - Intergenic
1192440757 X:71171675-71171697 TCTGTCAGTCACTCAAGGCCAGG - Intergenic
1192819123 X:74624913-74624935 TCTCTCAGTTACTCCCATACTGG + Intergenic
1195483830 X:105379549-105379571 TCTGTCATACCCTCATATCCTGG - Intronic
1195858040 X:109351807-109351829 TTTATCAGTCACACACATTCTGG + Intergenic
1196599329 X:117584169-117584191 TCTGTCAGTCACCTTCATCAAGG - Intergenic
1200144594 X:153920212-153920234 ACTGTCAGCCACGCACAGCCTGG + Intronic