ID: 1166867959

View in Genome Browser
Species Human (GRCh38)
Location 19:45852485-45852507
Sequence CAGGAAGTTGTCCAGTAGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 134}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867948_1166867959 26 Left 1166867948 19:45852436-45852458 CCCTTTCCCCTACACCACACCCC 0: 1
1: 0
2: 5
3: 66
4: 773
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867956_1166867959 5 Left 1166867956 19:45852457-45852479 CCTTTCTCTTCTGTCAGTCACTC 0: 1
1: 0
2: 0
3: 50
4: 487
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867952_1166867959 18 Left 1166867952 19:45852444-45852466 CCTACACCACACCCCTTTCTCTT 0: 1
1: 0
2: 3
3: 65
4: 571
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867955_1166867959 6 Left 1166867955 19:45852456-45852478 CCCTTTCTCTTCTGTCAGTCACT 0: 1
1: 0
2: 7
3: 61
4: 578
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867950_1166867959 20 Left 1166867950 19:45852442-45852464 CCCCTACACCACACCCCTTTCTC 0: 1
1: 0
2: 0
3: 41
4: 438
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867954_1166867959 7 Left 1166867954 19:45852455-45852477 CCCCTTTCTCTTCTGTCAGTCAC 0: 1
1: 0
2: 5
3: 42
4: 508
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867949_1166867959 25 Left 1166867949 19:45852437-45852459 CCTTTCCCCTACACCACACCCCT 0: 1
1: 1
2: 2
3: 83
4: 965
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867951_1166867959 19 Left 1166867951 19:45852443-45852465 CCCTACACCACACCCCTTTCTCT 0: 1
1: 0
2: 0
3: 45
4: 464
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867947_1166867959 27 Left 1166867947 19:45852435-45852457 CCCCTTTCCCCTACACCACACCC 0: 1
1: 0
2: 3
3: 62
4: 742
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867953_1166867959 12 Left 1166867953 19:45852450-45852472 CCACACCCCTTTCTCTTCTGTCA 0: 1
1: 0
2: 4
3: 74
4: 673
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867959 Original CRISPR CAGGAAGTTGTCCAGTAGTG TGG Exonic