ID: 1166867959

View in Genome Browser
Species Human (GRCh38)
Location 19:45852485-45852507
Sequence CAGGAAGTTGTCCAGTAGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 134}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166867954_1166867959 7 Left 1166867954 19:45852455-45852477 CCCCTTTCTCTTCTGTCAGTCAC 0: 1
1: 0
2: 5
3: 42
4: 508
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867949_1166867959 25 Left 1166867949 19:45852437-45852459 CCTTTCCCCTACACCACACCCCT 0: 1
1: 1
2: 2
3: 83
4: 965
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867955_1166867959 6 Left 1166867955 19:45852456-45852478 CCCTTTCTCTTCTGTCAGTCACT 0: 1
1: 0
2: 7
3: 61
4: 578
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867951_1166867959 19 Left 1166867951 19:45852443-45852465 CCCTACACCACACCCCTTTCTCT 0: 1
1: 0
2: 0
3: 45
4: 464
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867953_1166867959 12 Left 1166867953 19:45852450-45852472 CCACACCCCTTTCTCTTCTGTCA 0: 1
1: 0
2: 4
3: 74
4: 673
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867952_1166867959 18 Left 1166867952 19:45852444-45852466 CCTACACCACACCCCTTTCTCTT 0: 1
1: 0
2: 3
3: 65
4: 571
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867948_1166867959 26 Left 1166867948 19:45852436-45852458 CCCTTTCCCCTACACCACACCCC 0: 1
1: 0
2: 5
3: 66
4: 773
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867947_1166867959 27 Left 1166867947 19:45852435-45852457 CCCCTTTCCCCTACACCACACCC 0: 1
1: 0
2: 3
3: 62
4: 742
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867950_1166867959 20 Left 1166867950 19:45852442-45852464 CCCCTACACCACACCCCTTTCTC 0: 1
1: 0
2: 0
3: 41
4: 438
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1166867956_1166867959 5 Left 1166867956 19:45852457-45852479 CCTTTCTCTTCTGTCAGTCACTC 0: 1
1: 0
2: 0
3: 50
4: 487
Right 1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166867959 Original CRISPR CAGGAAGTTGTCCAGTAGTG TGG Exonic
901175581 1:7296452-7296474 CAGGAACTTCAGCAGTAGTGGGG + Intronic
903404309 1:23083544-23083566 GAGGAACTTGTCCATTAGTTTGG + Exonic
904403196 1:30270330-30270352 TAGGAAGGAGCCCAGTAGTGTGG + Intergenic
905153683 1:35954952-35954974 CATGAAGTTGTCCAGTGGACAGG + Intronic
906019332 1:42613580-42613602 CAGGAATTTTTCCAGAACTGAGG + Intronic
906704695 1:47886409-47886431 CAGCTAGGTGTCCAGCAGTGAGG - Intronic
906718086 1:47985219-47985241 CTGGAAGTTTTCCAGTGGAGGGG + Intronic
908654236 1:66371230-66371252 AAGGAAAGTTTCCAGTAGTGTGG + Intronic
912195306 1:107390828-107390850 CAGGAACTTATCCTCTAGTGAGG + Intronic
914917183 1:151825982-151826004 CAGGGGGTGGTCCAGGAGTGGGG + Intronic
915018991 1:152761788-152761810 CAGGCAGTTACCAAGTAGTGCGG - Exonic
923485218 1:234423333-234423355 AAGGAAGTGGTGCAGTAGAGAGG - Intronic
923942311 1:238842028-238842050 CATGGAGTTATCCAATAGTGGGG - Intergenic
924152536 1:241143288-241143310 CAGTAAATTGACCAGTAGAGTGG - Intronic
1063451909 10:6155622-6155644 CAGGAAGTCTTCCTGGAGTGGGG - Intronic
1066707727 10:38199904-38199926 CATGAAGTTGCCCAGGAATGTGG + Intergenic
1066981978 10:42424804-42424826 CATGAAGTTGCCCAGGAATGTGG - Intergenic
1068362631 10:55998490-55998512 AAGGAAATTGTCCTCTAGTGAGG - Intergenic
1070653612 10:78255587-78255609 CAGGCAGTTGTTGAGTGGTGAGG - Intergenic
1072693179 10:97584748-97584770 CAGGAGCTTGTCCAGGAATGTGG + Exonic
1075470284 10:122683685-122683707 CAGGAAGCTGCCCAGAAGGGAGG - Intergenic
1079394794 11:20052375-20052397 CAGGAAGTTGTTGAGCAGTGTGG + Intronic
1079403536 11:20125863-20125885 CAGAAGGTTGTCCAGTCCTGGGG + Intergenic
1081550866 11:44110738-44110760 CAGGAAGGTGTCAAGTAGACAGG + Intronic
1083313966 11:61802763-61802785 CAGGAAGATGGCTAGTAGGGAGG - Intronic
1083536206 11:63468874-63468896 CAGGATGATGGTCAGTAGTGTGG + Intronic
1087784740 11:102342005-102342027 CTGGAAGGTGTCCAGCTGTGAGG - Intergenic
1087811283 11:102611477-102611499 CAAGAATTTGTCCCCTAGTGGGG + Intronic
1089706427 11:120281230-120281252 CTGGAAGTTGTCAAGCAGAGAGG - Intronic
1091333913 11:134752724-134752746 CAGACAGGTGTCCAGTAGGGAGG - Intergenic
1093376640 12:18436038-18436060 CAAGAAGCTCTTCAGTAGTGTGG + Intronic
1095316896 12:40774287-40774309 CAGAAGGTTGCCAAGTAGTGTGG + Intronic
1096828171 12:54295060-54295082 CAGGGAGTTGGCCAGGACTGAGG - Intronic
1097275860 12:57813307-57813329 CAGGTAGTCGTCCAGCTGTGTGG + Exonic
1100355975 12:93830049-93830071 CAGGAAATTGACCAGTGGTGGGG + Intronic
1100594379 12:96059209-96059231 CAGGAAGTTGGCCAGTACAGTGG - Intergenic
1102528378 12:113528274-113528296 CAGGCTGGTGTGCAGTAGTGTGG - Intergenic
1103737502 12:123069953-123069975 CAGGAAGCTGCCCAGCAGTGGGG + Intronic
1109130269 13:58575641-58575663 CAGGAAGATGTGGAGAAGTGTGG - Intergenic
1115572555 14:34680700-34680722 CAAGAAGTAGTACAGCAGTGGGG + Intergenic
1116531518 14:45978649-45978671 CAGTAAAATGTCCAGTGGTGTGG - Intergenic
1117538604 14:56725157-56725179 CAGGAAGTTGACCAGCTGTGGGG - Intronic
1120722487 14:87903932-87903954 CAGGAAGTGGGGCAGCAGTGTGG + Intronic
1123627778 15:22239339-22239361 CAGGGAGCTTTCCAGAAGTGGGG + Intergenic
1124799217 15:32813623-32813645 CAGGTAGTTGTGCAGCATTGAGG - Intronic
1128229962 15:66027544-66027566 CAGGAAGTGGACCTGCAGTGGGG - Intronic
1129204016 15:74024710-74024732 CAGGGAGTTGTCCAGTGCTTTGG + Intronic
1131939449 15:97544842-97544864 CAGGAAATTGACCCATAGTGTGG - Intergenic
1132225940 15:100141578-100141600 CAGGAAGCCTTCCAGGAGTGGGG - Intronic
1132346102 15:101109944-101109966 CAGGCTGATGTGCAGTAGTGTGG - Intergenic
1133463572 16:6008282-6008304 CAGGAAGGTGGCCAGGAGTGTGG + Intergenic
1135765499 16:25174323-25174345 AAGGTAGTAGACCAGTAGTGAGG - Intronic
1138651273 16:58463096-58463118 GAGGAACTTGTGCAGGAGTGAGG - Intronic
1139247278 16:65457374-65457396 AAGGAACTTTTCCAGTATTGAGG - Intergenic
1139713987 16:68798101-68798123 CATGGAGATGGCCAGTAGTGGGG + Intronic
1141541283 16:84724110-84724132 CAGGAAGTTATTCAATAATGAGG + Intronic
1142146071 16:88493400-88493422 CAGGAAGCTGTCCCGGGGTGCGG + Intronic
1143329887 17:6126040-6126062 GAGCAGGTTGTCAAGTAGTGGGG - Intergenic
1152413561 17:80144151-80144173 CAGTAAGTTGTCCTGGGGTGCGG - Exonic
1159145605 18:64450429-64450451 CATTAAGTTTTCCATTAGTGGGG + Intergenic
1162682378 19:12355813-12355835 CAAAAATTTGTCCAGGAGTGGGG + Intronic
1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG + Exonic
927157821 2:20231742-20231764 CAGGAAGCTCTCCAGCAGGGAGG + Intergenic
928344885 2:30482831-30482853 CAGGAAATTGTTTAGTAGTATGG + Intronic
928851945 2:35759037-35759059 CTAGAAGTTGTCCAGGAGTCAGG + Intergenic
929483036 2:42330020-42330042 CAGGCTGTTCTCCAGAAGTGTGG - Exonic
931865369 2:66404526-66404548 CAGGATGGAGTCCAGTGGTGTGG - Intergenic
932141056 2:69278535-69278557 CTGGCAGCTGTCCAGTTGTGTGG - Intergenic
932218107 2:69979658-69979680 CAGGAGGTTGCCCAGAAATGTGG - Intergenic
933225255 2:79741011-79741033 AAGGAAAATGTGCAGTAGTGTGG + Intronic
935451315 2:103213034-103213056 CAGGAAGGTCTTCAGTGGTGTGG - Intergenic
942528359 2:176880795-176880817 CAGCCAGTCTTCCAGTAGTGTGG + Intergenic
943906612 2:193506832-193506854 CAGAAAGTTGCACAGTAGTTAGG - Intergenic
944465550 2:199996462-199996484 AAGGAAGTTGTGCAGCAGGGTGG + Intronic
1169707610 20:8523292-8523314 CAGGAAGTTGTGATTTAGTGAGG + Intronic
1172493651 20:35362146-35362168 CAGGAATTTGTCAAGTGGAGAGG + Intronic
1176971987 21:15277048-15277070 CAAAAAGTTGTTCAGTAGTATGG - Intergenic
1178118886 21:29447421-29447443 CAGGATGGAGTGCAGTAGTGGGG - Intronic
1178632959 21:34278432-34278454 AGGGAAGTTTTCCAGTAGCGGGG + Intergenic
1179008089 21:37531837-37531859 CTGGAGGCTGTCCAGGAGTGGGG - Intergenic
1181453778 22:23041905-23041927 CTGGAAGTTTTGCTGTAGTGTGG + Intergenic
1184955284 22:47881872-47881894 CAGGGAGTTGGCAAGGAGTGAGG + Intergenic
949313427 3:2725575-2725597 CAAGAAACTGTCCTGTAGTGGGG + Intronic
949414082 3:3798547-3798569 CCAGAAGTTGTTCAGTACTGAGG + Intronic
950186835 3:10950680-10950702 CCGGAAGTGGTCCAGGTGTGGGG - Intergenic
950753274 3:15148865-15148887 CAGGAAGTACTCCAGCAGGGAGG - Intergenic
956491074 3:69772854-69772876 CAGGAAGTTGTCTAGGTATGAGG + Intronic
958720489 3:97837403-97837425 CAGCAAGTTTTACAGTAGTTGGG + Intronic
960144217 3:114182159-114182181 CAGTGAGTGGTCCAGTAGTATGG + Intronic
967150281 3:186642205-186642227 CAGGAAGGTGAGCAGAAGTGAGG - Intronic
971173970 4:24262867-24262889 CAGGAAGTTGTACAGCCCTGAGG - Intergenic
972765060 4:42145266-42145288 CATGGAGTTCTCCTGTAGTGTGG - Intronic
973812043 4:54581050-54581072 CAGGAAGTTGTCCAGAGGTGAGG + Intergenic
973846368 4:54917204-54917226 CAGAAAGTTGTCTGGTAGAGAGG + Intergenic
974353851 4:60786339-60786361 TAGGAAGTTGGCCAGAAATGAGG + Intergenic
978456788 4:108902020-108902042 AAGAAAGTTGTCCAGTAATTGGG - Intronic
983454067 4:167940712-167940734 CAGGGAGTGGTTCAGTAGGGAGG - Intergenic
983712191 4:170732039-170732061 CAGGAAAATGTACAGAAGTGAGG - Intergenic
985636148 5:1036757-1036779 GAGGGGGTCGTCCAGTAGTGTGG + Intronic
985851051 5:2389365-2389387 CAGGAGGTTGTCCAGGTGAGAGG - Intergenic
990066792 5:51726551-51726573 CAGAAATTTGTTCAGAAGTGGGG + Intergenic
991125424 5:63064364-63064386 CAGGAAGGAATCCAGTAGTCAGG - Intergenic
996839280 5:127828823-127828845 CAGAAAGTTGTCCAGAAATAAGG + Intergenic
996962029 5:129262828-129262850 CAGGAAGCTTTCCTGTAGTGTGG - Intergenic
997262822 5:132477254-132477276 CTGGAATTTGTCCAGAATTGGGG - Intergenic
997676848 5:135719620-135719642 CAGGAATGTGTCCTGGAGTGTGG + Intergenic
998348598 5:141486061-141486083 GAGTAAGCTTTCCAGTAGTGGGG - Exonic
998407999 5:141884963-141884985 GAGTAAGTTATCCAGGAGTGAGG + Intergenic
999366032 5:151024041-151024063 CAGCAAGTTCTCCAGAATTGAGG + Intronic
999512774 5:152270110-152270132 CAGGAACTTGCCTAGTAGTGAGG - Intergenic
999994608 5:157080332-157080354 GAGGAACTTGTCCATTAGTTTGG - Intergenic
1000739641 5:164951866-164951888 ATGAAAGTTGTCCAGTAGAGAGG - Intergenic
1000816221 5:165925751-165925773 CTCAAAGTTGTACAGTAGTGGGG + Intergenic
1002756951 6:171366-171388 CAGGAAGGAGTGCAGTGGTGTGG - Intergenic
1003801188 6:9669239-9669261 CTGGAAATTGCCCAATAGTGGGG - Intronic
1005326169 6:24702753-24702775 CAGGAAATGGTCCAATAGAGGGG + Exonic
1007411067 6:41661907-41661929 CAGGAAGTTCACAGGTAGTGTGG - Intergenic
1008266982 6:49439735-49439757 CAGTAAGGGGTCCAGTGGTGTGG - Intronic
1013371264 6:109472938-109472960 CAGGAGGCTGTGCAGTAGTGGGG - Intronic
1014835887 6:126160038-126160060 CATGAATATGTCCAGAAGTGAGG - Intergenic
1015726639 6:136306143-136306165 CAGCAAGTTCTCCAGTAAGGAGG + Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1022582438 7:31569296-31569318 CAGGAAGTTGTGAAGTAGTGTGG - Intronic
1023623466 7:42095024-42095046 CAGAAAGGTGACCAGGAGTGTGG + Intronic
1024813353 7:53238718-53238740 AAGGAAGCTGTCCAGATGTGTGG - Intergenic
1027141648 7:75661877-75661899 CAGGAAGTTCCCCAAGAGTGTGG + Intronic
1029545893 7:101210433-101210455 GAGGAAGATGCCCTGTAGTGGGG + Exonic
1029577933 7:101415981-101416003 TAGAAAATTGTCCAGTAGTCAGG + Intronic
1030068394 7:105678030-105678052 CAGGAAGTTGTCTTGAAGTAGGG + Intronic
1030549440 7:110939500-110939522 CAGGAAATTGTGAAGTAGTTGGG - Intronic
1031363730 7:120878348-120878370 GTGGAAGTAGTCCAGTGGTGGGG - Intergenic
1032878637 7:136065320-136065342 CAGGAAGTTGTCTCTTAGTGAGG + Intergenic
1033822870 7:145155143-145155165 CAGCAGGTTTTCCAGTAGAGTGG - Intergenic
1035013891 7:155746323-155746345 CAAGCAGTAGTCCAGTAGTCTGG - Intronic
1035773951 8:2173153-2173175 CAGGTAGATGTCCATGAGTGAGG + Intergenic
1041669046 8:60474935-60474957 CATGAAGTTGTCCTGTCTTGAGG - Intergenic
1049737229 8:144215518-144215540 CAGGAAGTGGTCCTCTAGGGAGG - Intronic
1050609281 9:7334606-7334628 CGGGAAGTTTTCCTGTGGTGAGG + Intergenic
1057018735 9:91679159-91679181 CAGGAGGTAGACCAGTAGTCTGG - Intronic
1058254508 9:102744128-102744150 GAGGAAGGTGTCCAGCAGGGGGG - Intergenic
1058279768 9:103099409-103099431 CAGGAAGATGTGGAGAAGTGTGG - Intergenic
1060010577 9:120039951-120039973 CAGCAAGTTGACCAGGAATGAGG - Intergenic
1192221064 X:69197646-69197668 AAGGAAGTGGGCCAGAAGTGGGG - Intergenic
1192717062 X:73654769-73654791 CAGGAATTTGTCCATTATTTTGG + Intronic
1197751735 X:129968915-129968937 CAGAAAGTTGACCAGGTGTGTGG - Intergenic
1198069201 X:133131300-133131322 CAGGAAGTTGTGCAATATAGTGG + Intergenic
1198949688 X:142056541-142056563 CCTGAAGTTTTCCAGCAGTGTGG + Intergenic