ID: 1166868032

View in Genome Browser
Species Human (GRCh38)
Location 19:45852917-45852939
Sequence GAGCAGAAGCAGAAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1510
Summary {0: 1, 1: 0, 2: 12, 3: 145, 4: 1352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166868032 Original CRISPR GAGCAGAAGCAGAAGGAGAG TGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901056798 1:6452082-6452104 GAGCAGAGGCGGAAGGTGGGTGG + Exonic
901145847 1:7064202-7064224 GAGGAGGAGCAGGAGGAAAGGGG - Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901195545 1:7438036-7438058 GAGCAGAATCTGAAGGAGAGGGG + Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
901807672 1:11748544-11748566 TAGACGAAGCAGCAGGAGAGCGG - Exonic
901815552 1:11791476-11791498 GAGCGGAGGCACAGGGAGAGGGG - Intronic
902046438 1:13528220-13528242 GAAGAGAACCAGAAAGAGAGAGG + Intergenic
902084329 1:13847269-13847291 GACCAAAAGCAGAAGATGAGAGG - Intergenic
902586655 1:17443359-17443381 GAACAGATGCAGAAAGAGTGGGG - Intergenic
902664365 1:17927285-17927307 GAGCAGAAAAGGAAGGACAGGGG - Intergenic
902768871 1:18634268-18634290 GGGGAGATGCAGAAGGAGAGAGG - Intronic
902878202 1:19353469-19353491 GGGCAGAAACAGAAGGGCAGGGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904265173 1:29314449-29314471 GAGCTGAGGGGGAAGGAGAGTGG - Intronic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904696523 1:32334790-32334812 GAGCAGGAGCAGGGGGAGATCGG - Exonic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
904953434 1:34262912-34262934 GAACAGAAGCAGAAAGACAGAGG - Intergenic
905036278 1:34919990-34920012 GAGCAGGAGAAGAAGGGAAGAGG + Intronic
905605349 1:39293657-39293679 TAACAGCAGCAGAAGGAGACAGG + Intronic
905664406 1:39753910-39753932 GAGCAGAGGCAGCAGAAGACCGG - Intronic
905980561 1:42222001-42222023 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
906052827 1:42888604-42888626 GAGCTGTAGCAGAGGGAGAGGGG - Intergenic
906106766 1:43299470-43299492 GAGTAGGAGCAGGGGGAGAGTGG - Intergenic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906180854 1:43817625-43817647 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
906189080 1:43884321-43884343 GAGCAGGAGTCGAAGGAGAAAGG - Intronic
906513095 1:46422780-46422802 GAAAAGAGGCAGAAGGACAGAGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
907177062 1:52534169-52534191 GAACAGAATGGGAAGGAGAGGGG - Intronic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
908171908 1:61513213-61513235 AGGCAGGTGCAGAAGGAGAGAGG + Intergenic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908501346 1:64745724-64745746 GAGTAGGAGGTGAAGGAGAGTGG + Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908812890 1:68002011-68002033 GAGGAGAAGGAGGAGGAGAAAGG - Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909456362 1:75854276-75854298 GAGCAGCAGTAGTAGGAGATTGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
910163227 1:84296592-84296614 GAGGAGCAGGAGAGGGAGAGAGG + Intergenic
910168715 1:84355193-84355215 GTGCAGATGCAGAAACAGAGTGG + Intronic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
911117960 1:94265697-94265719 GAGCAGAAGCAGTAGAAAGGTGG - Intronic
911129357 1:94373425-94373447 CATCAGAAGGGGAAGGAGAGGGG - Intergenic
911452380 1:98080007-98080029 GAGCAGAAGGAGTATCAGAGAGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911474325 1:98357576-98357598 GAAAAGAAGAAGAAGGAGAAGGG - Intergenic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912145325 1:106786686-106786708 TAGCAGCAGCAGAAGGACACGGG - Intergenic
912158635 1:106953347-106953369 GAGAAGAAGCAAAGTGAGAGAGG - Intergenic
912547904 1:110464617-110464639 TAGAAAAAGCATAAGGAGAGTGG + Intergenic
912945199 1:114078856-114078878 GAGCAAAGGCAGAAGCAGACAGG - Intergenic
913173025 1:116249442-116249464 GAGCAGCAGGTGAAGGACAGGGG - Intergenic
914388796 1:147199157-147199179 GAACAGAAGAAGAAGGAAAATGG + Intronic
914393654 1:147243577-147243599 GCGCAGACCCAGGAGGAGAGCGG - Intronic
914815214 1:151058122-151058144 GAGGGGGAGGAGAAGGAGAGAGG + Exonic
914826233 1:151139653-151139675 AAGCCGAAGAAGAAGGGGAGGGG - Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915296097 1:154922967-154922989 TAGCACAGGCTGAAGGAGAGAGG - Intergenic
915348579 1:155210849-155210871 GAGCACAGGCTGAAGGAGAGTGG + Intronic
915351771 1:155231477-155231499 GAGCACAGGCTGAAGGAGACTGG + Intergenic
915444631 1:155967675-155967697 GCGGAGAAGCAGATGGAGTGTGG - Intronic
915465947 1:156098001-156098023 TAGCAGAAGCTGGAGGATAGGGG - Intronic
915556549 1:156664043-156664065 GAAAGAAAGCAGAAGGAGAGGGG + Intergenic
915620769 1:157082514-157082536 GAACAGAAAGAAAAGGAGAGCGG + Intergenic
916084093 1:161255783-161255805 AAGCCAAAGGAGAAGGAGAGGGG + Intergenic
916265987 1:162890278-162890300 GAGAATAGGCATAAGGAGAGGGG + Intergenic
916318175 1:163473457-163473479 GTGCAGGAGTAAAAGGAGAGAGG - Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
917004905 1:170403627-170403649 GACCAAAAGCAGAAGCAGATAGG + Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917439015 1:175049867-175049889 TAGGAGAAGGAGAAGGTGAGGGG + Intergenic
917479149 1:175395761-175395783 GAGTAGAATAAGAAGGAGATAGG - Intronic
918114125 1:181482656-181482678 GAGAAGATGCGGAAGGAGAATGG - Intronic
918301940 1:183212583-183212605 GTCCAGAAGTAGATGGAGAGAGG - Intronic
918372069 1:183870513-183870535 TAGCAGAAGCAGGAAGACAGCGG - Intronic
918595397 1:186287006-186287028 GAGCAAAGGGAGAGGGAGAGTGG + Intergenic
918682215 1:187369535-187369557 GAGCAGAGGGAGGGGGAGAGAGG + Intergenic
918995865 1:191758572-191758594 GAGTAGGAGGTGAAGGAGAGTGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919244318 1:194959546-194959568 GAGTAGAAACAGCAGAAGAGAGG - Intergenic
919420908 1:197369338-197369360 GAGGGGATGCAGGAGGAGAGGGG - Intronic
919803396 1:201366785-201366807 GAGCAGAGGCTCAGGGAGAGAGG - Intronic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919837641 1:201586663-201586685 GAGCAGGGAGAGAAGGAGAGAGG + Intergenic
919928038 1:202202813-202202835 TGGCAGAAGCAGAGGGTGAGAGG - Intronic
919929813 1:202214069-202214091 GAGAAGCGGCAGAACGAGAGAGG + Intronic
919974509 1:202602063-202602085 GGGCACAAGCAGAATCAGAGGGG + Intronic
920070790 1:203301556-203301578 GAGCAGCAAGATAAGGAGAGTGG - Intergenic
920543077 1:206793898-206793920 GAGTAGCAGGGGAAGGAGAGTGG + Intergenic
920744915 1:208617265-208617287 AAGCAGAGGCAGAAGTAAAGGGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921640296 1:217544994-217545016 GAGAAAAACAAGAAGGAGAGGGG - Intronic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921941714 1:220847357-220847379 GAGTAGGAGCAGATGAAGAGAGG - Intergenic
922168541 1:223135924-223135946 AAGCAGAAATACAAGGAGAGGGG - Intronic
922662974 1:227446492-227446514 GAGTAGAAGCAGGAGGGGTGAGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922804497 1:228378431-228378453 GGGGAGAAGGAGGAGGAGAGGGG - Intronic
922871102 1:228902536-228902558 GAGCCAGAGAAGAAGGAGAGGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923237729 1:232050564-232050586 GAGCAGAATCAGTGGGAAAGTGG + Intergenic
923272641 1:232371953-232371975 GAGCAGAAGCCCAGGGCGAGGGG + Intergenic
923462341 1:234218011-234218033 GCCCAGAAGCATGAGGAGAGTGG + Intronic
923466386 1:234250791-234250813 GACAAGAAGCAAAAAGAGAGAGG + Intronic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924448775 1:244159018-244159040 GAGGAGAAGGAGAAGAAGAAGGG - Intergenic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
1062880095 10:971303-971325 GAGATGAAGCACAAGGACAGGGG + Intergenic
1063495221 10:6501470-6501492 GAGCAGGAGGAGAAGGCGGGAGG + Intronic
1063647399 10:7898684-7898706 GTGCAAAAGCAGAAAGAAAGAGG + Intronic
1063729636 10:8681611-8681633 GAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1064067554 10:12195702-12195724 GAGGAGAAGAAGAAGGGGAAAGG - Intronic
1064114792 10:12568389-12568411 GAGCAGGAGGGGAAGGGGAGGGG - Intronic
1064146863 10:12832804-12832826 GAGCAAAAGAAGATGGACAGTGG + Exonic
1064305127 10:14158639-14158661 GAGGAGAAGGAGGAGGAGAAGGG + Intronic
1065235623 10:23648668-23648690 TAGCAGAAGCACTTGGAGAGGGG + Intergenic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065588362 10:27241441-27241463 GAGGAGCAGCCGAAGGAGAGAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066571552 10:36778601-36778623 GGTCAGAAGCAGAATGGGAGAGG - Intergenic
1066617300 10:37308229-37308251 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068755580 10:60648853-60648875 GAGCAGGAGCAGAAGCAGCTTGG - Intronic
1068937584 10:62650973-62650995 GAACAGAAAGAGAGGGAGAGAGG + Intronic
1069294801 10:66830505-66830527 GAGCACGAGTAGAAGCAGAGTGG - Intronic
1070020907 10:72584986-72585008 GGGTAGAAGCAAAAGGACAGAGG + Intronic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070578435 10:77698512-77698534 GAGCAGAAGCAGCAGCAATGGGG + Intergenic
1070599083 10:77853379-77853401 GAGGAGGACCAGAAGGAGATCGG - Exonic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1070689210 10:78512210-78512232 GAGGAGAGGAAGAGGGAGAGAGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072822953 10:98576525-98576547 GAGGACAAGGAGAAGCAGAGAGG + Intronic
1073055462 10:100697844-100697866 GAGCAGAACAAGGAGGAAAGAGG + Intergenic
1073062650 10:100741758-100741780 GAAGAGAAGCAGAAAGGGAGGGG - Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073125118 10:101144594-101144616 GGGCAGGTGCAGAAGGAGAGGGG - Intergenic
1073206184 10:101770661-101770683 CAGCAGAGGCAGAGGGCGAGCGG + Intronic
1073241006 10:102058179-102058201 TAGCCGAAGCAGAGAGAGAGGGG - Intergenic
1073249851 10:102114746-102114768 GAGAAGGAGGAGGAGGAGAGAGG - Intronic
1073538310 10:104297448-104297470 AACCAGAGGGAGAAGGAGAGAGG + Intronic
1073629232 10:105131769-105131791 GAGGAGAAGCAAGAGAAGAGAGG + Intronic
1073676649 10:105654946-105654968 GAGCAGAAGCAAGAGGGGAGAGG - Intergenic
1073729918 10:106275401-106275423 GAGCTGAAGCAAAAGCATAGAGG - Intergenic
1074376682 10:112946723-112946745 GAGAAGCAGCAGAAGGGCAGTGG + Intergenic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1075014834 10:118903236-118903258 GAGCAGAAGCAGCAGGAAATTGG + Intergenic
1075746690 10:124732925-124732947 GACCAGAAGTAGGAGCAGAGAGG - Intronic
1076163447 10:128263528-128263550 GAGAAGAAGAAGAGGGACAGAGG - Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077280260 11:1741436-1741458 GAGGAGAGGGAGGAGGAGAGCGG + Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078245262 11:9568412-9568434 GAGAACAAGCATAAGGAGAAAGG + Intergenic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078924882 11:15865569-15865591 GAGCAGAAGTTGAAGGCCAGAGG - Intergenic
1079633842 11:22711476-22711498 GAGCAGAATCAGGGGGAGACGGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079918957 11:26407824-26407846 GAGCAGAAGGCAAAGGGGAGTGG - Intronic
1080159783 11:29159951-29159973 GAGAAGGAGAAGAAGGAGAATGG + Intergenic
1080174741 11:29349072-29349094 GGGGAGGAGGAGAAGGAGAGGGG + Intergenic
1080314057 11:30928188-30928210 GAGGAGAAGAAGTAAGAGAGAGG - Intronic
1080529493 11:33161282-33161304 GAGCAGGTGAGGAAGGAGAGTGG - Exonic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1081567760 11:44270384-44270406 GAACAGGAGAAGAAGGAGGGAGG - Intronic
1081589416 11:44410783-44410805 AGGCAGAAGCAGAATAAGAGAGG + Intergenic
1081617810 11:44600973-44600995 CACCAGAGGCAGAAGGAAAGGGG + Intronic
1081908875 11:46687346-46687368 GGGCAGCCGCAGAAGGAGAAGGG - Intronic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082774266 11:57233911-57233933 GGGCAGAGGGAGGAGGAGAGGGG - Exonic
1082892394 11:58154077-58154099 GAGAAGAAGAAGAAGAAGAAGGG + Intronic
1082922369 11:58509402-58509424 GAGCAGACTCAGAAGAAGTGAGG + Intergenic
1083261415 11:61525054-61525076 AAGCACAGGCAGGAGGAGAGGGG - Intronic
1083264815 11:61541832-61541854 GAGCAGAAGGGGGAGGAGAGAGG + Intronic
1083367204 11:62148540-62148562 GAGAAGAAGAAGAAGGTGAGGGG + Exonic
1083708643 11:64533986-64534008 AGGCAGGTGCAGAAGGAGAGCGG + Intergenic
1083813835 11:65120772-65120794 GAGAAGAAGAAGAAGAAGACAGG - Exonic
1083822679 11:65181860-65181882 GAGGAGGAGGAGAAGGAGAGAGG + Intronic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084518267 11:69647974-69647996 CATCTGAGGCAGAAGGAGAGAGG - Exonic
1084753932 11:71222748-71222770 GAGCAGGAGCAGACTGAGAGAGG - Intronic
1084860436 11:72014504-72014526 GGGCAGCAGCAGGAGGAGCGTGG - Exonic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085468228 11:76738662-76738684 AACAAGAAGCAGAAAGAGAGGGG + Intergenic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085863560 11:80261842-80261864 GGGAGGAAGCAGAAGCAGAGGGG - Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086458656 11:86984108-86984130 GAGATGAAGCAGGAGGAGAGGGG + Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087641904 11:100764002-100764024 AAGAAGAAGAAGAAGAAGAGGGG - Intronic
1087655235 11:100914723-100914745 TAGCAGAAGGATCAGGAGAGAGG - Intronic
1087827473 11:102782237-102782259 GAGCAGGAGAAGAAAGAGAGGGG - Intergenic
1088034697 11:105296972-105296994 GAGCAGGAGTAGAAGCAGGGTGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088376586 11:109147825-109147847 GAACATAAGCAAAGGGAGAGAGG + Intergenic
1088423652 11:109676264-109676286 GAAGAGAAGGAGGAGGAGAGAGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089156186 11:116404544-116404566 GAGGAGAACCAGATGGACAGGGG + Intergenic
1089496058 11:118909239-118909261 AGGCAGAAGCAGGAGGAAAGGGG + Intronic
1089535165 11:119156544-119156566 GAGCTGCAGCAGAAAGAGAAGGG - Exonic
1089593682 11:119561136-119561158 GACCAGACGCAGAAGGCTAGTGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089831366 11:121331159-121331181 GAGCAGAAGTAAAGAGAGAGAGG + Intergenic
1089980220 11:122766054-122766076 GGGAAGAAGCGAAAGGAGAGGGG + Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090206022 11:124884905-124884927 CAGGAGAAGCTGAAGGACAGTGG + Exonic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1090307407 11:125703289-125703311 GAGCGCAAGCAGAAGCAGGGTGG + Intergenic
1090608536 11:128449821-128449843 CAGCAGAAGCAAGGGGAGAGTGG + Intergenic
1090817651 11:130314005-130314027 GAGAAAAAGCAGAAGGGGAAAGG + Intronic
1090827618 11:130398847-130398869 TAACAGAAACAGAAGGAGAAAGG + Intergenic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091215056 11:133895971-133895993 GAGCAAAAGCAGAAAGGGGGTGG - Intergenic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1091750924 12:3020812-3020834 AAGCAGAAACAGAGGGAGAGGGG - Intronic
1092174530 12:6394102-6394124 GAGCAGTAGCACAGGGAGATGGG + Intergenic
1092253129 12:6912541-6912563 GGGCAGAAGCAGGACCAGAGCGG + Intronic
1092785608 12:12023755-12023777 GAGCAGATGCTCAAGGAAAGTGG + Intergenic
1093352658 12:18122741-18122763 GAGTAGTAAAAGAAGGAGAGAGG + Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1094052958 12:26240528-26240550 GAGGAGCAGGAGAAAGAGAGGGG + Intronic
1094083775 12:26566220-26566242 GAGAAGAAGGAGGAGGAAAGAGG + Intronic
1094084575 12:26575429-26575451 GAACAAATGCAGAAGGAGAGTGG + Intronic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094456533 12:30641365-30641387 GAGAAGAAGAAGAAGGGTAGAGG + Intronic
1094487555 12:30937107-30937129 GAGATGAAGCAGGAGGAGATAGG + Intronic
1094751879 12:33418964-33418986 GAGAAAAAGCAGAGGTAGAGGGG - Intronic
1095270213 12:40209877-40209899 GAGCAGTACCAGAAAGACAGTGG - Intronic
1095283397 12:40383472-40383494 GAGCAGAAGCAGCAGTACAAAGG + Intergenic
1095408011 12:41889669-41889691 GAGTAGAGGAAGCAGGAGAGGGG - Intergenic
1095511867 12:42959817-42959839 GAAGATAAGCAGAAGAAGAGAGG - Intergenic
1095659089 12:44708067-44708089 GAGAAGAACCAGAAGGACTGTGG + Intronic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1096493118 12:52023690-52023712 GAGGAGGAGCAGCAGGGGAGGGG - Intronic
1096525483 12:52207657-52207679 GAGCTGAAACAGAGAGAGAGAGG + Intergenic
1096537668 12:52285946-52285968 GAGCAGAGGAGGAAGGGGAGAGG + Exonic
1096886141 12:54721273-54721295 GAGGAGAAGAAAAAGAAGAGAGG - Intergenic
1097016726 12:55992575-55992597 GACCAAAAGCAGAAGGGGAAGGG - Exonic
1097023699 12:56038224-56038246 GAGGGGAATCAGAAGAAGAGAGG - Exonic
1097245013 12:57603083-57603105 GAGCAGAAGATGAAGGGGAGAGG - Exonic
1097285079 12:57870909-57870931 AAGCAGAGGGAGAAGGAAAGGGG - Intergenic
1097473857 12:60029482-60029504 GAACAGAAACAGAGGGAGAGAGG - Intergenic
1098046311 12:66404528-66404550 GAGCAGGAGCAGAAGCCCAGAGG - Intronic
1098143438 12:67474054-67474076 GAGCAGTAGGAGTTGGAGAGGGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1099138820 12:78943405-78943427 GAGCAGGAGCAAGAGGTGAGGGG + Intronic
1099286101 12:80715977-80715999 GAGCAGAAAGAGAGGGAGAAAGG + Intergenic
1099656349 12:85497182-85497204 GTACAGAGGCAGCAGGAGAGTGG - Intergenic
1099858667 12:88203053-88203075 GAGCAGGAGCAATAGGAGTGGGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100098749 12:91076588-91076610 GAGGAGAAGGAGACGGAGAAGGG + Intergenic
1100146929 12:91689816-91689838 GGGGAGAAGAAGATGGAGAGAGG + Intergenic
1100308014 12:93369046-93369068 TGGCAGAAGGAGAAGGAGAAGGG - Intergenic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100663093 12:96721998-96722020 GGGCAGAAAGAGAAGGACAGTGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100891585 12:99131985-99132007 GGGGAGGAGCAGAAGAAGAGAGG - Intronic
1100893096 12:99147779-99147801 GAGGAGAAGTAGAAGAACAGGGG + Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101285366 12:103306494-103306516 GAGTAGGAGAAGAAGAAGAGGGG + Intronic
1101321504 12:103676989-103677011 GGACAGAATGAGAAGGAGAGAGG - Intronic
1101364548 12:104059660-104059682 GAGCAGATCTTGAAGGAGAGTGG + Intronic
1101437593 12:104677395-104677417 GAACAGAAGGGGAAGGTGAGTGG + Intronic
1101580504 12:106037764-106037786 GAGAAGGAAGAGAAGGAGAGGGG - Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101816586 12:108150601-108150623 GCACAGAAGCAGAAGTAAAGAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102197374 12:111034728-111034750 GAGGAGGAGGAGGAGGAGAGAGG + Intronic
1102241762 12:111328986-111329008 GAGGAGAGGGAGAGGGAGAGAGG - Intronic
1102262704 12:111454355-111454377 GACCAGAAGCAGAGGGAGAGAGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102701514 12:114843436-114843458 AGCCAGAAGCAGAAGGAGCGAGG - Intergenic
1102796336 12:115691948-115691970 GAGCAGACACAGAGGGGGAGAGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103060689 12:117856027-117856049 GAGAGGAAGCAGAGAGAGAGTGG - Intronic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103340999 12:120221150-120221172 GATCAGAGGCAGAAAGAAAGAGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103449478 12:121018381-121018403 TAGCAGAAGCGGGAAGAGAGCGG - Intergenic
1103661354 12:122521384-122521406 GAGCCGGAGCAGAAGCAAAGAGG - Exonic
1103715743 12:122944517-122944539 GAGCTGGGGCAGAGGGAGAGGGG + Exonic
1103829572 12:123768113-123768135 GAGGAGGAGGAGGAGGAGAGAGG - Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104064520 12:125296218-125296240 GGGCATAGGCAGAAGGAGATGGG - Intronic
1104187020 12:126442561-126442583 GAGCAGGAGCAGGAGGCCAGAGG + Intergenic
1104301961 12:127572372-127572394 GAGAAGGAGAAGAAGGAGAAGGG + Intergenic
1104467114 12:128999585-128999607 AAGCAGAAGGGGGAGGAGAGTGG - Intergenic
1104735633 12:131134318-131134340 GGTCAAAAGCAGAAGAAGAGGGG - Intronic
1104801562 12:131558325-131558347 GCTCTGAAGCAGCAGGAGAGGGG + Intergenic
1104878095 12:132050783-132050805 GCGCAGAACCTGCAGGAGAGAGG + Intronic
1104926661 12:132317361-132317383 GAGTGGAAGGAGCAGGAGAGAGG - Intronic
1104947492 12:132422885-132422907 AGACAGAAGCAGATGGAGAGAGG - Intergenic
1105544861 13:21343982-21344004 GAGGAGGAGAAGAAGGAGAAGGG - Intergenic
1105703397 13:22950793-22950815 GAGGAGAAATAGAAGGAGACAGG + Intergenic
1105974312 13:25459796-25459818 GTTCAGGAGCAGCAGGAGAGGGG + Intronic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106026553 13:25960708-25960730 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1106205261 13:27587291-27587313 CAGCAGGAGCAGAAGGGAAGGGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107143712 13:37034072-37034094 GAGAAGAAGGAGAAAGATAGGGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108037802 13:46309891-46309913 AAGCTGAAGCAGGAGGACAGAGG - Intergenic
1108166208 13:47695925-47695947 GAGCAGAAGGAAAAGTAGAAGGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109731468 13:66419500-66419522 GAGGGCAAGCAGAAGCAGAGTGG + Intronic
1109789638 13:67230304-67230326 GAGGAGAGGGAGAAGGAGAGAGG - Intronic
1109922169 13:69079257-69079279 GAGGAGAAAGAGTAGGAGAGAGG - Intergenic
1110558851 13:76888424-76888446 GAGCAGAAGTAGAAGCAGTTAGG - Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111886794 13:94031488-94031510 GACCAGAAGAAACAGGAGAGTGG + Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1113140689 13:107145967-107145989 GAGCTGGAGCAGAAAGACAGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114547818 14:23515110-23515132 GAGCAAAAGGAGGTGGAGAGAGG + Intergenic
1114664404 14:24369464-24369486 GAAGAGGAGCAGAGGGAGAGGGG - Intronic
1114730867 14:24991174-24991196 GAGGAGGAGGAGGAGGAGAGAGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1116665140 14:47764926-47764948 TAGAAGGAGAAGAAGGAGAGAGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1117886273 14:60367328-60367350 TAGCAGTAGCAGTAGGAGATAGG - Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118171679 14:63395388-63395410 GAGGAGGAGGAGGAGGAGAGCGG + Intronic
1118175973 14:63440368-63440390 CAGCAGAAGTGGTAGGAGAGAGG + Intronic
1118318445 14:64739411-64739433 GGGCAGCAGGAGGAGGAGAGTGG - Intronic
1118602571 14:67480932-67480954 GAGCAGAAGCAAGAAGAAAGGGG + Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118921533 14:70153713-70153735 GGACAGAAGCAACAGGAGAGCGG - Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119198519 14:72735360-72735382 GAGCAGGAGAAGGAAGAGAGGGG - Intronic
1119715481 14:76856111-76856133 GAGCAGAAGCAGAGAGAATGAGG - Intronic
1119754459 14:77105258-77105280 GGGCAGAAGGAGGGGGAGAGGGG - Intronic
1119773201 14:77234256-77234278 GAGCAGGGGCAGAGGGATAGGGG - Intronic
1119788146 14:77327783-77327805 GAGCAGAAGCAGGGGGGAAGAGG + Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120334059 14:83131026-83131048 GGGAAAGAGCAGAAGGAGAGGGG + Intergenic
1120599718 14:86487097-86487119 GAGGAGAAGGAGGAGAAGAGAGG + Intergenic
1121113967 14:91330909-91330931 GAGGAGAAGCAGAGGGCAAGGGG + Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121697935 14:95928252-95928274 GGGCAGAGGGAGAGGGAGAGAGG - Intergenic
1121697976 14:95928391-95928413 GAACAGAAGGAGAAGGAGATAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122060601 14:99134386-99134408 GTGCAAAGGCAGAAGCAGAGAGG + Intergenic
1122146029 14:99689324-99689346 GAGCAGTGGGAGGAGGAGAGTGG + Intronic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122454131 14:101836358-101836380 GAGTAGAGGCAGAAGGGCAGGGG - Intronic
1122689712 14:103526386-103526408 GAGCAGGTGCACAAGGAGAGGGG + Intergenic
1123038235 14:105479952-105479974 GGGCAGCAGGAGAGGGAGAGCGG - Intronic
1123050982 14:105542095-105542117 GAGCAGAAGAAAAAGATGAGAGG + Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124055524 15:26237984-26238006 TGGCAGAAGCAGGAGGTGAGTGG + Intergenic
1124396993 15:29310640-29310662 GCCCAGGAGCACAAGGAGAGTGG + Intronic
1124550834 15:30680052-30680074 GCCCAGAAGCAGAAGAAAAGTGG + Intronic
1124680416 15:31725616-31725638 GCCCAGAAGCAGAAGAAAAGTGG - Intronic
1125010670 15:34870097-34870119 GTGCAGTAGCAGAAGAAAAGAGG - Intronic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125352328 15:38780941-38780963 AATCAGAAGCTGAAGGAGAAGGG - Intergenic
1125512623 15:40300989-40301011 GAGCTCAGGCAGCAGGAGAGAGG + Intronic
1125522221 15:40354630-40354652 GCGGGGAAGCAGCAGGAGAGAGG - Intronic
1126103660 15:45134455-45134477 GGGTAGAAGCAGGTGGAGAGAGG + Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126174372 15:45721897-45721919 GAGACGAAGTAGAAGGGGAGAGG + Intergenic
1126351982 15:47753351-47753373 GAGAAGGTGCAGAAGGTGAGTGG + Intronic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126453157 15:48832620-48832642 GAGAAGAAGAAGAGGGAAAGGGG - Intronic
1126592187 15:50351635-50351657 GGACAGAGGGAGAAGGAGAGAGG + Intronic
1126866311 15:52941162-52941184 AAGCAGAAGCATAAGGTGAAAGG - Intergenic
1127122100 15:55780570-55780592 AAGCAGAAGAAGAAGAAGAAAGG + Intergenic
1127177854 15:56381013-56381035 AAGAAGAGGCAGAAAGAGAGAGG - Intronic
1127358755 15:58226593-58226615 GGGCAGAGGTAGGAGGAGAGGGG + Intronic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128029611 15:64468302-64468324 AAGCAGAAGGAGGAGGAGAGAGG - Intronic
1128364254 15:66986125-66986147 AACCAGAAGGAGAAGGAGTGTGG - Intergenic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128645419 15:69375233-69375255 GTGCAGAGGCAGCAAGAGAGTGG - Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129078814 15:73021575-73021597 TAGCAGAAGCAGACGGAAATAGG - Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130308868 15:82735377-82735399 GACTAAGAGCAGAAGGAGAGTGG - Intergenic
1130387382 15:83423568-83423590 GAGCAGAAAGAGAGGGAGAGAGG + Intergenic
1130688056 15:86056534-86056556 GGCCAGGAGCAGAAGCAGAGAGG + Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1130896077 15:88171428-88171450 GAGCAGAAGCTAAAGGGGAAAGG - Intronic
1131823340 15:96295179-96295201 GAGAAGAAGAGGAAGGAAAGGGG - Intergenic
1131885022 15:96903175-96903197 GAGGAGCAGTAGAAGGAGATTGG - Intergenic
1132083290 15:98885393-98885415 GAGGAGAAGGAAAGGGAGAGGGG - Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133031308 16:3012542-3012564 GAGCAGAGGCAGCTGGGGAGGGG + Exonic
1133220584 16:4317598-4317620 GGGGAGAAGGAGAAGCAGAGGGG - Intronic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133760815 16:8797165-8797187 GCGGAGAAGGAGAAGGAGCGAGG + Intronic
1134031594 16:10996424-10996446 TAGCAGAAGTAAAAGGTGAGTGG + Intronic
1134425037 16:14133610-14133632 GAGAAAAAGCAGAAGGGAAGAGG - Intronic
1134880987 16:17745401-17745423 GAGCAAACAGAGAAGGAGAGAGG - Intergenic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135117738 16:19737818-19737840 AAGCAGAAGCAGATGCACAGAGG - Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135675153 16:24408779-24408801 GAGCAGGAGAAAGAGGAGAGAGG + Intergenic
1135996828 16:27256396-27256418 GAGGAGAAGCAGAGTGGGAGTGG - Intronic
1136066183 16:27760488-27760510 GAGCAGAGGCAAAAGGATGGCGG + Intronic
1136162783 16:28431628-28431650 GAGGAGGCGGAGAAGGAGAGAGG - Intergenic
1136200183 16:28683360-28683382 GAGGAGGCGGAGAAGGAGAGAGG + Intergenic
1136216531 16:28797553-28797575 GAGGAGGCGGAGAAGGAGAGAGG + Intergenic
1136344581 16:29666578-29666600 GAACAGAGGCAGGGGGAGAGGGG + Exonic
1136405083 16:30040601-30040623 TAGGAGAGGCAGAAGGAGTGAGG + Intronic
1136539128 16:30918976-30918998 GAGGAGAAGGAGAAGAAGAAAGG - Intergenic
1136569096 16:31086299-31086321 GAGAAGGAGCAGAAGGGGAGGGG - Intronic
1136862082 16:33710522-33710544 GCGCCAAAGCAGTAGGAGAGCGG + Intergenic
1137328179 16:47461935-47461957 TAGCAGAAACTGAAGGAGACTGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137506842 16:49061412-49061434 GAGCACAAGAAGCAGCAGAGTGG + Intergenic
1137548013 16:49417344-49417366 GAGTTGAAGCAGGAGAAGAGAGG + Intergenic
1137554585 16:49462514-49462536 GAGCAGAGACAGAGAGAGAGAGG + Intergenic
1137694581 16:50453018-50453040 GAGAAGCAGCAGAAGAAGAAAGG + Intergenic
1137700625 16:50495420-50495442 GAGAAGGAGCAGAAGCTGAGAGG - Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138329668 16:56203573-56203595 GAGAAGAAACACAAAGAGAGAGG + Intronic
1138629974 16:58285745-58285767 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
1139207387 16:65042530-65042552 GAGCAGATGCGCAAAGAGAGAGG + Intronic
1139341742 16:66271912-66271934 AACCAGAGCCAGAAGGAGAGGGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139433716 16:66924802-66924824 AAGCAGAGGCAGCAGGTGAGGGG - Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139546491 16:67652325-67652347 GAGGAGAAGGAGAAGGTAAGTGG + Exonic
1139662129 16:68428446-68428468 GAGCAGGAGCAGCAGCAGAAGGG + Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1140037430 16:71382041-71382063 GAGTAGGAGGAGGAGGAGAGGGG + Intronic
1140318724 16:73926924-73926946 TAGCAGAACGAGGAGGAGAGAGG - Intergenic
1140421331 16:74821745-74821767 GCTCAGAAGGAGTAGGAGAGGGG + Intergenic
1140812210 16:78589229-78589251 GAACAGAGGGAGAAGGATAGAGG + Intronic
1140963234 16:79937821-79937843 GAGGAGGAGGAGAAGGAGAGGGG - Intergenic
1141001047 16:80308202-80308224 GGGCAGCAGAAGAAGGAGAGAGG - Intergenic
1141172511 16:81700336-81700358 GAGGAGCAGCAGCAGGTGAGGGG - Intronic
1141173994 16:81707566-81707588 GAGCAGGAGTAGAAGCAGGGAGG + Intronic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141537903 16:84696003-84696025 AAATAGAAGCAGAAAGAGAGAGG - Intergenic
1141637334 16:85321303-85321325 AAGCTGCAGCACAAGGAGAGAGG + Intergenic
1141842274 16:86580836-86580858 AAGCAGATGCAGAGAGAGAGAGG + Exonic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1141906205 16:87028617-87028639 GAACAGAATCACAAGGAGAGGGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1142704244 17:1684471-1684493 GAGGAGAAGCTGCAGGAGAAAGG - Exonic
1142764173 17:2056461-2056483 GAGAAGGAGCAGGAGGTGAGCGG - Intronic
1142955488 17:3518687-3518709 GAGCAGGAACAGAAAGAGAATGG + Exonic
1143270060 17:5668780-5668802 GAGGAGAAGGAGGAGGACAGAGG - Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143476305 17:7205524-7205546 GAGAAATAGCAGTAGGAGAGGGG - Intronic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1143711284 17:8736926-8736948 AAGCAGAAGAAGAAAGAAAGAGG + Intronic
1143762428 17:9115126-9115148 GAGCTGAGGCAGAAGGAGAGGGG - Intronic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144041370 17:11414037-11414059 GAACTGGAGGAGAAGGAGAGAGG - Intronic
1144235668 17:13258079-13258101 GGGAAGAAGGAGAAGGAGAAGGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144626630 17:16847282-16847304 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1144777231 17:17791070-17791092 GAGCTGGAGCAGAGGGAAAGCGG + Intronic
1144859576 17:18292416-18292438 CAGCAGGAGCTGATGGAGAGTGG + Intronic
1144879802 17:18425429-18425451 GTTCAAGAGCAGAAGGAGAGGGG + Intergenic
1145063970 17:19749564-19749586 GAGCAGAAGCAAAGGCACAGAGG + Intergenic
1145152432 17:20518955-20518977 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1145747654 17:27332308-27332330 GGGCAGAGTCAGAAGCAGAGAGG + Intergenic
1145898318 17:28473774-28473796 GGGCAGAGGCAGCAGGAGAATGG - Exonic
1145922568 17:28621434-28621456 GTGCAGGAGCTGATGGAGAGTGG - Exonic
1146163775 17:30573160-30573182 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1146174011 17:30653363-30653385 GAGGAGAGGCAGAAGGAAATAGG - Intergenic
1146347466 17:32069390-32069412 GAGGAGAGGCAGAAGGAAATAGG - Intergenic
1146528217 17:33584949-33584971 GAGAAGGAGCAGACAGAGAGAGG + Intronic
1146547132 17:33749268-33749290 GAGCAGCTGGAGAAGGAGAGGGG - Intronic
1146935523 17:36810390-36810412 AAGAAGAAGAAGAAGAAGAGGGG + Intergenic
1147158693 17:38558623-38558645 GAACAGAGGCAGGAGGAGAACGG + Intronic
1147426409 17:40347832-40347854 GAGCGGAAGCAGAGGGGGCGGGG + Intronic
1147508134 17:41040880-41040902 GAGCAGTAGCAGCAGCAGACTGG + Exonic
1147543666 17:41381891-41381913 GAGCTCCAGCAGAAGGTGAGGGG - Exonic
1147545346 17:41397184-41397206 GAGCTCCAGCAGAAGGTGAGCGG - Exonic
1147580771 17:41625972-41625994 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1148212877 17:45818806-45818828 GATCAGATGCAGCAGGAGGGAGG - Intronic
1148271089 17:46262356-46262378 AAGAAGAAGAAGAAGAAGAGGGG - Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1149037705 17:52154618-52154640 GATCAGAGACAGAAAGAGAGAGG - Intronic
1149039321 17:52169220-52169242 GAGCAGAAAGAGAAGGGGAAGGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149492185 17:57092952-57092974 GGGGGGAAGCAGGAGGAGAGCGG - Intronic
1149785799 17:59433901-59433923 AAGAAGAAGAAGGAGGAGAGGGG - Intergenic
1150250925 17:63704135-63704157 GAGCTGAGGGAGAGGGAGAGGGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150947629 17:69765445-69765467 GAGGAGGAGGAGGAGGAGAGGGG - Intergenic
1150964176 17:69948489-69948511 GAGGAGAAGGAGGAGGAGAGGGG + Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151166066 17:72205000-72205022 GAGCAATAGCAGAAGGGGATTGG - Intergenic
1151267563 17:72968510-72968532 GGGCAGAAGCAGAGGGACAGTGG - Intronic
1151417944 17:73978945-73978967 TGGCAGAAGCAGAAAGACAGAGG - Intergenic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151484180 17:74388175-74388197 GGGCAGGAGCAGAAGGAGAGAGG + Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151824988 17:76519197-76519219 GATCAGAAGGAGAAGGTCAGTGG - Intergenic
1151871663 17:76840925-76840947 GGGGAGAAACAGAGGGAGAGAGG - Intergenic
1152058682 17:78052237-78052259 GAGCAGCAGCACGAGTAGAGAGG + Intronic
1152289021 17:79428355-79428377 GGGCAGACGCAGGTGGAGAGTGG - Intronic
1152362964 17:79840825-79840847 GAGCAAAAGCAGAGCGAGAGTGG + Intergenic
1152565126 17:81096954-81096976 GAGGAGGAGAAGAAGGAGAAAGG + Intronic
1153328628 18:3848836-3848858 GAGTGGAAGGAGAAGGACAGTGG - Intronic
1153575550 18:6516614-6516636 GAGGAGGAGGAGAAGAAGAGTGG + Intronic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1155252351 18:23964628-23964650 GAGCACAAGCAGAGGCACAGAGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1156260959 18:35444694-35444716 GAGAAGAAGTGGAAGGAGAAGGG + Intronic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156706444 18:39888782-39888804 AAGGAGAAGGGGAAGGAGAGGGG - Intergenic
1156849035 18:41704338-41704360 GAGCAAAAGCAGCAGGAAACTGG + Intergenic
1157031336 18:43912118-43912140 GGGAAGAAGCAGAAGAAGAAAGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157600323 18:48889518-48889540 GACCAGAGGCAGTGGGAGAGGGG + Intergenic
1157616986 18:48992785-48992807 GAGCAGGAGCAGACTGAGTGTGG - Intergenic
1157894004 18:51447179-51447201 GAGCAAAAGGAGAAGGAAAGAGG + Intergenic
1158305731 18:56103367-56103389 GGGGAGGAGGAGAAGGAGAGAGG + Intergenic
1158310120 18:56149095-56149117 GAAGAGAAGCAGGAGGAAAGGGG + Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159263226 18:66043678-66043700 GGGGAAAAGCAGAAGTAGAGTGG - Intergenic
1159291380 18:66426183-66426205 GAGCAGAGGAAGGAGAAGAGAGG - Intergenic
1159310258 18:66698457-66698479 GAGGAGAAGGAGGAGGAGAAAGG + Intergenic
1159310289 18:66698551-66698573 AAGCAGAAGGAGGAGGAGAAAGG + Intergenic
1159508269 18:69363044-69363066 TAGCAGAAACTGAAGGAAAGGGG + Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160227087 18:77019848-77019870 TGGCGGAAGCAGCAGGAGAGCGG + Intronic
1160232292 18:77057558-77057580 GTGAAGAAGGACAAGGAGAGAGG + Intronic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160510639 18:79451656-79451678 GGGCTGCATCAGAAGGAGAGGGG - Exonic
1160679641 19:406848-406870 GAGGAGGAGGAGGAGGAGAGGGG - Exonic
1160705048 19:525767-525789 GAGAAGGAAGAGAAGGAGAGAGG + Intergenic
1160827043 19:1085424-1085446 GGGGAGAAACGGAAGGAGAGAGG - Intronic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1161224445 19:3136550-3136572 GAGCAGAAGAAGCAGGACCGCGG + Exonic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161388422 19:4008836-4008858 GAGAATAGGCAGAAAGAGAGGGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161732872 19:5972794-5972816 GAGCAGAAGCAGCAGGAATGGGG - Intronic
1161969073 19:7566252-7566274 GAGGAGAGGGAGAGGGAGAGGGG - Intergenic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162425802 19:10594690-10594712 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1162596005 19:11629780-11629802 GAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1162621513 19:11847914-11847936 GAGCAGCTCCAGAAGGAGTGTGG + Intergenic
1162625298 19:11880184-11880206 GAGCAGCTCCAGAAGGAGTGCGG + Intronic
1162635446 19:11964193-11964215 GAGCAGCTCCAGAAGGAGTGTGG + Intronic
1162657389 19:12141179-12141201 GAGCAGATCCAGAAAGAGTGTGG - Intronic
1162818125 19:13208185-13208207 GAGGAGGAGGAGGAGGAGAGGGG + Intronic
1163213932 19:15862492-15862514 GAGGGGAAGAAGAAGGGGAGGGG + Intergenic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1163611572 19:18304512-18304534 GAGGAGGAGGAGGAGGAGAGAGG + Intergenic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1164031806 19:21413918-21413940 CAGCAGTTGCAGAAGGAGACGGG - Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164482416 19:28622701-28622723 GAGCAAAAACAGAAAGAGAAGGG + Intergenic
1164567632 19:29339323-29339345 GAGAAGAAACAGGGGGAGAGAGG - Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1164672775 19:30082387-30082409 GGTCAGAGGCAGAAGGAGAGAGG + Intergenic
1164820130 19:31243608-31243630 TAGCAGAAGCAGAGGGGGTGGGG + Intergenic
1164897932 19:31893585-31893607 GAGCAGAAGAGGAAGAAGAAGGG + Intergenic
1164955174 19:32376894-32376916 CAGCAGAGGCAGAGAGAGAGAGG + Intronic
1164999593 19:32750237-32750259 GATCACAAGCAGAAAGAAAGCGG + Intronic
1165250020 19:34523551-34523573 GCCCAGAAGAAGCAGGAGAGAGG - Intergenic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166193207 19:41189596-41189618 GAGGAGGGGGAGAAGGAGAGAGG + Intergenic
1166635236 19:44445449-44445471 GAGCAGAATGAGAAAGAGGGAGG - Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167235819 19:48314245-48314267 CGGCAGAAGCAGAGAGAGAGAGG + Intronic
1167295308 19:48646073-48646095 GAGGAGGTGAAGAAGGAGAGAGG - Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167604855 19:50476233-50476255 GAGCAGAGGGAGAAAGCGAGGGG + Exonic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168137436 19:54360766-54360788 GTGCAGAGGAAGAAGGGGAGGGG + Intronic
1168143176 19:54403199-54403221 GATCAGAGGCAGAGGGAGTGAGG - Intergenic
1168160641 19:54508316-54508338 GTGCAGAGGAAGAAGGGGAGGGG - Intronic
1168414703 19:56160638-56160660 AAGCAGAGGCTGAAGGAAAGGGG + Exonic
1168433839 19:56302447-56302469 GGGAGGAAGCAGACGGAGAGAGG - Intronic
924959993 2:26265-26287 AGGCAGAGGCAGAAGGAGAGAGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925274765 2:2640992-2641014 AAGCAGAGGCAGAAGGGGTGTGG + Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925767573 2:7251434-7251456 GAGAAGAAGCAGAATAAAAGGGG + Intergenic
925800304 2:7592350-7592372 TAGCAGGAGATGAAGGAGAGGGG - Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927195028 2:20541033-20541055 GAGCAGCTGCAGAGGGGGAGCGG + Intergenic
927294701 2:21440674-21440696 GAGCTGAGGGATAAGGAGAGAGG - Intergenic
927638896 2:24834554-24834576 GTGGAGAAGGAGAAGCAGAGTGG - Exonic
927845573 2:26470684-26470706 GAGAAGAAGAAGAAGAAGAAGGG - Exonic
927866198 2:26589228-26589250 AAGGAGAAGTAGAAGAAGAGGGG - Intronic
927981551 2:27377976-27377998 GAGCAGAGGCATAAGGACAGCGG + Exonic
928268281 2:29831105-29831127 GAGGAGAAGAAGAAGAAGAAGGG + Intronic
928320566 2:30279978-30280000 GAGGAGAAGAAGAAGAAGAATGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928536287 2:32244831-32244853 GAGGAGGAGGAGAGGGAGAGAGG + Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
928872303 2:35994742-35994764 GAGCAGAAGGGTAAAGAGAGGGG - Intergenic
929024365 2:37585520-37585542 GAGCAGAGGCAGGTGGAGAGGGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929777587 2:44938593-44938615 GAGCAGAAGCAGAGGGACCTTGG - Intergenic
929899232 2:45986896-45986918 GAGCAGAAGAGGAAGAAGGGAGG + Intronic
929990544 2:46782527-46782549 GAGCCAAAGCAGAAGGATTGTGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930656547 2:54012931-54012953 GAGCAGAGGGAGAGGGAGAGTGG - Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
931483841 2:62670681-62670703 GATGAGAAGCAAAAGTAGAGTGG + Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931836613 2:66105595-66105617 GAGCCCCAGCAGAATGAGAGAGG - Intergenic
931945037 2:67297024-67297046 GAGATGAAGCAGAGGTAGAGTGG + Intergenic
932278557 2:70470160-70470182 GAGAAGGAACAGAAGAAGAGGGG + Intronic
932414684 2:71566524-71566546 GAGCACCAGCAGAGAGAGAGAGG + Intronic
932570312 2:72935040-72935062 GAGGTGAAGAAGAAAGAGAGGGG - Intronic
932621275 2:73265980-73266002 GAGCAGGAGGTAAAGGAGAGGGG + Intronic
932695336 2:73951633-73951655 GAGCAGAACCAGAGGATGAGTGG + Intronic
932738934 2:74276968-74276990 GACCAGAAGCAGAGAGAAAGAGG + Intronic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
932887720 2:75561904-75561926 GAGGAGAGGATGAAGGAGAGAGG + Intronic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933520711 2:83368451-83368473 AAGAAGAAGAAGAAGGATAGAGG + Intergenic
933580861 2:84125568-84125590 AAGAAGAAGAAGAAGGAAAGTGG + Intergenic
934546280 2:95219347-95219369 CAGCAGAATCAAAAGGACAGAGG - Intronic
934708669 2:96501790-96501812 GAGCAGGACCAGGAGGGGAGGGG - Intronic
934972206 2:98772897-98772919 GAGCAGGAGCATATGGACAGAGG - Intergenic
935122398 2:100194224-100194246 GAGCTGAAGCAGAAGTATGGAGG + Intergenic
935227582 2:101067040-101067062 CACCAGAAACAGCAGGAGAGAGG - Intronic
935234171 2:101124186-101124208 CACCAGAAACAGCAGGAGAGAGG + Intronic
935593031 2:104857860-104857882 GGGAAGGAGCAGAGGGAGAGGGG + Exonic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936919801 2:117676263-117676285 GAGCAGAAGCAAGAGCAGTGGGG + Intergenic
937020206 2:118643546-118643568 GAGCAGAAGCAGAAGCTGTCAGG + Intergenic
937025903 2:118696934-118696956 AAGCAGAGGCTCAAGGAGAGCGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937379921 2:121367374-121367396 GAACAGAAGCACAAGTAGCGGGG - Intronic
937388298 2:121457401-121457423 TGGCAGAAGGAGAAGGGGAGAGG - Intronic
937445266 2:121952251-121952273 GAGCAGGAGCAGAAGGTGACCGG + Intergenic
937478205 2:122233894-122233916 GAGCTATAGCAGAAGGAGACTGG - Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
937686812 2:124706847-124706869 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
937686814 2:124706853-124706875 GAGGAGAAGGAGAAGGGGAAAGG + Intronic
937761625 2:125611213-125611235 GAACAAAAGCAGAAAGAGAAAGG + Intergenic
937814086 2:126231751-126231773 GAGCAGAAACTAAAGAAGAGGGG - Intergenic
938070416 2:128305469-128305491 GAACAGAGGCAGAAGAGGAGGGG + Intronic
938136670 2:128764725-128764747 TACCAAAAGCAGAAGGAGATGGG - Intergenic
938987311 2:136590382-136590404 GAGAAGCAGCAGAGAGAGAGAGG + Intergenic
939148458 2:138444695-138444717 GCTCCCAAGCAGAAGGAGAGAGG - Intergenic
939389149 2:141544293-141544315 AAGAAGAAGAAGAAGAAGAGTGG - Intronic
939554479 2:143657885-143657907 GAACAGAATCAGAAGGACTGAGG - Intronic
939754081 2:146087488-146087510 GGACAGAAGGAGAAGGAGAAGGG + Intergenic
940012962 2:149073839-149073861 AAGCAGAAGCTCAATGAGAGAGG + Intronic
940164040 2:150748324-150748346 GAGGGGAGGGAGAAGGAGAGAGG - Intergenic
940199567 2:151135392-151135414 GAGCGGGAGCAGAGGGAAAGTGG - Intergenic
940363980 2:152825629-152825651 TGGCGGAAGCAGGAGGAGAGAGG + Intergenic
940642834 2:156365090-156365112 GTGCAGAGGAGGAAGGAGAGAGG + Intergenic
940642839 2:156365111-156365133 GGGCAGAGGAGGAAGGAGAGAGG + Intergenic
941038203 2:160590533-160590555 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
941751322 2:169137841-169137863 GAAAAGAAGAATAAGGAGAGAGG + Intronic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
942178100 2:173354619-173354641 GCGCAGCTGCACAAGGAGAGTGG + Intergenic
942199821 2:173559758-173559780 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942791356 2:179765114-179765136 AAGCAGAACCAGTAGGAGAAAGG - Intronic
942909606 2:181227180-181227202 GAGAAGAATCAGAACGAGAAGGG + Intergenic
943292642 2:186093947-186093969 GAGAAGAAGCACGAGCAGAGGGG + Intergenic
943463039 2:188193448-188193470 ATGCAGAAGCAGGAGGATAGAGG - Intergenic
943557166 2:189419907-189419929 GAGGAGGAGAAGAAGGAGAGGGG + Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944500006 2:200349730-200349752 GACCAGAAGGAGAAGGTTAGAGG - Intronic
944635152 2:201668875-201668897 GAGAAGAAGGTGAGGGAGAGAGG - Intronic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
944958055 2:204835466-204835488 GAAGAGAGGCATAAGGAGAGGGG - Intronic
945155162 2:206830426-206830448 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
945155165 2:206830429-206830451 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
945198278 2:207257417-207257439 GAGCAGAAGGAAAAGGAAATAGG - Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946191083 2:218008337-218008359 GCCCAGAAGGAAAAGGAGAGTGG + Intergenic
946329091 2:218999846-218999868 GAGCATAGGCTGAAGGAAAGAGG - Intergenic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946859461 2:223986853-223986875 GGTCAGAAGCAGAAGGAGTGGGG - Intronic
946993640 2:225365159-225365181 GAGGAGAAGCAGCAGGGGTGAGG - Intergenic
947102312 2:226634204-226634226 GTGCAGAAAGAGAAGAAGAGAGG - Intergenic
947295897 2:228629693-228629715 GAGCTGGAGCTGAAGGAGAATGG + Intergenic
947827067 2:233113746-233113768 GAGATGCAGCAGCAGGAGAGAGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948017954 2:234705477-234705499 GAGCAGGAGGAAGAGGAGAGGGG - Intergenic
948247215 2:236496622-236496644 GAAGAGAAGCAGAGGGAAAGAGG + Intronic
948264941 2:236629263-236629285 GGTCAGAAACAGAGGGAGAGGGG - Intergenic
948273240 2:236689547-236689569 AAGAAGAAGAAGAGGGAGAGAGG - Intergenic
948486386 2:238283905-238283927 GATCAGAGGCAGCAGCAGAGTGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
948886191 2:240886189-240886211 GAGCAAAAGGAGAGGGGGAGGGG + Intronic
1168979780 20:1994533-1994555 GGGTAGAAACACAAGGAGAGAGG + Intergenic
1169348251 20:4846965-4846987 GAGGATGGGCAGAAGGAGAGGGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170390833 20:15872214-15872236 GATAAGAAGAAGAAGGAAAGAGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170842732 20:19937253-19937275 GAGCAGCAGCCAAAGGGGAGAGG + Intronic
1170940686 20:20845660-20845682 GAACAGAAGCAGAAAGGGAGAGG + Intergenic
1171400784 20:24871979-24872001 GCGCAGAAGGAGAAGAAGGGAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171533059 20:25864696-25864718 GAGCAGAAGGAGCAAGAGGGAGG + Intronic
1171539693 20:25938104-25938126 GAGGAAAAGAAGAAAGAGAGTGG - Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172237542 20:33388581-33388603 GGGGAGAGGGAGAAGGAGAGAGG - Intronic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1172694637 20:36813926-36813948 GATCAGAGGCGGAAGGAGCGTGG - Intronic
1172773333 20:37393870-37393892 GAGCAGGGACAGAAGGAGGGAGG - Intronic
1172950763 20:38722295-38722317 CACCAGAAACAGAAGGGGAGAGG + Intergenic
1172957307 20:38770111-38770133 GGGCAGAAACAGGAGGGGAGGGG - Intronic
1173113549 20:40218564-40218586 GAACAGAAGCAGAGAGGGAGGGG - Intergenic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173302713 20:41818092-41818114 GGGCAGAAGCAGAAGGATCTCGG - Intergenic
1173371777 20:42442935-42442957 GAGCTGAGTCAGAATGAGAGAGG + Intronic
1173678246 20:44856968-44856990 GAGGAGAAGAAGAAGGGGAGGGG + Intergenic
1173750517 20:45471623-45471645 GAGGAGGACCAGAAGGAGAGAGG + Intronic
1173859073 20:46270248-46270270 GAACAGATGGGGAAGGAGAGAGG + Intronic
1173859714 20:46275209-46275231 GAGCAGAGGAACAGGGAGAGGGG - Intronic
1173863289 20:46297922-46297944 GAGCAGAGGACGAAGGTGAGGGG - Intronic
1174054308 20:47787395-47787417 GAGATGAGGCGGAAGGAGAGGGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175179285 20:57133973-57133995 GAGCAGCATCAGAGGTAGAGTGG - Intergenic
1175298837 20:57928590-57928612 GAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1175819535 20:61901204-61901226 GAGCAGGAGCAGGAGGAGTAGGG + Intronic
1175921265 20:62451540-62451562 GAGAAGAGAGAGAAGGAGAGAGG + Intergenic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1176143814 20:63556752-63556774 GAGCAGGAGCAGAAGGCCTGGGG - Intergenic
1176261660 20:64185076-64185098 AAGCAGGAGGAGATGGAGAGGGG + Intronic
1176267970 20:64220685-64220707 GAGGGGAAGGAGAGGGAGAGGGG - Intronic
1176387602 21:6146572-6146594 AAACAGAAGCAGTAGGAGACGGG + Intergenic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177249368 21:18572253-18572275 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1177323673 21:19555818-19555840 GAGCTGAAGGGGAAAGAGAGAGG + Intergenic
1177809244 21:25907134-25907156 TAGAAGAAGAAGAAGAAGAGCGG - Intronic
1178701217 21:34835191-34835213 GAGGAGAGGGAGAGGGAGAGGGG - Intronic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1179126504 21:38595593-38595615 GAGCAGAAGCAGGGCGGGAGCGG + Intronic
1179423393 21:41253718-41253740 GCTCAGGAGCAGAATGAGAGGGG + Intronic
1179711089 21:43263566-43263588 GAGATGTAGCAGAAGGTGAGCGG + Intergenic
1179735870 21:43391676-43391698 AAACAGAAGCAGTAGGAGACGGG - Intergenic
1179789572 21:43748703-43748725 GAGAAGGAGGTGAAGGAGAGAGG - Intronic
1180229804 21:46420452-46420474 GAGCTAAAGCTAAAGGAGAGAGG - Intronic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1180798377 22:18619238-18619260 GAGCTGAAGGAGAGGGAGTGAGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1181223341 22:21376027-21376049 GAGCTGAAGGAGAGGGAGTGAGG - Intergenic
1181255399 22:21559599-21559621 GAGCTGAAGGAGAGGGAGTGAGG + Intronic
1181425279 22:22833235-22833257 GAGCTGAAGAAGAAAGAGACAGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182028163 22:27136608-27136630 GAGCAGAAGGCAGAGGAGAGAGG - Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182069678 22:27454834-27454856 GTTCAGAGGCAGAAGGAGTGTGG - Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182222188 22:28767472-28767494 TGGCAGAAAGAGAAGGAGAGAGG - Intergenic
1182277696 22:29200966-29200988 AAGCAGGAGGAGAATGAGAGTGG - Intergenic
1182355572 22:29720987-29721009 GGGCAGCAGCAGAAGGGGAGAGG + Intronic
1182414154 22:30210312-30210334 GAGGAGGAGGAGGAGGAGAGAGG + Intergenic
1182420504 22:30246401-30246423 GAGGAGGAGGAGAAGGAGAGGGG + Intronic
1182440114 22:30358080-30358102 GAGGAGAGGAGGAAGGAGAGAGG - Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182897940 22:33874044-33874066 GAGCAGAGGCAGGAGAATAGAGG - Intronic
1183259594 22:36785914-36785936 GAAGAGAAGCAGGAGAAGAGGGG - Intergenic
1183462127 22:37957903-37957925 GGGCAGTGGCAGAAGCAGAGAGG - Intronic
1183616188 22:38947155-38947177 GGATAGAAGCGGAAGGAGAGTGG - Intergenic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1184092694 22:42300772-42300794 GAGCAGAGGCAAAGGCAGAGAGG - Intronic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184309837 22:43634008-43634030 GAGGAGAAGCAGGAAGTGAGGGG + Intronic
1184339840 22:43880231-43880253 AAGCAGGAGGAGGAGGAGAGGGG - Exonic
1184542052 22:45132623-45132645 GGGAAGAAGGAGAAGCAGAGAGG + Intergenic
1184600212 22:45539056-45539078 GAGGAGGAGGAGAAGGAGAAAGG - Intronic
1184730266 22:46367819-46367841 GAGCAGCAGCAGGAGGAATGCGG + Exonic
1184929022 22:47666752-47666774 GAGCAGAAGAAGAAGAAAAAAGG - Intergenic
1185198447 22:49487504-49487526 GAACAAAAACAGAAGCAGAGTGG - Intronic
1185201267 22:49507009-49507031 GAGAAGAAGAGGAAGGAGAAGGG + Intronic
1185418834 22:50723893-50723915 GAGCGGAGGGAGAAGCAGAGAGG - Intergenic
949348129 3:3096293-3096315 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
949349483 3:3110998-3111020 GAGCAGATGCAGAAAGATGGTGG + Intronic
949607963 3:5675268-5675290 GAGCAGGAGCCGAGAGAGAGAGG + Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949870470 3:8583706-8583728 GTCCAGAAGCAGAGGGAGTGAGG - Intergenic
949895330 3:8764110-8764132 GAGCAAATGCTGAAGCAGAGAGG + Intronic
950384110 3:12643009-12643031 GAACAGAAGCAGGAGGACATTGG + Intronic
950627744 3:14260529-14260551 GAGCAGGAGCAGAGAGAGAAGGG + Intergenic
950678703 3:14570071-14570093 GAGCCCAAGCAAAGGGAGAGGGG + Intergenic
950922387 3:16707697-16707719 AACCTAAAGCAGAAGGAGAGTGG + Intergenic
950962399 3:17119803-17119825 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
951088474 3:18542881-18542903 GAGAAGAATCACAGGGAGAGTGG + Intergenic
951277790 3:20710886-20710908 GGGCTGGAGCTGAAGGAGAGAGG + Intergenic
951462076 3:22962467-22962489 GAGCAGACAGAGAGGGAGAGAGG - Intergenic
951939002 3:28056837-28056859 GAGCACTAGCAGAGAGAGAGAGG - Intergenic
952027677 3:29102907-29102929 GGGAGGCAGCAGAAGGAGAGAGG - Intergenic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
953132555 3:40154252-40154274 GAGCTGCAGGAGAAGGAGAAAGG - Intronic
953201927 3:40785611-40785633 GAGGAGGAGAAGAAGGAGAGGGG - Intergenic
953363936 3:42325633-42325655 TTGTAGAAGCAAAAGGAGAGAGG - Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953521973 3:43651903-43651925 GAGTAGAACCAGAAGAAGATGGG - Intronic
953910715 3:46891578-46891600 TGGCAGAAGAAGAAGGATAGTGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954121845 3:48504232-48504254 GAGCAGGAGGAGGAGGAGGGAGG + Exonic
954199443 3:49015421-49015443 GTGCAGGAGCTGAAGGTGAGTGG + Exonic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954994963 3:54872723-54872745 GAGCAGATGAAGAAGAAAAGAGG - Intronic
955016027 3:55070196-55070218 AAGAAGAGGCAGAAGGAAAGTGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955281293 3:57597162-57597184 GGGCAGAAGCAGAAGGGGTTTGG + Exonic
955375063 3:58387792-58387814 GAGGAGAGAAAGAAGGAGAGAGG + Intronic
955393476 3:58537653-58537675 GAGCAGAAACATGGGGAGAGAGG - Intergenic
955416432 3:58696323-58696345 GAGCTGAAGCAGAACTAGACAGG + Intergenic
955445093 3:59001401-59001423 GAGGAGAGAGAGAAGGAGAGAGG - Intronic
955510705 3:59677837-59677859 GAGCAGAGGCAGGAAGAGAAAGG - Intergenic
955595724 3:60588432-60588454 GAGGGGAAGGAGAAAGAGAGGGG + Intronic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955647385 3:61154590-61154612 GTTCAGAAGTAGCAGGAGAGGGG - Intronic
955699989 3:61672760-61672782 GAGAAGAGGGAGAGGGAGAGAGG + Intronic
955766717 3:62351947-62351969 CATCAGTTGCAGAAGGAGAGTGG - Intergenic
956077268 3:65518884-65518906 GAGAAAAAGCAGAATAAGAGTGG + Intronic
956953035 3:74304296-74304318 TAGGAGAAGGAGAGGGAGAGAGG - Intronic
957753451 3:84455124-84455146 GGTCAGAAGAAAAAGGAGAGAGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957936455 3:86950049-86950071 GAGCAGAACCTGTAGCAGAGTGG - Intronic
958081073 3:88747058-88747080 GAGCACAAGCTGAAGCAGGGTGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958462245 3:94413195-94413217 GAGCTGAGGCAGCAGCAGAGGGG + Intergenic
958720349 3:97836218-97836240 GAGAAAAATCAGGAGGAGAGAGG - Intronic
959199535 3:103228287-103228309 GATCAGAAACAAAAGTAGAGAGG - Intergenic
959525200 3:107368689-107368711 GAGCAAAGAAAGAAGGAGAGGGG + Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960409979 3:117311056-117311078 AAGCAGATGCAGAAACAGAGAGG - Intergenic
960418334 3:117412670-117412692 GAGAAGAGGAAGAAGGAGAAGGG - Intergenic
960605078 3:119496853-119496875 GAGCAGTAGCCAAAGGAGAGGGG + Intergenic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960825625 3:121780555-121780577 TAGCAGAAGCAGAAAGTAAGAGG + Intronic
961018517 3:123485237-123485259 GACCAGAAGTGGAAGGTGAGAGG + Intergenic
961814093 3:129539537-129539559 GAGCAGAAGACGAAGCAAAGAGG - Intergenic
961837417 3:129674562-129674584 GAGGAGAGGAAGAAGAAGAGTGG + Intronic
961917018 3:130386906-130386928 GAGCAGATGCAGATGGAGTGAGG + Intronic
962007012 3:131359874-131359896 GAGGTGAGGCAGAAGCAGAGAGG + Intergenic
962047050 3:131771520-131771542 GAGAAGAAGCAAGAGGGGAGAGG - Intronic
962264423 3:133935131-133935153 AAGCAGAGCCAGAAGGAGAGAGG + Intronic
962491412 3:135897239-135897261 GAGAAGCAGGAGGAGGAGAGGGG - Intergenic
962500877 3:135990931-135990953 GAGCCAAAGCTGAAGGAGTGGGG - Intronic
962730867 3:138282263-138282285 GAGCAGAACTAGAAGGAATGTGG + Intronic
962865990 3:139448389-139448411 CAGCAGTGGCAGAGGGAGAGGGG - Intergenic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963037904 3:141048380-141048402 GAGCAAAGGCAGGAGGAGTGAGG + Intergenic
963115586 3:141726439-141726461 AAGAAGAAGAAGAAGAAGAGAGG + Intergenic
963481515 3:145879976-145879998 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
963584537 3:147168390-147168412 AAGGAGAAGGAGAAGAAGAGAGG + Intergenic
963616786 3:147549626-147549648 GAGCAGAGGCAGAGAGAAAGCGG - Intergenic
963748454 3:149149513-149149535 AAGCACCAGCAGATGGAGAGAGG + Intronic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
964383800 3:156126069-156126091 GAGCAGGAGGAGATGGGGAGGGG + Intronic
964877745 3:161387904-161387926 GAGTAGAAGGAGGAGCAGAGTGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
965349261 3:167593921-167593943 CAGGAGAGGCAGAACGAGAGAGG - Intronic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966756454 3:183376016-183376038 GAGCAAAAGCGGAAGAAGAAAGG + Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966923164 3:184627667-184627689 GCCCAGGGGCAGAAGGAGAGAGG + Intronic
966956494 3:184885816-184885838 GAGCAGAAGAAGGAGGGGAAGGG - Intronic
967014620 3:185470505-185470527 GAGTAGAAGCAGGAAGAGACGGG - Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967114771 3:186327334-186327356 GAGGAGAAGGAGGAGGAAAGGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967583244 3:191185261-191185283 GAGCAGGAGGAAAAAGAGAGAGG + Intergenic
967648183 3:191952405-191952427 GGGCCGCAGCAGAAGGAGAAAGG + Intergenic
968055603 3:195689583-195689605 GAGCAGCAGCTGAAGGGAAGTGG + Intergenic
968100187 3:195959015-195959037 GAGCAGCAGCTGAAGGGAAGTGG - Intergenic
968123822 3:196144146-196144168 GAGCAGAGGGAGAGGGAAAGAGG - Intergenic
968889166 4:3358890-3358912 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969560773 4:7946403-7946425 GAGCAGAAGGATGAGGGGAGAGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970520205 4:16875877-16875899 GAGTGGAAGGAGAAGGATAGAGG - Intronic
970645295 4:18113826-18113848 GAGGAGAAGAAGAAGGGGAAGGG + Intergenic
971084470 4:23255782-23255804 GATCACAAGGAGAAGAAGAGTGG - Intergenic
972909881 4:43801272-43801294 GAGCAGGAGGAAGAGGAGAGAGG + Intergenic
973638930 4:52884768-52884790 CAGCAGGAGCCCAAGGAGAGAGG - Intronic
973650838 4:52995727-52995749 TGGCAGAAGGAAAAGGAGAGGGG + Intronic
973833774 4:54789102-54789124 GAGAAGGAGGGGAAGGAGAGAGG - Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
973963041 4:56130884-56130906 AAGCAGAGGAAAAAGGAGAGAGG - Intergenic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
974406606 4:61480174-61480196 GAGAAGGAGGAGATGGAGAGAGG - Intronic
974638209 4:64592666-64592688 GGGTAGAAGCAGAAGAGGAGAGG + Intergenic
975346759 4:73300590-73300612 GAGGAGAAGAGGAAGGAGAGAGG + Intergenic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976777179 4:88719570-88719592 GAGGAGGAGAAGAAGGAGAAAGG - Intergenic
976881978 4:89937489-89937511 CAACAGAAACAGAGGGAGAGTGG + Intronic
977760641 4:100732573-100732595 GAGGAAAAGCGGAAGGATAGAGG + Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
978978784 4:114915824-114915846 GAGGAGAAGGAGAGGGGGAGAGG + Intronic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979349353 4:119627630-119627652 GAGCAGAGGGACAAGAAGAGTGG - Intronic
980387443 4:132104586-132104608 GAGCAGGAGCAGGAGCACAGTGG - Intergenic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980666299 4:135941160-135941182 AAACAGTAGCAAAAGGAGAGAGG - Intergenic
980733316 4:136849253-136849275 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
980933720 4:139206441-139206463 AAACTGAAGCAGAAGGATAGAGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981082566 4:140649718-140649740 GGGCAGAAGAAGAGGGTGAGGGG + Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
982093304 4:151898511-151898533 GAGCAGGAGCAAGAGGAGAGGGG + Intergenic
982358092 4:154491057-154491079 GCGCAGCAGCAGGAGGGGAGCGG - Intronic
982364369 4:154559185-154559207 GAGGAGAAGAAGAAGGGGAAGGG - Intergenic
982568767 4:157021879-157021901 GAGCAGTAGCAAAAGAGGAGGGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983357851 4:166687167-166687189 GGACAGAAACAGAAAGAGAGAGG - Intergenic
983696778 4:170542023-170542045 GTGGAGAATGAGAAGGAGAGTGG + Intergenic
983970041 4:173860191-173860213 GCCCAGAAGCAAAAGTAGAGAGG - Intergenic
984111707 4:175625064-175625086 GAGCAGCAGAAGAAGGGCAGTGG - Intergenic
984354113 4:178636826-178636848 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
984703428 4:182833000-182833022 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703445 4:182833049-182833071 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703481 4:182833149-182833171 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703487 4:182833168-182833190 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703503 4:182833221-182833243 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703521 4:182833272-182833294 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703559 4:182833370-182833392 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703565 4:182833389-182833411 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703576 4:182833424-182833446 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703625 4:182833550-182833572 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703631 4:182833569-182833591 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703637 4:182833588-182833610 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703648 4:182833623-182833645 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703697 4:182833749-182833771 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703703 4:182833768-182833790 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703709 4:182833787-182833809 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703722 4:182833826-182833848 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703728 4:182833845-182833867 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703740 4:182833883-182833905 GAGGAGAAGGAGGAGGGGAGGGG - Intergenic
984703753 4:182833918-182833940 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703772 4:182833972-182833994 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703778 4:182833991-182834013 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703798 4:182834042-182834064 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703835 4:182834139-182834161 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703841 4:182834158-182834180 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703847 4:182834177-182834199 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703853 4:182834196-182834218 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703864 4:182834231-182834253 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703913 4:182834357-182834379 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703919 4:182834376-182834398 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703925 4:182834395-182834417 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703931 4:182834414-182834436 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703937 4:182834433-182834455 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703950 4:182834472-182834494 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703956 4:182834491-182834513 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703962 4:182834510-182834532 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703968 4:182834529-182834551 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703974 4:182834548-182834570 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984710546 4:182880612-182880634 GAGGAGAGGCAGGAGGAAAGAGG + Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984822955 4:183899206-183899228 GAGCAGAGGGAGAGAGAGAGGGG - Intronic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985503515 5:264360-264382 GAGCAGCAGCTGAAGGGAAGCGG + Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985717920 5:1473045-1473067 GAGCAGGAGGAGCAGGAGAGAGG - Intronic
985783964 5:1884786-1884808 GAGCAGGAGGAGAGGGAAAGGGG - Intronic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986251136 5:6059486-6059508 GCACAAAGGCAGAAGGAGAGGGG + Intergenic
986426574 5:7637452-7637474 GAGAAGAAGAAGAAGAAGAAAGG + Intronic
986695586 5:10352260-10352282 GAGTTGGATCAGAAGGAGAGGGG + Intergenic
986840794 5:11694760-11694782 GAACAGAGACAGAAGGAGAGAGG - Intronic
987100289 5:14585123-14585145 GAGGAGAAGGAGGAGTAGAGGGG + Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
988289037 5:29260790-29260812 GAGAAGAAGAAGAGGGGGAGAGG + Intergenic
988354480 5:30155586-30155608 GGTCAGAAACAGAAGGAGTGGGG - Intergenic
988368618 5:30336903-30336925 GAGCAGAGGTAGAATTAGAGAGG + Intergenic
988407488 5:30842071-30842093 GAAGAGAAGCAGAAAGATAGAGG - Intergenic
988427375 5:31079146-31079168 AACCAGAAGCAGATGGAGGGAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988976405 5:36520916-36520938 GGGCAGAACTAGAAGGTGAGAGG - Intergenic
989153940 5:38326331-38326353 GAGCAGCAACCGAAGTAGAGAGG + Intronic
989208184 5:38832073-38832095 GAGGAGAGAGAGAAGGAGAGAGG - Intergenic
989208190 5:38832169-38832191 GAGGAGAGAGAGAAGGAGAGAGG - Intergenic
989311910 5:40028979-40029001 GAAGAAAAGGAGAAGGAGAGGGG - Intergenic
989320795 5:40131346-40131368 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
989425579 5:41291699-41291721 GAGCAGTTGCAGAAAGAGGGTGG + Intergenic
990357063 5:54978911-54978933 GAGCAGGAGAAGATGGGGAGGGG - Exonic
990524053 5:56607597-56607619 TGGCAGAGGCAGCAGGAGAGGGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
990773132 5:59273273-59273295 GTGCAGAGGCACAAGAAGAGAGG + Intronic
991089847 5:62683800-62683822 GAGCACAGGCAGAATCAGAGAGG - Intergenic
991930796 5:71750788-71750810 AAGGAGAAGGAGAAGAAGAGAGG - Intergenic
991965134 5:72083266-72083288 GAGGAAAAGGAGAAGCAGAGAGG - Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
992813985 5:80418221-80418243 GAGGAGAAGAGAAAGGAGAGAGG - Intronic
993011827 5:82492002-82492024 AAGCAGAAGCAAAGGTAGAGGGG - Intergenic
993013308 5:82508504-82508526 GAGCAGCAGCAGTAGAAGACAGG - Intergenic
994171015 5:96660191-96660213 GAACAGAAGGAGAAGGGGTGGGG - Intronic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994343919 5:98663212-98663234 AAGCAGAGGGAGAAGGAAAGAGG + Intergenic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994926274 5:106120949-106120971 GAGCAGAGCCAGAAGGCGGGAGG - Intergenic
995272886 5:110242430-110242452 AAGCAGGAGCAGGAGGAGTGGGG + Intergenic
995414316 5:111891731-111891753 GAGCAGGAGCAAGAGGGGAGAGG + Intronic
995695384 5:114873309-114873331 CAGCTGAAGCAGAAGGAATGGGG - Intergenic
995752464 5:115467877-115467899 GAGCAGAAGAGGGAGGAGAGTGG + Intergenic
995927693 5:117394812-117394834 GAGCAGACCCAGAAAAAGAGAGG - Intergenic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996282793 5:121751675-121751697 TTGCAGAAGAAAAAGGAGAGAGG + Intergenic
996581389 5:125035889-125035911 GAGCAGCATCAGAAGCGGAGGGG + Intergenic
996833290 5:127763794-127763816 AGGCAGAAGCAGAGGGAAAGGGG - Intergenic
997208950 5:132066583-132066605 GAGCAAGGGCAGAGGGAGAGAGG + Intergenic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998179188 5:139924625-139924647 GAGCAAGAGCAGATGGAAAGAGG - Intronic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
998811020 5:145966009-145966031 GTGCAGAAGCGGGAGGAGGGAGG + Intronic
999142935 5:149374608-149374630 GAGCAGAAGAAAGAGCAGAGCGG + Intronic
999261497 5:150241469-150241491 GAAGAGAAGAAGGAGGAGAGGGG - Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999446044 5:151640171-151640193 GCTCAGAAGCAGCAGGAGACAGG + Intergenic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
999863094 5:155669400-155669422 GAGACAAAGCAGAAGGAGAGGGG + Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000169691 5:158689931-158689953 GAGGAGAAATGGAAGGAGAGGGG + Intergenic
1000210030 5:159100212-159100234 GAGGAGAGGGAGAAAGAGAGAGG + Intergenic
1000275441 5:159730651-159730673 GGGCAGAATCAGCAGAAGAGGGG - Intergenic
1000299752 5:159945566-159945588 GCACAGAAGCAGGAGGAGAGAGG + Intronic
1001525658 5:172426806-172426828 AAGCAGAGCCAGAGGGAGAGAGG + Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002298103 5:178242300-178242322 GAGCTGGGGCAGGAGGAGAGGGG - Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002401053 5:178991782-178991804 GGGCAGAAGCAGAAAGATGGGGG - Intronic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1002940924 6:1715088-1715110 CAGCAGAAACATAAGGAGACAGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003593068 6:7452259-7452281 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1003773302 6:9331919-9331941 GTGCAGAAACAGAAGGATGGAGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003941886 6:11036944-11036966 GAGGAGAGAGAGAAGGAGAGGGG + Intronic
1003942394 6:11043155-11043177 GAGCAAAATCAGATGGAGTGGGG + Intronic
1004101375 6:12615603-12615625 TAGCAGAAGTGGAAGGAAAGTGG - Intergenic
1004173012 6:13313515-13313537 GAGCAGATGCTCAAGCAGAGGGG - Intronic
1004277525 6:14251687-14251709 GAGCAGGAGGAAAAGGAGAAGGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004615711 6:17286775-17286797 GAGCCGAAGCAGAGGCATAGAGG + Intronic
1004685459 6:17939156-17939178 TAGCAGATGCACAAGGAAAGGGG - Intronic
1004725623 6:18308803-18308825 GGGAAGAAAGAGAAGGAGAGAGG - Intergenic
1004767976 6:18752923-18752945 CCACAGAAGCAGAAGGGGAGAGG - Intergenic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1005294627 6:24413245-24413267 GAGCAGGAGGGGAAGGAGAGAGG + Intronic
1005358292 6:25006504-25006526 GAACAAAAGCAGAGGGAGATTGG - Intronic
1005495449 6:26383859-26383881 GAGCAGGAGGAGGAGGAGGGAGG - Exonic
1005513317 6:26531364-26531386 GAGCTGATGGAGCAGGAGAGTGG + Intergenic
1005624715 6:27652875-27652897 GGGCAGAGGCAGAGGGACAGGGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006145037 6:31953829-31953851 GAGCTGAAGCAGAAGAGGGGAGG + Exonic
1006335814 6:33420157-33420179 GAGGAGGAGGAGGAGGAGAGAGG - Exonic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007237093 6:40398403-40398425 GAGCAGCAGCAGAAGGTCGGCGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007429604 6:41769088-41769110 GAGGAGGAGGAGGAGGAGAGAGG + Intergenic
1007578229 6:42939515-42939537 GAAGAGGAGCAGCAGGAGAGAGG - Intergenic
1007708130 6:43803935-43803957 GAGGAGAAGGAAGAGGAGAGAGG + Intergenic
1007761542 6:44136214-44136236 GCGCAGAGGCTGAAGCAGAGAGG - Intronic
1007822060 6:44567819-44567841 GAGCAGAAGATACAGGAGAGAGG - Intergenic
1008064770 6:47035901-47035923 GAGCAGAGAGAGAGGGAGAGGGG + Intronic
1008065540 6:47043857-47043879 GAAAACAAGCAGAAGGAGAATGG - Intergenic
1008225014 6:48904446-48904468 GAGGAGAAGAAGAAGTAGAAGGG - Intergenic
1008743259 6:54636215-54636237 GAGCAGAAAGAGAACTAGAGAGG + Intergenic
1008753446 6:54764983-54765005 GAGAAAAAGCAGAAGGACAGAGG - Intergenic
1009635555 6:66259982-66260004 TAGGAGAAGGGGAAGGAGAGGGG + Intergenic
1010387694 6:75301557-75301579 TAGCATTAGCAGAAGTAGAGAGG + Intronic
1011170542 6:84499885-84499907 GAGCACAAGCCCAAGGAGAGTGG + Intergenic
1011618777 6:89222541-89222563 GAGCAGATGCAGAACGGGGGTGG - Intronic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012747434 6:103111107-103111129 GAGTACAGGCAGAAGGAAAGAGG + Intergenic
1012961011 6:105621709-105621731 GAGCAGCACCAGCAGGAGATCGG - Intergenic
1013071097 6:106729996-106730018 GAGCAGGTGGAGAAGGAGGGAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1014776088 6:125511449-125511471 GAGGAGAAGAGAAAGGAGAGGGG - Intergenic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015827115 6:137325906-137325928 GAGCAGGGACATAAGGAGAGAGG + Intergenic
1016003685 6:139067771-139067793 GAGGAGAAGGAGGAGGAGAGGGG - Intergenic
1016754963 6:147674827-147674849 GGGAAACAGCAGAAGGAGAGTGG - Intronic
1016997272 6:149969552-149969574 GAGCAGAAGCAGGTGCAGTGAGG - Intronic
1017001533 6:150000633-150000655 GAGCAGAAGCAGGTGCAGTGAGG + Intergenic
1017041811 6:150314253-150314275 GAGCACCTGCAGAAGGGGAGAGG + Intergenic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1017132219 6:151117457-151117479 GAGCAGATTCAGAAGGAGTGAGG + Intergenic
1017266774 6:152455324-152455346 GATCTGATACAGAAGGAGAGCGG - Intronic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017753322 6:157509121-157509143 GAGATGAGGCAGGAGGAGAGAGG - Intronic
1017945216 6:159091064-159091086 GAGCAAGAGCAGGAGGACAGAGG - Intergenic
1017972653 6:159326754-159326776 GAGGAGAAGAGGAAGGAGACAGG + Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018393778 6:163361349-163361371 TTGCAGATGCAGAAGGGGAGAGG - Intergenic
1018935006 6:168268536-168268558 GAGCAGAAACAGCGCGAGAGAGG + Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019032298 6:169024118-169024140 CAGCAGAAGCAGAGGGGCAGCGG + Intergenic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019535282 7:1526141-1526163 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535285 7:1526144-1526166 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535306 7:1526228-1526250 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535309 7:1526231-1526253 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019799011 7:3074010-3074032 AAGCAGGAGGAGAAGGAGAGAGG - Intergenic
1019891998 7:3954488-3954510 GAGGAGAAGCAGGAGGGGAGGGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020079702 7:5280924-5280946 CAGCAGCAGAGGAAGGAGAGGGG + Intronic
1020097191 7:5375803-5375825 GAGCAGAGGCAGATGGAGATTGG - Intronic
1020463767 7:8453134-8453156 TTACAGAAGTAGAAGGAGAGGGG + Intronic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021425147 7:20491086-20491108 GAGCAGAAGAAGAGAGAGACGGG - Intergenic
1021469187 7:20981713-20981735 GATGAGAAACAGAAGGATAGAGG - Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1022044826 7:26614347-26614369 GAGCAGATTTAAAAGGAGAGAGG + Intergenic
1022102950 7:27179980-27180002 GGGCAGAGAGAGAAGGAGAGAGG + Exonic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022218778 7:28291484-28291506 TAGCAGAAGCAGATTGACAGAGG - Intergenic
1022474087 7:30699201-30699223 GAGCTGAAGAAGTAGGGGAGAGG - Intronic
1022590705 7:31659467-31659489 GGGCAGAAGAAGAAGCAGAGAGG - Intergenic
1022723730 7:32962859-32962881 GAGAAAAAGCAGTAGGAGTGAGG + Intronic
1022873494 7:34504001-34504023 GAGCAGGAGCAAGAGGAGGGAGG + Intergenic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023003037 7:35830839-35830861 AAGCAGAAACAGATGGAAAGAGG - Intronic
1023085770 7:36568737-36568759 GAGAAGAAAGAGAAGGGGAGGGG - Intronic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023436638 7:40147147-40147169 TAGCGGAAGGGGAAGGAGAGGGG - Intronic
1023549759 7:41357237-41357259 TAGCAGAAGGAGAAGAAAAGAGG - Intergenic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1023897902 7:44449570-44449592 GCAAAGAAGCAGAAGGAAAGGGG + Intronic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024295993 7:47842748-47842770 GAGCAGCTGCAGAAGGTGAAGGG + Intronic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1024450934 7:49542291-49542313 GAACTGAAGCAGAAGGAGATGGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024891681 7:54210989-54211011 GAGCAGAAGAAAAAGTAAAGGGG + Intergenic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025049894 7:55725056-55725078 GAGAAAAAGCAGTAGGAGTGAGG - Intergenic
1025083784 7:56006212-56006234 GGGAAGAAGTAAAAGGAGAGAGG + Intergenic
1025199202 7:56951279-56951301 CAGCAGCAGAGGAAGGAGAGGGG - Intergenic
1025284352 7:57650147-57650169 GAGCAGAAGAAGCAGGAGGGAGG + Intergenic
1025573180 7:62600678-62600700 GAGGAGAGGGAGAGGGAGAGGGG + Intergenic
1025672744 7:63625654-63625676 CAGCAGCAGAGGAAGGAGAGGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026205727 7:68255617-68255639 GAGGAGAAGGGGAAGGAGAAGGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026284985 7:68955124-68955146 AAGCAGAAAGAGAAAGAGAGGGG + Intergenic
1026305294 7:69134994-69135016 AAGGAGAGGGAGAAGGAGAGAGG - Intergenic
1026641501 7:72130115-72130137 GGCAAGAAGCAGAAGGGGAGCGG - Intronic
1026828297 7:73597087-73597109 GAGCAGAAGATGAAGGTGAAGGG - Intronic
1026955052 7:74371751-74371773 GAGAGGGAGGAGAAGGAGAGAGG + Intronic
1027192612 7:76005883-76005905 GAGGAGGAGGAGGAGGAGAGAGG + Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028210577 7:88069240-88069262 GAAGGAAAGCAGAAGGAGAGAGG - Intronic
1028246848 7:88489649-88489671 GAGGAGAAGGAGGAGGAAAGAGG - Intergenic
1028793526 7:94879004-94879026 GAGGGGAAGGGGAAGGAGAGGGG + Intergenic
1029094874 7:98077190-98077212 GAGGAGGAGCAGGAGGAGAAGGG + Intergenic
1029094877 7:98077196-98077218 GAGCAGGAGGAGAAGGGGAAGGG + Intergenic
1029416509 7:100446492-100446514 GGGCAGAGGCAGGAGGAGAGAGG + Intergenic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1030081501 7:105782579-105782601 GATCAGGAGCAGAAGGACTGTGG + Intronic
1030145318 7:106347614-106347636 GAACAGAAGCAGAAAGACATTGG + Intergenic
1030361387 7:108598855-108598877 GTGCAGAGGAAGAGGGAGAGAGG + Intergenic
1030397289 7:109002932-109002954 GAGGAGAAGAAGAAGCAGTGAGG - Intergenic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030758784 7:113324410-113324432 GAGCAGAAACACAATGAGACAGG - Intergenic
1030873285 7:114783522-114783544 GAGCAGAGGGACATGGAGAGAGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031214842 7:118877207-118877229 GGGAAGAAGGAGAAGGGGAGGGG + Intergenic
1031537132 7:122948359-122948381 GAGGAGAAGGAGAAGGACAAGGG + Intergenic
1031796204 7:126176992-126177014 GAGGAGGAGGAGAAGGAGAAGGG - Intergenic
1032013589 7:128361727-128361749 GAGGAGGAGGAGGAGGAGAGAGG - Intergenic
1032216974 7:129965011-129965033 GGGCAAAAGCAGGAGCAGAGAGG - Intergenic
1032725544 7:134587129-134587151 GGGAAGAAGCAGAGAGAGAGGGG + Intergenic
1032794969 7:135269794-135269816 GAGGAGGGGCAGAAGGAGTGGGG + Intergenic
1033105105 7:138513547-138513569 GAGCAGGGGCAAAAAGAGAGGGG + Intronic
1033259583 7:139831244-139831266 GAGCAGAGGCAGCAGGAGAGAGG + Intronic
1033538570 7:142334815-142334837 GAGCAGAAACAGATGGACAGTGG - Intergenic
1033595211 7:142854484-142854506 GAGCCGAGGCAGCGGGAGAGGGG - Intergenic
1033657572 7:143383388-143383410 GAGCATAAGCATAAGGTGATTGG + Intronic
1033818944 7:145109961-145109983 GAGCAGAAGCTGAAAGAGTTTGG + Intergenic
1033988738 7:147257862-147257884 GTTCAGAGGCAGATGGAGAGAGG + Intronic
1034009880 7:147518387-147518409 AAGCAGAAGATGAAGGAGACAGG + Intronic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034432499 7:151048229-151048251 CCGCAGAGGCAAAAGGAGAGAGG + Intergenic
1034435655 7:151061681-151061703 GAGTAGAGGGAGGAGGAGAGAGG - Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034726744 7:153343301-153343323 GAGCAGAAGAGAAAGGAGACAGG - Intergenic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1035658852 8:1331823-1331845 AGGCAGGAGCAGAGGGAGAGTGG + Intergenic
1035670633 8:1414506-1414528 GAGCAGAAGCGGAAGGTGGCGGG + Intergenic
1036518643 8:9469445-9469467 GAGAGGAAGAAGGAGGAGAGAGG - Intergenic
1036701303 8:11015685-11015707 GCTCAGAACCAGAAGGAGCGAGG + Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037465602 8:19157065-19157087 GAAAAGAAGCAGAACCAGAGAGG - Intergenic
1037655440 8:20879695-20879717 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1037683294 8:21116755-21116777 GAGCAGAAGCAGGTGGTGAGTGG - Intergenic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1037809853 8:22080856-22080878 GTGCTGGAGCAGAAGGTGAGGGG + Exonic
1037874998 8:22539879-22539901 GAGCAGAGGCAGAAGTAGACTGG + Intronic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1037943405 8:22971819-22971841 TAGCTGAAGCAGGAGAAGAGTGG - Intronic
1038075581 8:24069688-24069710 GACAAGAAGCAGAAGGAGATAGG + Intergenic
1038120391 8:24607973-24607995 GAGGAAAAGGAGAAGGGGAGGGG + Intergenic
1038473198 8:27842924-27842946 GATCAGGAGAAGAATGAGAGGGG + Intergenic
1038486115 8:27936285-27936307 GACCAGTAGGACAAGGAGAGTGG + Intronic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1039138981 8:34361303-34361325 GAGCAAAAGACAAAGGAGAGAGG - Intergenic
1039411733 8:37360463-37360485 GAGAGGCAGCAGCAGGAGAGAGG + Intergenic
1039552334 8:38452020-38452042 GAGGGGAAGGAGAGGGAGAGGGG + Intronic
1039555555 8:38472448-38472470 GAGCAGGGGCAGAAGGAATGTGG - Intergenic
1040065687 8:43141676-43141698 AAGCAGAAGCTGGAGGAGAAAGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040758416 8:50808603-50808625 GAGAAGACAGAGAAGGAGAGGGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041144390 8:54858199-54858221 GAGCAGAAGCAGAAAAGGTGAGG + Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041525337 8:58799341-58799363 GAGGAGAGACAGAAAGAGAGAGG + Intergenic
1041609035 8:59821674-59821696 GGGCAAAGGTAGAAGGAGAGGGG + Intergenic
1041627171 8:60043538-60043560 GAGCAGGAGAAGAAGGGGAGTGG + Intergenic
1041860266 8:62504820-62504842 GAGCAGAAAGAGAAGTAGTGAGG - Intronic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042223292 8:66494404-66494426 GAACAGAGGCGGCAGGAGAGGGG - Intronic
1042419421 8:68568030-68568052 GAGAAGAAGCAGAGAGATAGGGG + Intronic
1042567510 8:70127482-70127504 GAGCAGAGGCAGGAGGAAAAGGG + Intronic
1042691799 8:71508118-71508140 GTGCAGAAGCACAAGGACAAAGG - Intronic
1042739386 8:72026291-72026313 GAGTGGGAGAAGAAGGAGAGGGG + Intronic
1043019648 8:74984605-74984627 GAGCAGTAGCTGCAGGAGCGAGG - Exonic
1043280486 8:78459664-78459686 GAACAGAAGGAGAAGGATATGGG + Intergenic
1043398053 8:79857809-79857831 GAGGAGAAGCAAAAAGGGAGAGG - Intergenic
1043925436 8:86031174-86031196 GAGCAGAAGCAAAACCAGAGAGG + Intronic
1044526884 8:93262278-93262300 GAGCAGAAGGAGAGGGGGAGAGG + Intergenic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045395644 8:101758240-101758262 GAGCAGGAGCGGGTGGAGAGAGG - Intronic
1045799421 8:106084905-106084927 GAGAAAGAGCAGAAGCAGAGTGG - Intergenic
1046031426 8:108787468-108787490 TGGCCGAAGCAGAAGGTGAGTGG - Exonic
1047250088 8:123175411-123175433 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1048287647 8:133154279-133154301 GAACAGAGGCACTAGGAGAGGGG - Intergenic
1048316977 8:133369839-133369861 GAGCAGAAGGAGAGGAAGAGAGG + Intergenic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048417559 8:134243633-134243655 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048417573 8:134243687-134243709 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048417576 8:134243693-134243715 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048461802 8:134627213-134627235 GAGCAGACTCAGAAGGAGAGCGG + Intronic
1048516584 8:135116824-135116846 GAGGAGGAGGAGGAGGAGAGGGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048695122 8:137019178-137019200 GAGCAGAAGCAGAAAGCAACAGG + Intergenic
1048904364 8:139073615-139073637 AAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049405253 8:142449533-142449555 GAGGAGAAGGAGGAGGAGAGAGG - Exonic
1049662750 8:143827534-143827556 GAGCTGAAGCAGCATGAGACAGG + Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050020296 9:1276762-1276784 GGGCAGAGCCAGAAAGAGAGGGG + Intergenic
1050052561 9:1618425-1618447 GCCCAATAGCAGAAGGAGAGTGG - Intergenic
1050090734 9:2015328-2015350 GTACAGAAACAGAGGGAGAGAGG - Exonic
1050259109 9:3822375-3822397 TAGCAGAAGAATAAGCAGAGGGG + Intergenic
1050592410 9:7174023-7174045 GAGAAGGAGAAGCAGGAGAGTGG + Intergenic
1050774228 9:9239814-9239836 GAGCACAAGCCAAAGGATAGAGG - Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051109579 9:13620638-13620660 TAGCAGAGGGAGAAGGACAGAGG - Intergenic
1051436617 9:17040419-17040441 GAACAGGAGCAGAAGGTGGGTGG - Intergenic
1051547735 9:18294936-18294958 GAGCAGAAGAAGGAGCAAAGAGG - Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051978804 9:22987881-22987903 GGGAAGAAGCAGAGGAAGAGAGG + Intergenic
1052677564 9:31646520-31646542 GAGCAGAACAAGAAGGACAGAGG - Intergenic
1052738435 9:32369648-32369670 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1053022802 9:34707704-34707726 GAGGAGAAGAAGAAGAAGAAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053272418 9:36759455-36759477 GAGGAGAAGCAGTAGCTGAGAGG + Intergenic
1053284745 9:36842869-36842891 GAGATGAAGCAGAAGGACTGGGG - Intronic
1053287522 9:36859500-36859522 GTGCAGACGCTGAAGGAGAGGGG - Intronic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053724940 9:40990135-40990157 AATCAGAATCAGCAGGAGAGAGG + Intergenic
1054341028 9:63861866-63861888 AATCAGAATCAGCAGGAGAGAGG - Intergenic
1054850650 9:69843458-69843480 GAGGAGAAGTAGGAGGGGAGGGG - Intronic
1055012297 9:71579998-71580020 GAGCAAAAGCAGAGGCAAAGTGG - Intergenic
1055210237 9:73782887-73782909 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055742806 9:79408210-79408232 GGGCAAAACCAGGAGGAGAGAGG + Intergenic
1056207557 9:84334934-84334956 GAGCAGCAGAACCAGGAGAGGGG - Intronic
1056436264 9:86578300-86578322 GAACAGGAGCAACAGGAGAGAGG - Intergenic
1056697884 9:88875449-88875471 GCCCAGAAGCAGAGGGAGGGAGG - Intergenic
1056710700 9:88990502-88990524 GAGGAGGAGGAAAAGGAGAGAGG - Intergenic
1056898225 9:90571547-90571569 GAACAAATACAGAAGGAGAGAGG + Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1056980022 9:91301178-91301200 GAGCAGAAGCAGAGAAAGAGTGG + Intronic
1057047943 9:91900260-91900282 GCGCAGAAGCAGAAGCAAACTGG + Intronic
1057147196 9:92765946-92765968 GCGGACAAGCAGATGGAGAGGGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057345702 9:94248668-94248690 GATTAGGAGCTGAAGGAGAGGGG - Intergenic
1057456292 9:95215361-95215383 GAGGAGAGGGAGATGGAGAGAGG + Intronic
1057497373 9:95571852-95571874 GAGAAGGAGGAGGAGGAGAGGGG + Intergenic
1057537748 9:95931223-95931245 GGGCAGAAACAGACTGAGAGGGG - Intronic
1057711222 9:97446947-97446969 CAGCAGAAGCAGAAGTGAAGAGG + Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057929880 9:99184292-99184314 GAGCAGAGGAGGAAGCAGAGGGG + Intergenic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1058343419 9:103926701-103926723 GAAAAGGAGCAGAGGGAGAGAGG + Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059266115 9:113032616-113032638 GAGCAGAAGATGAAGGAAGGCGG + Intergenic
1059542524 9:115144377-115144399 GAGGAAAAGGAGAAGGGGAGGGG - Intronic
1059632220 9:116136840-116136862 GAGAAGAAGAGGAAAGAGAGAGG + Intergenic
1059850143 9:118329182-118329204 GAGCTGAAGCAGAAGAATGGAGG - Intergenic
1059860508 9:118455522-118455544 GAGCAGAAAGAGAGAGAGAGAGG + Intergenic
1059976434 9:119722822-119722844 AGGCAGAAGCAGAACGAGAGAGG - Intergenic
1059998112 9:119933457-119933479 GAGCAAAAGGAGCAAGAGAGAGG - Intergenic
1060237266 9:121873639-121873661 AAGAAGAAGAAGAAGAAGAGAGG - Intronic
1060315677 9:122508161-122508183 GAGAAGGAGAAGAAGGAGAAGGG + Intergenic
1060320536 9:122555326-122555348 GAGAAGGGACAGAAGGAGAGAGG - Intergenic
1060402382 9:123356304-123356326 GAGCAGCAGTAGCAGGACAGAGG - Exonic
1060430083 9:123543576-123543598 GAGCAGGGACAGAAGGAGCGTGG - Intronic
1060498129 9:124132863-124132885 GACCAGGAGCAGGAGGGGAGGGG + Intergenic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1060998974 9:127891714-127891736 GAGGAGAGGGAGAAGGGGAGGGG + Intronic
1061613637 9:131764783-131764805 GAGAAGGAGGAGGAGGAGAGAGG - Intergenic
1061682956 9:132252372-132252394 TAGCCGAGGCAGAAAGAGAGAGG + Intergenic
1061977680 9:134078860-134078882 GAGCAGAAGCAGAAGCGGTTTGG - Intergenic
1062040327 9:134401603-134401625 GACAAGAAGCCGCAGGAGAGTGG - Intronic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062166326 9:135109443-135109465 GAGAAGAAGCCGCAGGAGAAGGG + Intronic
1062194136 9:135263891-135263913 GAGGGGAAGGAGGAGGAGAGGGG - Intergenic
1062309156 9:135926659-135926681 CAGCACCAGCTGAAGGAGAGAGG - Intergenic
1062405169 9:136392788-136392810 GAGCAGAGGCAGAAGGGCTGGGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062530475 9:136997325-136997347 AAAAAGAAGCAGCAGGAGAGGGG + Intergenic
1062588720 9:137263461-137263483 GGGCAGAGGGGGAAGGAGAGAGG - Intronic
1062724284 9:138062619-138062641 GAACGGAAGCATAATGAGAGGGG - Intronic
1062729813 9:138102637-138102659 GAGCGGCAGCAGGAGGGGAGCGG - Intronic
1185502515 X:608482-608504 GAAGAGAAGAAAAAGGAGAGAGG - Intergenic
1185544173 X:928790-928812 GGACAGAAACAGAAGGACAGGGG + Intergenic
1185586591 X:1245767-1245789 GAGCAGAAGAAGCAGAAGATGGG + Intergenic
1185591607 X:1281052-1281074 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185591619 X:1281096-1281118 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185688323 X:1948429-1948451 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185688601 X:2133951-2133973 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1185793426 X:2945009-2945031 AAGAAGAAGAAGAAGAAGAGGGG + Intronic
1185814980 X:3146291-3146313 GAGGAGGAGGAGGAGGAGAGAGG - Intergenic
1185851075 X:3489279-3489301 GAGAGGAGGCAGAGGGAGAGAGG + Intergenic
1185851085 X:3489330-3489352 GAGAGGAGGCAGAGGGAGAGAGG + Intergenic
1185953333 X:4460828-4460850 GAGGAGGAGGAGGAGGAGAGGGG - Intergenic
1186045553 X:5532818-5532840 GGAGAGAAACAGAAGGAGAGAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1187411896 X:19058337-19058359 GTACACAAGCAGAAGGAGATGGG - Intronic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187561536 X:20407983-20408005 GAGCAGGAGCAGAGAGGGAGGGG + Intergenic
1187652065 X:21420434-21420456 AAGCAGAAGAAAAAGGAAAGGGG - Intronic
1187734243 X:22288571-22288593 GGGGAGAGGCAGAGGGAGAGGGG - Intergenic
1188219207 X:27519296-27519318 GAGCAAAAGAAGAAGCAGAGCGG + Intergenic
1188237187 X:27744828-27744850 TGGCAGAAGGAGAAGGGGAGCGG - Intronic
1188472968 X:30560833-30560855 GAGCACAAGCAGAAGGAATTGGG + Intronic
1188529850 X:31127839-31127861 GGGAAGAAAGAGAAGGAGAGAGG - Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188980183 X:36720428-36720450 GAGAAGAAGAAGAAGAAGGGAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189053287 X:37669543-37669565 GAGCAGGAGCAAGAGGGGAGGGG - Intronic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189186817 X:39061990-39062012 GGGCGGATGCAGATGGAGAGAGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189785484 X:44555463-44555485 GAGGAGAAGCAGCAGGCGATTGG - Intergenic
1190259842 X:48790908-48790930 GAGAAGGAGGGGAAGGAGAGGGG + Intronic
1190290235 X:48987719-48987741 GACCAGAAGCAGATGGAGATGGG + Intronic
1190850814 X:54239741-54239763 GAGTAGAAGGACAAGAAGAGGGG - Intronic
1191103748 X:56759700-56759722 AGGCTGAAGCAGGAGGAGAGAGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1192761127 X:74097730-74097752 GGGTAGAGGGAGAAGGAGAGGGG - Intergenic
1193065357 X:77253906-77253928 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1193483646 X:82059534-82059556 GAGCTGAAGAAGGAGGAGACTGG + Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194537632 X:95125622-95125644 GAGAAGGAGGAGAAGGAAAGAGG + Intergenic
1195348586 X:103975970-103975992 GCCCAGAAGCAGAAGAAGTGAGG + Intergenic
1195358856 X:104062870-104062892 GCCCAGAAGCAGAAGAAGTGAGG - Intergenic
1195577549 X:106468143-106468165 AGGAAGAAGAAGAAGGAGAGGGG - Intergenic
1196727060 X:118905263-118905285 GAGAAGAAGAAGAAGGGGAAGGG - Intergenic
1197077924 X:122375368-122375390 CAGCTGAGGCAGAAGGGGAGAGG + Intergenic
1197456650 X:126684340-126684362 CAGTAGAAGCATAAGGAAAGGGG + Intergenic
1197535222 X:127679030-127679052 TAGAGGAAGTAGAAGGAGAGTGG + Intergenic
1197831641 X:130649089-130649111 GAGAGGAAGCAAGAGGAGAGGGG - Intronic
1197906082 X:131427282-131427304 GAGAAGCAGGAGGAGGAGAGAGG - Intergenic
1197947074 X:131851155-131851177 TAGCAGAAGCAGGAAGAGAGCGG - Intergenic
1198467552 X:136917123-136917145 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
1198768617 X:140104676-140104698 GATCACAAGTAGTAGGAGAGTGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1199833256 X:151564004-151564026 GGGATGAGGCAGAAGGAGAGGGG + Intronic
1199843146 X:151671244-151671266 TAGCAGAAGGAAGAGGAGAGAGG + Intronic
1199903070 X:152196571-152196593 GAGCAGAAGCTGTATGAGAGTGG - Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200763494 Y:7061607-7061629 TAGGGGAAGGAGAAGGAGAGGGG - Intronic
1200923482 Y:8633704-8633726 GAGAAGAAGAAGAAGAAAAGAGG - Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic