ID: 1166869108

View in Genome Browser
Species Human (GRCh38)
Location 19:45860153-45860175
Sequence CAGTTAATATATATTGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166869105_1166869108 18 Left 1166869105 19:45860112-45860134 CCTGATGAACCTGTTTCCAAAAA 0: 1
1: 0
2: 1
3: 32
4: 532
Right 1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG 0: 1
1: 0
2: 1
3: 28
4: 320
1166869106_1166869108 9 Left 1166869106 19:45860121-45860143 CCTGTTTCCAAAAAAAAAAAAGA 0: 7
1: 194
2: 2776
3: 20773
4: 38510
Right 1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG 0: 1
1: 0
2: 1
3: 28
4: 320
1166869107_1166869108 2 Left 1166869107 19:45860128-45860150 CCAAAAAAAAAAAAGAAAAAATA 0: 6
1: 284
2: 15941
3: 22823
4: 45631
Right 1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG 0: 1
1: 0
2: 1
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166869108 Original CRISPR CAGTTAATATATATTGAACA CGG Intronic
901168711 1:7238581-7238603 CAGTTAATATTTACTGAGCAGGG + Intronic
907111467 1:51930377-51930399 TAGCTGATATATATTGAACAAGG - Intronic
907165337 1:52405512-52405534 CAGCTAATATACATTGAGAATGG - Intronic
907295955 1:53454469-53454491 CACTCAATAAATATTGACCATGG + Intergenic
908342328 1:63194450-63194472 CAGTAAATATTTATGGCACATGG - Intergenic
908428995 1:64037650-64037672 CAGTTGACATTTATTGAATAGGG + Intronic
908557727 1:65273950-65273972 TAATTAACATATATAGAACATGG - Intronic
909601537 1:77466356-77466378 AAGTAAATGTATGTTGAACATGG - Intronic
911281396 1:95933830-95933852 CAATTAATATATTTAAAACAAGG + Intergenic
911388178 1:97204114-97204136 AAGTTAATATATGGTAAACACGG + Intronic
911820110 1:102407788-102407810 GATTTAATATATATTTAACAGGG + Intergenic
912023848 1:105141238-105141260 TAGTAAATATAGATTGAAAAGGG + Intergenic
913097365 1:115531692-115531714 CAGTTAACATATAATGAGCAGGG - Intergenic
915406249 1:155661954-155661976 CAGTTAGAAAATATTGAATAGGG - Intronic
916305661 1:163328140-163328162 GAGTTAATATATTTTGATCTTGG + Intronic
917253922 1:173094058-173094080 CAGTTAATAAATATGGGAAATGG - Intergenic
918261182 1:182797830-182797852 CATTCAATATCTATTGAACAGGG - Intronic
918478403 1:184951141-184951163 CAGCTAATATTTAATGCACATGG - Intronic
918682623 1:187374029-187374051 CAGATAATAAATATTTATCAAGG - Intergenic
919176474 1:194025930-194025952 TACTTAATTTATATTCAACATGG - Intergenic
919222970 1:194655320-194655342 CATATATTATATATAGAACATGG + Intergenic
919562452 1:199138709-199138731 CAGTTAATGTTTATTGAATTTGG + Intergenic
921136552 1:212265960-212265982 CAGCAAATATATAGTGAACTTGG - Intergenic
921473951 1:215582860-215582882 CATTTAAAATATGTAGAACAAGG - Intronic
923221396 1:231897445-231897467 CAGTTATCATTTATGGAACAAGG + Intronic
923370664 1:233309239-233309261 CAGTTAAAATATTTGGAATATGG + Intergenic
923453508 1:234142046-234142068 CATTTAATAAATATTTACCAAGG - Intronic
924146283 1:241078603-241078625 AATCTAATATATATGGAACAAGG - Intronic
924543161 1:245000368-245000390 CATTTAATATATTTGGACCACGG + Intronic
924768467 1:247055971-247055993 GAGTGCATATATATTGAAAATGG - Intronic
1063201896 10:3792092-3792114 AAGACAATAAATATTGAACACGG - Intergenic
1065405773 10:25362127-25362149 GAGTTAATATATATGGCATAAGG + Intronic
1065462213 10:25980621-25980643 CACTTCATTTATATTGAACTTGG + Intronic
1065648240 10:27859635-27859657 CAGTAAAATTATATTGTACAAGG + Intronic
1066749707 10:38641232-38641254 GAGTTAATATATAATGTAAATGG + Intergenic
1066966942 10:42276547-42276569 GAGTTAATATATAATGTAAATGG - Intergenic
1068194046 10:53692828-53692850 AACTTAGTATATATTGCACATGG + Intergenic
1069460262 10:68588281-68588303 CACTTAATAAATACTGAATAAGG - Intronic
1070469306 10:76762778-76762800 CCCTCAATAGATATTGAACATGG + Intergenic
1071283262 10:84122398-84122420 AAGTTAATATGGACTGAACAAGG - Intergenic
1075146827 10:119889549-119889571 AAGTTAATATGGATTGAACAAGG + Intronic
1076321573 10:129586148-129586170 CAGTTAATATTTTTGGACCACGG + Intronic
1077542457 11:3153659-3153681 CAGTTTAAAAATAATGAACAGGG + Intronic
1077951650 11:6965186-6965208 CAGTAAAGGCATATTGAACACGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079481318 11:20883386-20883408 CATTTAATAAATATTGATTAAGG + Intronic
1079907315 11:26264970-26264992 GAGGTAATATATATTGAAGTTGG + Intergenic
1080360229 11:31505180-31505202 CAGAAAACATATAATGAACATGG - Intronic
1081223562 11:40493061-40493083 TATTTAATATATATTAAATATGG - Intronic
1085987459 11:81804476-81804498 CATTTACTATATATTGAAATAGG + Intergenic
1086577242 11:88353259-88353281 CAATAAATATCTATTCAACATGG + Intergenic
1088173893 11:107028745-107028767 CAGCTTACTTATATTGAACAAGG + Intergenic
1088576920 11:111281087-111281109 CACTTAATATATATTGGATGAGG + Intronic
1089345328 11:117787384-117787406 CAGTAAATATTTGTTGCACAAGG - Intronic
1090957774 11:131529001-131529023 CAGTAAATATATATTGCAATGGG + Intronic
1092659670 12:10723943-10723965 CTGTCAATATATATTTAATAAGG + Intergenic
1092683189 12:11011970-11011992 AAGTTTATAAATATTGAAAATGG - Intronic
1094075686 12:26471262-26471284 GGTTTAATATATATTGGACATGG + Intronic
1094428942 12:30345598-30345620 CACTTGACATTTATTGAACATGG + Intergenic
1094642649 12:32291233-32291255 CAGTTAACATCTATAGAATATGG + Intronic
1095523813 12:43100990-43101012 CAGAAAATAAATATTGAATATGG + Intergenic
1097397939 12:59098816-59098838 CAGTTAATTAATAGTGAAAATGG + Intergenic
1097423951 12:59418435-59418457 CACTGAATATATATCGAACTGGG + Intergenic
1097541475 12:60949245-60949267 CAATTAATATTGATTGAACTAGG - Intergenic
1097803573 12:63941125-63941147 AATTTAATATATATTTATCAGGG - Intronic
1099011814 12:77300373-77300395 CAGTTATGATATATTTAAAAAGG + Intergenic
1099217585 12:79872127-79872149 CAATGAATAAATATTGAATATGG - Intronic
1099649097 12:85401641-85401663 CAGTTAATATACAGTGAATACGG + Intergenic
1099906093 12:88771991-88772013 CTGTAAATAAATATTGAAAATGG + Intergenic
1099992242 12:89736318-89736340 CAGCAAGTATATATTAAACATGG + Intergenic
1100735735 12:97528009-97528031 CAGTTAATGTATATAAAACTCGG - Intergenic
1102627729 12:114249246-114249268 CAGTTTATATATATGGAAACGGG + Intergenic
1103310446 12:120002674-120002696 CAGCAAATATTTATTGATCAAGG + Intronic
1105872738 13:24521697-24521719 TAGTTAATATATGTTGAATTTGG + Intergenic
1106163214 13:27218832-27218854 AAGTTAATATGGACTGAACAAGG + Intergenic
1108381911 13:49862606-49862628 CAGTTACTTCATTTTGAACAAGG - Intergenic
1108609061 13:52066501-52066523 GAGTTAATTTTTTTTGAACAGGG - Intronic
1108799353 13:54074658-54074680 TACTTTATATATATTTAACATGG + Intergenic
1108997451 13:56752168-56752190 CAGTCAATATCTAATAAACAAGG - Intergenic
1109467154 13:62750696-62750718 CAGTTAATATTTGTTGATAATGG + Intergenic
1109560594 13:64044404-64044426 CATTTAATCTCTATTGACCATGG + Intergenic
1109995458 13:70118372-70118394 CCATTAATATTTATTGAACTGGG + Intergenic
1111284097 13:86065541-86065563 CTGTAAAGATATATTCAACACGG + Intergenic
1111345995 13:86955233-86955255 CAGTTAATAAATGCTCAACAAGG + Intergenic
1112668982 13:101613319-101613341 CAGTCAACATATATTTACCAGGG + Intronic
1112895219 13:104291049-104291071 CATTTAATATCTATTGTAAATGG - Intergenic
1113032674 13:106011996-106012018 CAGCTAAAATATATGAAACAAGG - Intergenic
1114652892 14:24297618-24297640 CAGTTAGGAGATTTTGAACAGGG - Intronic
1114904330 14:27106732-27106754 AAGGTAATATATAGTTAACAAGG + Intergenic
1115282833 14:31684123-31684145 CAGCTATTAGATATTGAAAATGG - Intronic
1117210814 14:53497027-53497049 CATTTAATTTCTATTGAACAGGG - Intergenic
1117605851 14:57428342-57428364 CAGGTAATACACATTGAACAAGG - Intergenic
1117854845 14:60017969-60017991 CAGATGATATATATTGAAGTAGG - Intronic
1118815685 14:69312286-69312308 CAGTCAGTATCTATCGAACACGG - Intronic
1119193449 14:72700342-72700364 TTCTTAATATTTATTGAACAAGG + Intronic
1119552288 14:75523756-75523778 AAGTATATAAATATTGAACAGGG + Intronic
1119577396 14:75738508-75738530 CAGTTACTAAATATTAGACAAGG - Intronic
1120631617 14:86898747-86898769 CAGTGAATGCATATTGAAAATGG - Intergenic
1120642086 14:87027815-87027837 CAGTTAAAATTTACAGAACAGGG + Intergenic
1124213968 15:27791172-27791194 CATTTTGTATATTTTGAACAAGG - Intronic
1126681659 15:51208123-51208145 CAGCTGATATAGATTGAAAAGGG + Exonic
1126878215 15:53066862-53066884 CAGTTCATATATCTTCAACATGG + Intergenic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128589772 15:68885263-68885285 CATTTAATATATATAAAACCCGG + Intronic
1130665603 15:85866908-85866930 CACATAATATATAGTGATCAGGG + Intergenic
1133507804 16:6429519-6429541 GACATAATATTTATTGAACAAGG - Intronic
1134762683 16:16728124-16728146 CAGTTAGTATATACTAAACACGG + Intergenic
1134818377 16:17225360-17225382 CTCTTAATATTTTTTGAACAAGG - Intronic
1134983369 16:18631024-18631046 CAGTTAGTATATACTAAACACGG - Intergenic
1136733010 16:32435920-32435942 GAGTTAATATATAATGTAAATGG - Intergenic
1139269050 16:65664757-65664779 CAGTTAATATCTGTTGAAGAAGG + Intergenic
1140159268 16:72469715-72469737 CACTTAATATATATGAAATATGG + Intergenic
1140345289 16:74207377-74207399 GAGTTAATATATAAAGAACTAGG + Intergenic
1140531697 16:75672357-75672379 AAGTGAATATAAATTGAACCAGG + Intronic
1203020071 16_KI270728v1_random:393683-393705 GAGTTAATATATAATGTAAATGG + Intergenic
1203038406 16_KI270728v1_random:666841-666863 GAGTTAATATATAATGTAAATGG + Intergenic
1150816118 17:68393215-68393237 CATTTAATATTTATAGACCATGG - Intronic
1154013854 18:10598764-10598786 ATGTTAATATATATTAAATAAGG - Intergenic
1155321885 18:24627388-24627410 TAGTTAATATCTATAAAACAAGG + Intergenic
1155363906 18:25031612-25031634 CAGATAAAATATATGAAACAAGG + Intergenic
1155951386 18:31916976-31916998 CCATTAATATATATGTAACAAGG + Intronic
1156112432 18:33744537-33744559 CATTTAATTTATCTGGAACAAGG - Exonic
1156786843 18:40925126-40925148 CAGTAAATATATACTGAAAGGGG + Intergenic
1156930726 18:42639960-42639982 CTCTTAATAGATATTGAACCTGG - Intergenic
1157023271 18:43812682-43812704 CATTTAATATATATTTCAAAGGG + Intergenic
1157459492 18:47875141-47875163 CAGTTAACATAAATTGCACATGG - Intronic
1157567712 18:48690943-48690965 CAGTAAATAGGTATTGCACACGG + Intronic
1158521637 18:58176061-58176083 CACTTAGTGTATACTGAACATGG - Intronic
1158827787 18:61242920-61242942 TGGTTAATATTTATTGAGCAAGG + Intergenic
1160406519 18:78650257-78650279 CAGTCAATATACCCTGAACAAGG + Intergenic
1162108406 19:8385497-8385519 AAGTTAATATGGACTGAACAAGG + Intronic
1164043897 19:21517443-21517465 CTGTTACTATATAATGAGCAGGG + Intronic
1165943628 19:39428379-39428401 CAGCTAATATTTATTGAGCCAGG - Exonic
1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG + Intronic
1167906764 19:52667024-52667046 AAGTTAATATGGACTGAACAAGG + Intronic
925391565 2:3498464-3498486 CAGTTACTTTATTTTGAACAAGG + Exonic
925949375 2:8896626-8896648 AAGTTAATATGGACTGAACAAGG - Intronic
926626362 2:15093470-15093492 CATAAAATATATGTTGAACATGG - Intergenic
928684117 2:33730142-33730164 CAAATAATGTATACTGAACATGG - Intergenic
928849731 2:35730669-35730691 CAGATAATATAAAGTAAACATGG + Intergenic
933342404 2:81039503-81039525 AAGTTAATATGGACTGAACAAGG + Intergenic
933876474 2:86625188-86625210 CATTTAAAATAAAGTGAACAAGG + Intronic
934312700 2:91883357-91883379 GAGTTAATATATAATGTAAATGG + Intergenic
935549002 2:104431797-104431819 AAGTTAATGTAGCTTGAACAAGG + Intergenic
936765385 2:115841347-115841369 CATTTAATATATATTTATCAAGG + Intronic
937021475 2:118660772-118660794 AAATTAATATATATTCATCAAGG + Intergenic
938655733 2:133431285-133431307 CAGTTTAAATATATAAAACATGG - Intronic
939739216 2:145885505-145885527 ATGTTAATATAAATTGAATATGG - Intergenic
939865806 2:147471186-147471208 CAGTTAACAGAGATTGATCAGGG + Intergenic
940171835 2:150837004-150837026 TAATTAATATATTTTGAAGAGGG + Intergenic
940335140 2:152518926-152518948 CAGATAAAATATATTGACCCTGG + Intronic
941243774 2:163071980-163072002 AAGTTAATATGGATTGAACGAGG + Intergenic
941523518 2:166579029-166579051 CAGCTAATATCTATTGAACAGGG - Intergenic
941641648 2:167995412-167995434 CATTTAAAATATTTTAAACAGGG + Intronic
942563722 2:177246537-177246559 CATTTAATATATTTTGGAGATGG + Intronic
942984049 2:182118300-182118322 CAGTGTATATTTATTGAATATGG + Intronic
943134246 2:183891452-183891474 AAGTTAATATGGACTGAACAAGG + Intergenic
943669190 2:190643128-190643150 CAGTGAATATATGTTTAAAAGGG - Intergenic
943861891 2:192876649-192876671 CTGTTAATGGATATTGAAAATGG - Intergenic
944763184 2:202838652-202838674 CAATTATTATATAATGAAAAGGG - Intronic
945056311 2:205872452-205872474 CAGTTAATATTTTTGGACCATGG + Intergenic
945556201 2:211279396-211279418 CAGTTAAAATATATTGGCCTTGG - Intergenic
947095034 2:226556747-226556769 CATTTAATTTACTTTGAACATGG + Intergenic
947272303 2:228350370-228350392 GAGTTGATAAATATTAAACAAGG + Intergenic
948758096 2:240170818-240170840 AAGTTAAAATATATTAACCATGG - Intergenic
1172340913 20:34156779-34156801 GAGTTAATATGAACTGAACAAGG + Intergenic
1173619071 20:44422977-44422999 TAGTCAATATTTATTGAATAGGG - Intronic
1177629502 21:23708115-23708137 CAGCTAATAAATATTGAAGTTGG - Intergenic
1177721021 21:24907073-24907095 CAGCTAATAAATATTGAAGTTGG - Intergenic
1178231604 21:30791303-30791325 CAGTTGCTATAAATTGAAGAGGG + Intergenic
1180118076 21:45725361-45725383 AAGTTAAGATTTATTGGACAAGG - Intronic
1180539447 22:16429205-16429227 GAGTTAATATATAATGTAAATGG + Intergenic
1183131169 22:35838136-35838158 CAGTTAATAAAAATTGAATGAGG + Intronic
1184923833 22:47623961-47623983 CAGTGAATTTATATATAACACGG + Intergenic
952027767 3:29103841-29103863 TAGGCAATATATATTAAACACGG - Intergenic
952087683 3:29846319-29846341 GAGTTAATATATTTTGAATAAGG + Intronic
952095934 3:29954060-29954082 GAATAAATATATATTGAATAAGG - Intronic
952786299 3:37158848-37158870 CAGTAAATATTTGTTGAAAAGGG - Intronic
957254716 3:77822072-77822094 CAGTTACCATTTATTGAATAGGG + Intergenic
957466863 3:80604642-80604664 CAGATAACATGTATTAAACAGGG - Intergenic
957472575 3:80678398-80678420 CAGTAAATATATATTCATTAAGG - Intergenic
958601591 3:96301781-96301803 AAGTTAATATGAACTGAACAAGG + Intergenic
958681882 3:97341639-97341661 CACTTAATATATATTAAAATTGG - Intronic
959549624 3:107639786-107639808 CAGCTAATGTATATTGAAATTGG + Intronic
959635757 3:108566919-108566941 CAATAAATATTTATTGAATAAGG + Intronic
959827721 3:110819344-110819366 CAGTTATTTTATATTCAAAATGG - Intergenic
960179542 3:114559202-114559224 CAGTAAATAAATAGTAAACAAGG + Intronic
960506222 3:118497989-118498011 CAGTTTTTAAATATGGAACATGG + Intergenic
960648452 3:119918011-119918033 CAGTTATTTTATATTTAAAATGG - Intronic
963021616 3:140877464-140877486 AAGTTAATATGGACTGAACAAGG + Intergenic
963095951 3:141540808-141540830 CAACTAATATTTATTGAATATGG + Intronic
963697232 3:148576841-148576863 TAGTTAATATGGACTGAACAAGG + Intergenic
964028667 3:152109880-152109902 TATTTAATATATATTAAATACGG + Intergenic
964598059 3:158459453-158459475 CTGCTAATACATATTGAAGATGG + Intronic
965225028 3:165977418-165977440 CAGTTATTAGATATTCCACATGG - Intergenic
965946970 3:174254897-174254919 TAGTTAAAATATATATAACAAGG - Intronic
966084807 3:176057535-176057557 CAGTTAATAACTATAGAACAAGG - Intergenic
966562273 3:181336179-181336201 CAACTAATATATTTTGAACAAGG - Intergenic
966591235 3:181685081-181685103 CAATGAATATTTATTGATCACGG - Intergenic
967597435 3:191343359-191343381 CAGTGAATATTTATTGCACAAGG - Intronic
968687799 4:1973201-1973223 CAGTTAAGATAAATAAAACAGGG + Intronic
969986495 4:11217081-11217103 CAGATACTATAAATTGAAGATGG - Intergenic
970538068 4:17050085-17050107 CAGTTAAGATCTATTGTTCAGGG - Intergenic
970683621 4:18539725-18539747 CAGTAAATATTTATGAAACAAGG + Intergenic
970784629 4:19781162-19781184 AAGTTAATGAATATTGGACAGGG + Intergenic
971259257 4:25041544-25041566 CAGTTAATTTATAAGGAAAATGG - Intergenic
972692552 4:41413720-41413742 CAGTGAATATTTATTTAACATGG + Intronic
972784837 4:42316777-42316799 AAGTAAATATGGATTGAACAAGG + Intergenic
973263119 4:48184969-48184991 CAGTCAATATTTAATGAACATGG - Intronic
974744858 4:66058693-66058715 CAGGTAGTATAAATTGAATATGG + Intergenic
975251054 4:72178056-72178078 CAGATAAGATATTTTGAAAATGG + Intergenic
975251130 4:72179162-72179184 CAGGTAATCTATATTTACCAAGG - Intergenic
975778272 4:77813051-77813073 CAGTTAATTAATTTTGGACAGGG + Intronic
976255325 4:83094022-83094044 TACTTAATATATATTCTACAGGG + Exonic
976633647 4:87265668-87265690 CAATTAATATAAATTGTGCAGGG - Intergenic
976933906 4:90604390-90604412 CAGATAATAAATGGTGAACATGG - Intronic
977783605 4:101007163-101007185 CATTTAAAATAAACTGAACAGGG - Intergenic
977788681 4:101071912-101071934 CAATTAAAATATATAGTACAAGG + Intronic
978006530 4:103623959-103623981 CAGTTAACCTAGATTGAACAAGG - Intronic
978103608 4:104874063-104874085 CAGTAAATAAATATTTATCAAGG - Intergenic
978931169 4:114314050-114314072 AATTTAGTATATATTAAACATGG + Intergenic
978956562 4:114621270-114621292 CAGTAAATACTTATTGAAAAAGG - Intronic
979032516 4:115667725-115667747 CAGTTAACATGTATTATACAAGG + Intergenic
979090784 4:116479448-116479470 AAGTTTATAAATATTGACCAAGG - Intergenic
979863209 4:125720687-125720709 CAGATAATATATAATTAATAAGG - Intergenic
981195665 4:141917192-141917214 TAGTTAGTAAATGTTGAACAAGG - Intergenic
981276569 4:142905238-142905260 CAGCTAATATATACTGAATGGGG - Intergenic
981289744 4:143060471-143060493 TAGCAAATATAGATTGAACAGGG + Intergenic
981735722 4:147948369-147948391 CAGTTGGTAAAAATTGAACATGG - Intronic
982544941 4:156722715-156722737 CATTTAATACATATTGAAGGGGG - Intergenic
982544957 4:156722948-156722970 CAGTTAATGAATTTTGAGCAGGG - Intergenic
982670752 4:158317761-158317783 TAGTTAATATCTATTAAACATGG + Intronic
982701624 4:158664073-158664095 AAGTTAATATGGACTGAACAAGG + Intergenic
982861828 4:160461855-160461877 AAGCCACTATATATTGAACAGGG - Intergenic
983462498 4:168045970-168045992 CAGTTTATCTATATTCAGCAGGG + Intergenic
983670457 4:170231385-170231407 CATTTAATATATACAGAACTGGG + Intergenic
983902584 4:173151915-173151937 CATTAACTATAAATTGAACATGG - Intergenic
983913463 4:173265933-173265955 CATTTAATATATTATGAGCAAGG - Intronic
984376791 4:178941447-178941469 AAGATAAGATATATTTAACAAGG - Intergenic
987921539 5:24288471-24288493 CATTTAATATATACTAAACTAGG - Intergenic
988654613 5:33195244-33195266 CAGTTACTTTATATTGACAATGG + Intergenic
989288901 5:39738642-39738664 CAGGTAATAAATATAGGACAAGG - Intergenic
989329796 5:40243557-40243579 CTGTAAACATATATTGAACAAGG + Intergenic
990308069 5:54512235-54512257 CAGGTAATAAATATTGAATCAGG + Intergenic
990967071 5:61460491-61460513 CTGTTAACATACATAGAACATGG + Intronic
991332959 5:65512211-65512233 CAGTGAAGATACAGTGAACATGG + Intergenic
992085338 5:73273269-73273291 CACTTAATATATCTTGGTCATGG - Intergenic
992455678 5:76913513-76913535 AAGTTAATATGGACTGAACAAGG + Intronic
992825461 5:80545916-80545938 CCTTTAAAATATATTGAAAATGG - Intergenic
994518137 5:100795500-100795522 CAGATAATATGTAGTGAAAATGG + Intergenic
994786868 5:104177468-104177490 CCGTAAATCTATATTAAACATGG - Intergenic
996367431 5:122717903-122717925 CAATTAATAAATATTGAAGCAGG - Intergenic
996627100 5:125583629-125583651 CAAGAAATATATAGTGAACACGG + Intergenic
996702259 5:126462100-126462122 CAGTAAATATTTGTTGAAAAAGG + Intronic
997085670 5:130795300-130795322 CATTTAATATATCTAGACCATGG + Intergenic
998114721 5:139527388-139527410 AAGTTAATTTAGACTGAACAAGG + Intronic
998537485 5:142947847-142947869 TAATAAATATTTATTGAACATGG - Intronic
998620978 5:143793891-143793913 TAGTCAATATATATTCATCAAGG - Intergenic
1000658165 5:163907195-163907217 GAGTGAATATATTTTGCACATGG - Intergenic
1002772553 6:302210-302232 AACTTAATATATCTTGAAAATGG - Intronic
1004784496 6:18951777-18951799 CCTGTAATATATATTGGACAAGG + Intergenic
1004912275 6:20298343-20298365 CAGCTAACATATACTGAACAGGG - Intergenic
1005275922 6:24217803-24217825 AAGTTATTATATCTTGAGCAAGG - Intronic
1007602538 6:43091671-43091693 CATTTAATATTTTTTGACCATGG - Intronic
1008141768 6:47840131-47840153 CAGTTCATAACTATTGAAGATGG + Intergenic
1008772503 6:54995973-54995995 CACTTAATATAAATTGAGCTAGG - Intergenic
1009353747 6:62713931-62713953 GATTTTATTTATATTGAACAGGG + Intergenic
1009480032 6:64145432-64145454 CATTTTACATATAATGAACATGG - Intronic
1009681644 6:66900924-66900946 CAGTTAGCATATAATGAGCAGGG + Intergenic
1009722924 6:67498061-67498083 CAGTAAATATATATCTAACAAGG - Intergenic
1009920992 6:70061018-70061040 CAGTTTATGTAAATTGAACTTGG - Intronic
1010510321 6:76710220-76710242 TAGTTTGTATATATTGAGCATGG - Intergenic
1011636245 6:89376674-89376696 CACTTAATATAAAATAAACAAGG - Intronic
1011927070 6:92658971-92658993 CAATTTATTTATATTGCACAGGG + Intergenic
1012903159 6:105031431-105031453 CAGTTAATTTATATTAAATTTGG + Intronic
1013559317 6:111289096-111289118 AAGTTAATTTATACTAAACAAGG - Intergenic
1013693428 6:112672231-112672253 CATTTAATATATACTGAAATTGG - Intergenic
1013916551 6:115345874-115345896 CAGTAAATATATAATCAAGAAGG - Intergenic
1014542655 6:122695920-122695942 TTATTAATATATATTGTACATGG - Intronic
1015035336 6:128646387-128646409 CACTTAGTATATATTTACCATGG + Intergenic
1015837935 6:137442332-137442354 CAGTTATTATATAATGATAAAGG - Intergenic
1016100136 6:140089792-140089814 CAGTTAGTTAATATTGAACAGGG + Intergenic
1016315271 6:142778589-142778611 CATTTACTATATATTTACCATGG + Intronic
1016605473 6:145918277-145918299 CAGTTAAATTATATTAAATATGG + Intronic
1017561956 6:155637688-155637710 CAGTTAAAAGATACTGTACATGG + Intergenic
1017979051 6:159382793-159382815 CAGTTAACATGTTTTGAGCACGG + Intergenic
1020733164 7:11910193-11910215 CATGTAATATTTATTGAACTAGG + Intergenic
1022322587 7:29300904-29300926 CATTTAAAAAATATTGCACATGG - Intronic
1023407169 7:39846495-39846517 CAGTTAGTTTTTATTGAAAAGGG + Intergenic
1023436480 7:40145703-40145725 AAGTTAATATGGACTGAACAGGG - Intronic
1024167451 7:46748992-46749014 CAGATAATACATTTTAAACATGG - Intronic
1025637000 7:63330201-63330223 CAGTTAATAGTTATTCAACTTGG + Intergenic
1025645695 7:63417901-63417923 CAGTTAATAGTTATTCAACTTGG - Intergenic
1026028957 7:66772457-66772479 CTTTTAATATATATTTAGCATGG + Intronic
1027536327 7:79406712-79406734 CAATAAATATTTGTTGAACAAGG - Intronic
1028434213 7:90782671-90782693 CCATTAATATTTATTGAATAAGG + Intronic
1028557537 7:92139775-92139797 CAGTTAATCAATTTTTAACAAGG - Intronic
1030717961 7:112832919-112832941 AAGTAAATATATATAAAACAAGG - Intronic
1031768998 7:125818739-125818761 ATGTTAATATATATAAAACATGG - Intergenic
1037672229 8:21024874-21024896 CACTTAATATATATTTGATATGG - Intergenic
1040799029 8:51321106-51321128 GTGTTAAAAAATATTGAACATGG + Intronic
1041455276 8:58052462-58052484 CAATAAATATTTATTGAACCAGG + Intronic
1043007379 8:74836531-74836553 CAGTGAATATAAATGAAACAAGG + Intronic
1043310311 8:78850981-78851003 CTGTTAATATGTAATGTACATGG + Intergenic
1044417687 8:91954594-91954616 CAATTAATATTTATTGAGCGCGG + Intergenic
1045149480 8:99387699-99387721 GACTTAATAAATATTGAACCTGG - Intronic
1045217621 8:100163930-100163952 CAGTGATAATATATTGAACTTGG + Intronic
1046070989 8:109252910-109252932 AAGTTAATAAATAGTGATCAAGG - Intronic
1047055410 8:121159090-121159112 CACTTACTAGATATAGAACATGG - Intergenic
1048084468 8:131162007-131162029 CATTCAATATTTATTAAACATGG + Intergenic
1048218058 8:132514879-132514901 CATTTTAAATATCTTGAACATGG - Intergenic
1048631905 8:136252521-136252543 CAGTTCATATCTAGTGAACCAGG - Intergenic
1048901351 8:139040730-139040752 CAGTTACTATATGTTGCACGAGG - Intergenic
1051022598 9:12562721-12562743 GAGTTAATATAAGATGAACATGG + Intergenic
1051210249 9:14734474-14734496 CATTTGACAAATATTGAACATGG - Intergenic
1052265706 9:26570170-26570192 GAGTTAATAATTCTTGAACAAGG - Intergenic
1055676185 9:78664131-78664153 CAGCAAATATTTAGTGAACATGG + Intergenic
1056430971 9:86527196-86527218 CAGTTAATATGTATTCCAAAAGG - Intergenic
1056746028 9:89303810-89303832 CGGTTAAAATATTTTGAAAAAGG - Intergenic
1057560643 9:96125572-96125594 AAGCTAATATGTATTGAGCATGG - Intergenic
1058783235 9:108360535-108360557 CAGGTATTCTATCTTGAACAGGG + Intergenic
1059214091 9:112543861-112543883 CAGCAAATATAAATTGGACATGG - Intronic
1186083884 X:5964990-5965012 CATCTAATATACATAGAACACGG + Intronic
1187648133 X:21372257-21372279 CAATGAATATTTATTGAGCATGG - Intergenic
1188237669 X:27749871-27749893 CATTTAATATAAATTAAATAAGG + Intergenic
1188618520 X:32190765-32190787 CAGTTAAAACATCTTTAACACGG - Intronic
1188718545 X:33494352-33494374 CAGTCAATATATCTTTGACAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189830511 X:44968199-44968221 CAATTATTCCATATTGAACATGG + Intronic
1190637770 X:52453208-52453230 CAGTTTATATATAGTCAACTAGG - Intergenic
1190678880 X:52807255-52807277 CAGTTTATATATAGTCAACTAGG + Intergenic
1193120373 X:77817262-77817284 CAGTGAAAATTTACTGAACATGG + Intergenic
1193285239 X:79706275-79706297 TACTTAATATTTATTGAAAATGG + Intergenic
1193572265 X:83159227-83159249 AAGTTAATACATTTTGATCAAGG - Intergenic
1193883239 X:86952657-86952679 CAGTTGATATATGTTAAAGATGG + Intergenic
1194048999 X:89044731-89044753 CAGTTTTTATATTTTGAACCGGG + Intergenic
1194681043 X:96853043-96853065 CAGTTAAAAGATAATGAAAATGG + Intronic
1195492021 X:105481620-105481642 CAGTTAATTTATTTGGAAGAAGG + Intronic
1195731463 X:107972584-107972606 CAATAAATATTTATTGAATATGG - Intergenic
1197084743 X:122458487-122458509 CAGTTAATACATTGTGAAGAAGG + Intergenic
1197090978 X:122537258-122537280 CAGTGAAAATATTTTGCACAGGG + Intergenic
1197290271 X:124647882-124647904 CAGGTAATTTAGATTGAAAAGGG - Intronic
1198926646 X:141804235-141804257 CTGGCAAGATATATTGAACAAGG + Intergenic
1200722311 Y:6621545-6621567 CATTTAGAATAGATTGAACATGG + Intergenic
1201180645 Y:11340840-11340862 GAGTTAATATATAATGTAAATGG + Intergenic
1201271735 Y:12262352-12262374 AAGTTAATATGGACTGAACAAGG - Intergenic
1201272378 Y:12267560-12267582 CAGGTAATGAATATTGGACATGG + Intergenic
1202233602 Y:22682863-22682885 GAGGTAATATACATAGAACAAGG - Intergenic
1202309554 Y:23513295-23513317 GAGGTAATATACATAGAACAAGG + Intergenic
1202561247 Y:26157297-26157319 GAGGTAATATACATAGAACAAGG - Intergenic