ID: 1166869802

View in Genome Browser
Species Human (GRCh38)
Location 19:45864347-45864369
Sequence GTCGGACGGGCGGGCGCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166869786_1166869802 13 Left 1166869786 19:45864311-45864333 CCTCCCGCGGCGCTCGGGACAGC 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1166869802 19:45864347-45864369 GTCGGACGGGCGGGCGCCGGTGG 0: 1
1: 0
2: 4
3: 29
4: 278
1166869793_1166869802 -9 Left 1166869793 19:45864333-45864355 CCGTACCCCGGGCGGTCGGACGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1166869802 19:45864347-45864369 GTCGGACGGGCGGGCGCCGGTGG 0: 1
1: 0
2: 4
3: 29
4: 278
1166869785_1166869802 16 Left 1166869785 19:45864308-45864330 CCGCCTCCCGCGGCGCTCGGGAC 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1166869802 19:45864347-45864369 GTCGGACGGGCGGGCGCCGGTGG 0: 1
1: 0
2: 4
3: 29
4: 278
1166869787_1166869802 10 Left 1166869787 19:45864314-45864336 CCCGCGGCGCTCGGGACAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1166869802 19:45864347-45864369 GTCGGACGGGCGGGCGCCGGTGG 0: 1
1: 0
2: 4
3: 29
4: 278
1166869788_1166869802 9 Left 1166869788 19:45864315-45864337 CCGCGGCGCTCGGGACAGCCGTA 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1166869802 19:45864347-45864369 GTCGGACGGGCGGGCGCCGGTGG 0: 1
1: 0
2: 4
3: 29
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166869802 Original CRISPR GTCGGACGGGCGGGCGCCGG TGG Exonic