ID: 1166871634

View in Genome Browser
Species Human (GRCh38)
Location 19:45874368-45874390
Sequence GCTTACTTGCCCTGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166871626_1166871634 22 Left 1166871626 19:45874323-45874345 CCTTGATTGTGTAGGTTTTTGTG No data
Right 1166871634 19:45874368-45874390 GCTTACTTGCCCTGGGTGGCTGG No data
1166871625_1166871634 23 Left 1166871625 19:45874322-45874344 CCCTTGATTGTGTAGGTTTTTGT No data
Right 1166871634 19:45874368-45874390 GCTTACTTGCCCTGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166871634 Original CRISPR GCTTACTTGCCCTGGGTGGC TGG Intergenic
No off target data available for this crispr