ID: 1166872412

View in Genome Browser
Species Human (GRCh38)
Location 19:45878930-45878952
Sequence CAGAGTAGACAGAGAGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166872412_1166872414 -7 Left 1166872412 19:45878930-45878952 CCACCGTCTCTCTGTCTACTCTG No data
Right 1166872414 19:45878946-45878968 TACTCTGAGCCTCTTAGTCTTGG No data
1166872412_1166872418 9 Left 1166872412 19:45878930-45878952 CCACCGTCTCTCTGTCTACTCTG No data
Right 1166872418 19:45878962-45878984 GTCTTGGGCACTATCTCTGTGGG No data
1166872412_1166872415 -6 Left 1166872412 19:45878930-45878952 CCACCGTCTCTCTGTCTACTCTG No data
Right 1166872415 19:45878947-45878969 ACTCTGAGCCTCTTAGTCTTGGG No data
1166872412_1166872417 8 Left 1166872412 19:45878930-45878952 CCACCGTCTCTCTGTCTACTCTG No data
Right 1166872417 19:45878961-45878983 AGTCTTGGGCACTATCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166872412 Original CRISPR CAGAGTAGACAGAGAGACGG TGG (reversed) Intergenic
No off target data available for this crispr