ID: 1166873849

View in Genome Browser
Species Human (GRCh38)
Location 19:45885709-45885731
Sequence GCGACCTGCCCAAGATGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166873849_1166873851 -6 Left 1166873849 19:45885709-45885731 CCACGGCATCTTGGGCAGGTCGC 0: 1
1: 0
2: 1
3: 9
4: 77
Right 1166873851 19:45885726-45885748 GGTCGCACAGGTAGCACCACTGG 0: 1
1: 0
2: 0
3: 0
4: 51
1166873849_1166873856 22 Left 1166873849 19:45885709-45885731 CCACGGCATCTTGGGCAGGTCGC 0: 1
1: 0
2: 1
3: 9
4: 77
Right 1166873856 19:45885754-45885776 GGACGCCTGCACAGACGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 115
1166873849_1166873853 0 Left 1166873849 19:45885709-45885731 CCACGGCATCTTGGGCAGGTCGC 0: 1
1: 0
2: 1
3: 9
4: 77
Right 1166873853 19:45885732-45885754 ACAGGTAGCACCACTGGCGGCGG 0: 1
1: 0
2: 0
3: 13
4: 88
1166873849_1166873852 -3 Left 1166873849 19:45885709-45885731 CCACGGCATCTTGGGCAGGTCGC 0: 1
1: 0
2: 1
3: 9
4: 77
Right 1166873852 19:45885729-45885751 CGCACAGGTAGCACCACTGGCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1166873849_1166873854 1 Left 1166873849 19:45885709-45885731 CCACGGCATCTTGGGCAGGTCGC 0: 1
1: 0
2: 1
3: 9
4: 77
Right 1166873854 19:45885733-45885755 CAGGTAGCACCACTGGCGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166873849 Original CRISPR GCGACCTGCCCAAGATGCCG TGG (reversed) Exonic
901711770 1:11121267-11121289 ACGACCTGGCCAAGCTGCTGTGG - Exonic
902695425 1:18137514-18137536 GTCACTTGCCCAAGATCCCGTGG + Intronic
905452039 1:38063137-38063159 GCAGCCTGCCCATGATGCTGAGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907341496 1:53738999-53739021 GCGCCATCCCCAAGCTGCCGGGG + Intergenic
913158172 1:116120788-116120810 CCTGCCTTCCCAAGATGCCGGGG - Intronic
918127268 1:181595634-181595656 GCCACCTGCCCAAGCTGGGGAGG + Intronic
1069838055 10:71321580-71321602 GCGACAGGCCCAGGATGCCAGGG + Intronic
1073691881 10:105818698-105818720 GGGACCTGCCCCAGATGTAGAGG + Intergenic
1074116627 10:110461204-110461226 GCCACCTGCCCAAGATGCCTGGG - Intergenic
1074568628 10:114604206-114604228 ACAACCTGCCCAAGAAGCAGAGG + Intronic
1077595921 11:3531514-3531536 GCCACATGCCCATGATGCCTGGG + Intergenic
1078668734 11:13346682-13346704 GGGACTTGCGCAAGATGCCTTGG - Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1080584058 11:33665870-33665892 GGCACCTTCCCAAGATGCTGAGG + Intronic
1084251821 11:67905509-67905531 GCCACGTGCCCATGATGCCTGGG + Intergenic
1084821017 11:71690519-71690541 GCCACATGCCCATGATGCCTGGG - Intergenic
1085510035 11:77083493-77083515 GTGACCTGCCCAAGCTCCCCTGG - Intronic
1089150575 11:116360636-116360658 GTGACCAGCCCAAGCTGCCAGGG - Intergenic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092422091 12:8340300-8340322 GCCACATGCCCATGATGCCTGGG + Intergenic
1100461192 12:94800838-94800860 GCGACTTGCCCGAGATCCCATGG - Intergenic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1104271339 12:127285129-127285151 GCATCCTGCCCAAGAAGCCTTGG - Intergenic
1105306715 13:19174097-19174119 GAGACCTGGCCAAGGTGCAGCGG - Exonic
1106776906 13:33017202-33017224 GCGGGCTGCCCCGGATGCCGGGG - Exonic
1108241772 13:48471900-48471922 GAGACCTGCCCAAGGTGAGGTGG - Intronic
1113782950 13:112986956-112986978 GCGTCCTGCCCAAGGCTCCGGGG + Intronic
1119743288 14:77027721-77027743 GCGACCTGCCCCGCATGCCCTGG - Exonic
1121116029 14:91343395-91343417 GCCTCCTGCCCAAGGTGCCCTGG + Intronic
1122264653 14:100540958-100540980 GCGTCCTTCCAAAGATGACGGGG + Intronic
1122935317 14:104953162-104953184 GGCACCTGCCCAAGGTGCAGAGG - Exonic
1124658808 15:31528650-31528672 GAGACCTGCCCAAGGAGCTGTGG - Intronic
1131119569 15:89814168-89814190 ACAACCCGGCCAAGATGCCGGGG - Intronic
1133101124 16:3480664-3480686 GTGATCTGCCCAAAATGCCGGGG - Intronic
1133376198 16:5289272-5289294 GCCACATGCCCATGATGCCTGGG - Intergenic
1134763926 16:16739172-16739194 GCAACCTGCCCAAGATCCCCAGG - Intergenic
1134982128 16:18619991-18620013 GCAACCTGCCCAAGATCCCCAGG + Intergenic
1142156348 16:88534342-88534364 TCGACCTGAGCAAGAAGCCGCGG + Exonic
1142494947 17:301159-301181 GCTACGTGCCCACGATGCTGGGG - Intronic
1144742307 17:17590911-17590933 GCGACCGGCCCCAGAAGCTGGGG - Intronic
1150229498 17:63542325-63542347 GCGACCTGCACAAGATCCAGCGG + Exonic
1152021731 17:77783194-77783216 GGGAGCTGCCCAAGATGACTGGG - Intergenic
1154102610 18:11489919-11489941 GTCACCTGCCCAAGATGCCTAGG + Intergenic
1159507367 18:69354632-69354654 TGGACCTGCCCCAGATGCCCTGG + Intergenic
1160554059 18:79714777-79714799 GCGGCCTGCCCAGGGTGCCACGG + Exonic
1161261442 19:3340034-3340056 GCCATCTGCCCAAGGTCCCGTGG + Intergenic
1161618050 19:5283186-5283208 GGGGCCTTCCCAGGATGCCGTGG - Intronic
1162125781 19:8498878-8498900 GCGTGCTTCCCAAGAGGCCGCGG - Exonic
1165040428 19:33064583-33064605 GCCACCTGCCCGGGACGCCGGGG + Intronic
1166343971 19:42153982-42154004 ACAGCCTGCCCAAGGTGCCGGGG - Intronic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG + Intronic
930999792 2:57765853-57765875 GCAACCTGCCCATGATGCCTGGG - Intergenic
932401412 2:71483209-71483231 GAGACGGGCCCAAGATGCCCTGG - Intronic
938298267 2:130192065-130192087 GAGACCTGGCCAAGGTGCAGCGG - Exonic
938458500 2:131482592-131482614 GAGACCTGGCCAAGGTGCAGCGG + Exonic
947489966 2:230585173-230585195 TCATCCTGCCCAGGATGCCGTGG + Intergenic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1173440381 20:43070201-43070223 GTGACCAGCCCCAGATGCTGTGG + Intronic
1175910067 20:62401019-62401041 GCAACTTGCCCAAGATGACATGG + Intronic
1180751978 22:18130883-18130905 GAGACCTGGCCAAGGTGCAGCGG + Exonic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1182532057 22:30968582-30968604 GCGGCCTGCCCGAGGTGCTGTGG - Intergenic
956675525 3:71728719-71728741 GCACCCTGCCCAAGTTGCCTTGG - Intronic
957065894 3:75521915-75521937 GCCACATGCCCATGATGCCTGGG + Intergenic
961287258 3:125816152-125816174 GCCACATGCCCATGATGCCTGGG - Intergenic
961899836 3:130199823-130199845 GCCACATGCCCATGATGCCTGGG + Intergenic
969213575 4:5706805-5706827 GGGACGTGCTCAAGATGCCAAGG + Intronic
969398644 4:6939112-6939134 GCGACTTGCCCCAGATGCAGAGG - Intronic
986385036 5:7224880-7224902 GAGTCCTGACAAAGATGCCGGGG - Intergenic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1013360970 6:109393657-109393679 CCGACCTCCCCGAGAGGCCGTGG - Intronic
1019606792 7:1913999-1914021 GAGACCTGCCCACGCTGCCCTGG - Intronic
1024579351 7:50789395-50789417 GCTACCTTCCCAACAAGCCGTGG + Intronic
1029000416 7:97148419-97148441 CCCAGCTGCCCAGGATGCCGAGG + Intronic
1029069777 7:97885980-97886002 GCCACATGCCCATGATGCCTGGG + Intergenic
1034946859 7:155267772-155267794 CAGACCTGCCCGAGATGCGGTGG - Intergenic
1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG + Intergenic
1036248776 8:7143707-7143729 GCCACATGCCCATGATGCCTGGG - Intergenic
1037579144 8:20234504-20234526 GCGACCTGCCCAACAGCCTGGGG + Intergenic
1185765606 X:2723588-2723610 GTCACCTGCCCACGATGCCCTGG + Intronic
1196602043 X:117612788-117612810 GGGAACTGACCAAGATGCCTAGG + Intergenic