ID: 1166873968

View in Genome Browser
Species Human (GRCh38)
Location 19:45886139-45886161
Sequence TGCCCCAGAGGCCGCTTCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166873955_1166873968 30 Left 1166873955 19:45886086-45886108 CCGCTCTCGCCGCCGCCGCTGCA 0: 1
1: 2
2: 10
3: 81
4: 792
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873962_1166873968 -3 Left 1166873962 19:45886119-45886141 CCGCCTCCACCTCCTTCTTCTGC 0: 1
1: 9
2: 456
3: 2217
4: 8848
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873960_1166873968 3 Left 1166873960 19:45886113-45886135 CCGCCGCCGCCTCCACCTCCTTC 0: 1
1: 4
2: 79
3: 967
4: 7226
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873961_1166873968 0 Left 1166873961 19:45886116-45886138 CCGCCGCCTCCACCTCCTTCTTC 0: 1
1: 6
2: 370
3: 1868
4: 8554
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873964_1166873968 -9 Left 1166873964 19:45886125-45886147 CCACCTCCTTCTTCTGCCCCAGA 0: 1
1: 0
2: 7
3: 107
4: 846
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873958_1166873968 18 Left 1166873958 19:45886098-45886120 CCGCCGCTGCAACGGCCGCCGCC 0: 1
1: 0
2: 15
3: 221
4: 1913
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873963_1166873968 -6 Left 1166873963 19:45886122-45886144 CCTCCACCTCCTTCTTCTGCCCC 0: 1
1: 0
2: 21
3: 440
4: 3506
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873957_1166873968 21 Left 1166873957 19:45886095-45886117 CCGCCGCCGCTGCAACGGCCGCC 0: 1
1: 0
2: 10
3: 177
4: 1920
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
1166873959_1166873968 15 Left 1166873959 19:45886101-45886123 CCGCTGCAACGGCCGCCGCCGCC 0: 1
1: 0
2: 21
3: 354
4: 2104
Right 1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166873968 Original CRISPR TGCCCCAGAGGCCGCTTCGC AGG Exonic