ID: 1166874792

View in Genome Browser
Species Human (GRCh38)
Location 19:45890822-45890844
Sequence GTGATCTCCACCTTGGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 134}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166874779_1166874792 12 Left 1166874779 19:45890787-45890809 CCACCACAGCAGCCACCACGGAC 0: 1
1: 0
2: 3
3: 32
4: 369
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874773_1166874792 27 Left 1166874773 19:45890772-45890794 CCACCACTGCCCCGTCCACCACA 0: 1
1: 0
2: 8
3: 59
4: 668
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874780_1166874792 9 Left 1166874780 19:45890790-45890812 CCACAGCAGCCACCACGGACACG 0: 1
1: 0
2: 0
3: 15
4: 210
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874784_1166874792 0 Left 1166874784 19:45890799-45890821 CCACCACGGACACGGGCTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874777_1166874792 16 Left 1166874777 19:45890783-45890805 CCGTCCACCACAGCAGCCACCAC 0: 1
1: 1
2: 17
3: 208
4: 891
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874787_1166874792 -3 Left 1166874787 19:45890802-45890824 CCACGGACACGGGCTCTGGGGTG 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874776_1166874792 17 Left 1166874776 19:45890782-45890804 CCCGTCCACCACAGCAGCCACCA 0: 1
1: 0
2: 9
3: 78
4: 622
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874774_1166874792 24 Left 1166874774 19:45890775-45890797 CCACTGCCCCGTCCACCACAGCA 0: 1
1: 0
2: 9
3: 141
4: 814
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134
1166874775_1166874792 18 Left 1166874775 19:45890781-45890803 CCCCGTCCACCACAGCAGCCACC 0: 1
1: 0
2: 10
3: 205
4: 684
Right 1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG 0: 1
1: 1
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166874792 Original CRISPR GTGATCTCCACCTTGGGGGC CGG Exonic
905212433 1:36383940-36383962 GTGAGCTCAGCCTTGGGGGTGGG - Intronic
905934490 1:41812794-41812816 GTGCACTCCTCCTTGGGGGTGGG + Intronic
906318992 1:44805255-44805277 CAGATCTCCACCCTGGGAGCAGG - Exonic
910949946 1:92635265-92635287 GTAGACTCCACCTCGGGGGCAGG - Intronic
912416933 1:109515234-109515256 ATGATCACCACTTTGGTGGCAGG - Intergenic
913544201 1:119851298-119851320 TTGATCCCCACCTTGGGAGAAGG - Intergenic
917846250 1:179022983-179023005 GTGATCACAACCATGAGGGCAGG + Intergenic
918216244 1:182393866-182393888 GTCATCCCCACCTCAGGGGCTGG - Intergenic
921075826 1:211699362-211699384 GTGATCTCCGCCTTGTGCTCTGG + Intergenic
923029473 1:230236045-230236067 GTGATCACCACGCTGGTGGCCGG - Exonic
923911831 1:238456181-238456203 GTGATCTGCAACTTGAGAGCAGG + Intergenic
1063130528 10:3173315-3173337 GTGAGCTGAGCCTTGGGGGCGGG + Intergenic
1063130571 10:3173446-3173468 GTGAGCTGGGCCTTGGGGGCGGG + Intergenic
1064096393 10:12427458-12427480 TTGTCCTCCAGCTTGGGGGCCGG - Intronic
1070287446 10:75094283-75094305 GTGATATCTGCCTTGGGTGCAGG - Intergenic
1071045084 10:81363543-81363565 GTGAGCTCCAAATTGGTGGCTGG - Intergenic
1072515075 10:96173305-96173327 GTGATCTCCACAGAGGGTGCTGG - Intronic
1075520538 10:123141141-123141163 GTGATCTGCGCCCTGGGGGAGGG + Intergenic
1076142384 10:128089948-128089970 GTGCTGACCTCCTTGGGGGCAGG - Intergenic
1076762943 10:132614709-132614731 GAGGCCACCACCTTGGGGGCAGG - Intronic
1077111942 11:865832-865854 GAGACCCCCACCCTGGGGGCTGG + Intronic
1077439272 11:2560467-2560489 GTGACGTCCATCCTGGGGGCGGG + Intronic
1077443745 11:2580732-2580754 CTGACCCCCACCTTGGGCGCTGG + Intronic
1084396874 11:68916933-68916955 GTGATTTCTACTTTGGGGGATGG - Intronic
1088170723 11:106993211-106993233 GTGATCTCCACTTTGTGACCTGG - Intronic
1089147251 11:116338210-116338232 GGGAACTCCACTTTGGGGGAAGG + Intergenic
1089838750 11:121395095-121395117 TTGCTCTCCTCCTTAGGGGCAGG + Intergenic
1090245408 11:125212732-125212754 AGGACCTCCAGCTTGGGGGCTGG - Intronic
1090473057 11:126997023-126997045 CTGATCTCCACCTCGGAGACAGG - Intronic
1091331069 11:134731258-134731280 GAGATCTCCTCCCTGGGGTCTGG + Intergenic
1105041849 12:132967091-132967113 GTGAGCCCCACCTTGAGGCCAGG + Intergenic
1108844361 13:54659982-54660004 GTGATCCCCAGCTTGAAGGCGGG + Intergenic
1112571974 13:100601448-100601470 GAGATGTCACCCTTGGGGGCGGG - Intergenic
1113627247 13:111856409-111856431 TTGGTCTCCACCTTGGTGGTGGG + Intergenic
1114212014 14:20623530-20623552 GTGATTCCCACTTTGGGTGCGGG + Intergenic
1118133196 14:62991009-62991031 GTAATCCCCACATTGGGGGAGGG - Intronic
1121027583 14:90627879-90627901 GTCATCTCCAGCTTAGGTGCCGG - Intronic
1127952721 15:63825217-63825239 GTAACCTCCACCTTGGGTTCAGG - Intronic
1128801229 15:70498357-70498379 GTCAACTCCCCCTTGGGAGCTGG - Intergenic
1129387688 15:75204878-75204900 GCCATCTGCAGCTTGGGGGCTGG + Intronic
1134598271 16:15513006-15513028 GTGGGCTCCATCTTGGGGGCGGG + Intronic
1136997671 16:35201900-35201922 GAGAACTCCAGCTTGGGGGGAGG - Intergenic
1137983708 16:53090763-53090785 ATGTTCTCCCACTTGGGGGCAGG + Intronic
1139040215 16:62991203-62991225 GGGATCACCACCCTGTGGGCTGG - Intergenic
1141207402 16:81943496-81943518 GTGATCTCCACTGTTGGAGCTGG - Intronic
1142173149 16:88633336-88633358 GTGAGCTGCACCATGAGGGCTGG + Intergenic
1144112161 17:12046185-12046207 GTTATCTCCACCTTTGGTTCAGG - Intronic
1144864102 17:18323843-18323865 GTGAGGACCACCTTGGGGGCTGG + Intergenic
1145367871 17:22279324-22279346 GTGAGCCCCACCTGCGGGGCAGG + Intergenic
1147376125 17:40023384-40023406 ATGATCACCACCCTGGGGGAGGG + Exonic
1148076037 17:44935622-44935644 CTGATCTCCACTATGGGTGCGGG + Intronic
1148675068 17:49440234-49440256 GAGATCTCCACCTTCCGGGGTGG + Intronic
1148906145 17:50913493-50913515 GTGATCTCCAGGCTGGGAGCTGG - Intergenic
1150213467 17:63454162-63454184 GTGCTGTCCCCCTTGGGAGCAGG - Intergenic
1151511897 17:74565983-74566005 GTGATTCTCACCTGGGGGGCAGG + Intergenic
1151619688 17:75238242-75238264 GTGATCTCCACCTTGAAGCCAGG - Exonic
1152890123 17:82875637-82875659 GAGATCTCTTCCTCGGGGGCAGG + Intronic
1158732190 18:60036228-60036250 GAAATCTTTACCTTGGGGGCGGG + Intergenic
1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG + Intergenic
1164429929 19:28178122-28178144 GTAGGCTCCACCTCGGGGGCAGG + Intergenic
1165767371 19:38359865-38359887 GTGTTCTCCAGCACGGGGGCAGG - Intronic
1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG + Exonic
1167766788 19:51488659-51488681 GTGGGCTCCTCCCTGGGGGCAGG + Intronic
1167903728 19:52641077-52641099 GTTATCGTCATCTTGGGGGCGGG - Intronic
926425561 2:12735996-12736018 GTGAACTCCAGCTTGGGGGAAGG + Intronic
930011114 2:46939565-46939587 GTGCTCTACAACCTGGGGGCAGG + Intronic
931677651 2:64713733-64713755 GTGATTTCCAGCGTGGGTGCAGG - Intronic
933566790 2:83960284-83960306 GTAATTTCCACCTAAGGGGCCGG + Intergenic
935670295 2:105550233-105550255 TTGTTCTTAACCTTGGGGGCAGG - Intergenic
936156131 2:110048458-110048480 GTCAGCTCCACCTTGGGGGAAGG + Intergenic
936188556 2:110322970-110322992 GTCAGCTCCACCTTGGGGGAAGG - Intergenic
937099030 2:119254491-119254513 GTGATCTCTACTTTGTGGGGTGG + Intronic
937118173 2:119424375-119424397 GAGAGCTCTTCCTTGGGGGCAGG - Intergenic
937636954 2:124166890-124166912 GTGGGCTCCATCTTGGGGGAAGG - Intronic
938240300 2:129738088-129738110 GTGGGCTCCACCTTGGGATCTGG - Intergenic
945677761 2:212876237-212876259 GTAGACTCCACCTTTGGGGCAGG + Intergenic
946402772 2:219477217-219477239 CTCATCTCTACCTTGGGGCCAGG - Intronic
1169021409 20:2333920-2333942 GTCCTCTCCACATTTGGGGCAGG + Intronic
1171733211 20:28737189-28737211 GTAGGCTCCACCTTTGGGGCAGG + Intergenic
1173025146 20:39300555-39300577 GTGCCCTCCTCCTTGGAGGCTGG + Intergenic
1181544996 22:23597730-23597752 CTGAGCTCCACCTTGGGTCCTGG - Intergenic
1181718338 22:24752374-24752396 GTGATCTCCATCTGGTGGGCGGG - Intronic
1181815315 22:25432152-25432174 CTGAGCTCCACCTTGGGTCCTGG + Intergenic
1182117631 22:27766273-27766295 CTGGTCTCCACCTTGGGGGTTGG + Intronic
1183660296 22:39216131-39216153 GTCATCTCCAGGTTGGGGGGGGG - Intergenic
1184943833 22:47787097-47787119 GTGCTCTGCAGTTTGGGGGCAGG + Intergenic
952338288 3:32423820-32423842 GTGACCTGCACCTGGGGGGCTGG - Intronic
953662510 3:44901427-44901449 GAGGTGTCCACTTTGGGGGCTGG + Intronic
955324571 3:58000292-58000314 CTGATCTCCACCTTGGCTGCTGG + Intergenic
956016820 3:64892657-64892679 GTTATATGCCCCTTGGGGGCTGG - Intergenic
961742105 3:129039499-129039521 CTGATCTCCTCCATGAGGGCAGG - Intronic
962754843 3:138459285-138459307 CTGATCCCCACCCTGGGGGCTGG - Intronic
968477028 4:816065-816087 GTTATATTCACCTTGGAGGCTGG + Intronic
968917319 4:3502235-3502257 GAGATGTCCACCTCCGGGGCTGG + Intergenic
969467928 4:7368610-7368632 GTGGTCCCCTCCATGGGGGCAGG - Intronic
969851734 4:9962973-9962995 GTGGCATCCACCTTGGGGTCTGG - Intronic
971292327 4:25355424-25355446 GTGGTGTCCACCATGGGGGTGGG + Intronic
979469461 4:121077373-121077395 GACATCTCTACATTGGGGGCTGG + Intergenic
985763910 5:1766623-1766645 TTCATCTCCACCTTGGAGGCGGG - Intergenic
985818094 5:2141662-2141684 GGGATCTCCACCTTTTGGGAAGG + Intergenic
986909153 5:12532803-12532825 GTGTGCTCTATCTTGGGGGCTGG - Intergenic
988489649 5:31695647-31695669 GTGCACACCACCTTAGGGGCTGG + Intronic
990896583 5:60706386-60706408 GAAATCCCCACCTTGGGGGATGG + Intergenic
997245944 5:132349364-132349386 GTAGTCTCCACCTCTGGGGCAGG - Intergenic
999126922 5:149252718-149252740 GTGGTCTCCAGCTTGGGTGAGGG - Intronic
999479044 5:151928268-151928290 GTCATGTGAACCTTGGGGGCAGG + Intergenic
999681394 5:154063529-154063551 GTGATTGCCACCTTGGTGCCAGG - Intronic
1001009205 5:168083038-168083060 GTAGACTCCACCTCGGGGGCAGG - Intronic
1001834206 5:174817279-174817301 GTGACCTCTTCCTTGGGGGTTGG - Intergenic
1002171632 5:177377992-177378014 GTGATCACCTCCCTGGGGGTTGG - Intergenic
1003725763 6:8761308-8761330 GTGATCTCGGGTTTGGGGGCTGG + Intergenic
1006513663 6:34534557-34534579 GCAATCTGCACCTTGGGGCCTGG + Exonic
1006640172 6:35485693-35485715 CAGAGCCCCACCTTGGGGGCAGG - Intronic
1006814095 6:36839295-36839317 GTGATCTCCACCTTGGTGGCCGG + Exonic
1007702966 6:43775068-43775090 GTGCTCTCCACCTCTGGGGAGGG + Intronic
1012977807 6:105798816-105798838 GTGCTATCCACCCTGGGGGGTGG - Intergenic
1015200784 6:130577765-130577787 ATGATTTCCACCCTGGTGGCTGG - Intergenic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019694652 7:2438489-2438511 GTGATGGCATCCTTGGGGGCTGG - Intergenic
1025115700 7:56256145-56256167 GTGGTTTCCACCTTGGGCACTGG - Intergenic
1028197176 7:87920538-87920560 GTGTTCTCCTTCTTGGGAGCAGG - Intergenic
1029093996 7:98070733-98070755 GTCATCTCAACCTTGGTGGCAGG - Intergenic
1029312266 7:99678272-99678294 GTGACCTCCACGGTGGGGCCAGG + Intronic
1029314416 7:99698361-99698383 GTGACCTCCACTGTGGGGCCAGG + Intronic
1029320055 7:99750857-99750879 GTGACCTCCACTGTGGGGCCAGG + Intergenic
1032017806 7:128390976-128390998 GTGATCTCCACCTTAAGGTATGG - Intergenic
1033099641 7:138459898-138459920 GTTAGCTCCTCCTAGGGGGCGGG - Intergenic
1033497107 7:141910124-141910146 GTGACCTCCACCCTGGGTCCAGG - Intronic
1033597882 7:142869398-142869420 GTAATCTCCACAATGGGGGAAGG - Intronic
1035792783 8:2323175-2323197 GTAGGCTCCACCTTGGGGGCCGG - Intergenic
1035800021 8:2398530-2398552 GTAGGCTCCACCTTGGGGGCCGG + Intergenic
1037177838 8:15967647-15967669 TTGTTCTCCATCTTCGGGGCTGG + Intergenic
1037584487 8:20267292-20267314 CTGGTCTCCATGTTGGGGGCTGG + Intronic
1039570167 8:38580235-38580257 GTGAACTCTACATTGAGGGCAGG + Intergenic
1040650968 8:49448446-49448468 GTAGGCTCCACCTCGGGGGCAGG + Intergenic
1041480651 8:58316384-58316406 GTGATGTACACCTTGAGGGTAGG - Intergenic
1043504417 8:80888149-80888171 AGGATCTCCACTCTGGGGGCAGG + Intergenic
1045395014 8:101751792-101751814 CTGACCCCCACCTTTGGGGCAGG - Intronic
1047331897 8:123896969-123896991 GTGTTCTCCATCTTGGAGGTGGG + Intronic
1049576844 8:143393552-143393574 GTGAGCTCCACCTTGGCCCCAGG - Intergenic
1050096244 9:2069875-2069897 ATGATCTCCACCTGGGTGACAGG - Intronic
1051468083 9:17403695-17403717 TTGATCTCAACCTTGGAGGTAGG + Intronic
1053450418 9:38189386-38189408 CTGGTCTGCACCTTGGGGGTTGG - Intergenic
1053575538 9:39355498-39355520 GGGATCCCCAGCTTGGGGGGTGG + Intergenic
1054097098 9:60914185-60914207 GGGATCCCCAGCTTGGGGGGTGG + Intergenic
1054118505 9:61189814-61189836 GGGATCCCCAGCTTGGGGGGTGG + Intergenic
1055987245 9:82063862-82063884 GGGATCCCCAGCTTGGGGGGTGG - Intergenic
1057025157 9:91729562-91729584 GAGATCTCCTCCTGGGGTGCAGG - Intronic
1061108661 9:128552065-128552087 GTGATCTCACCCTTTGGGACTGG + Intergenic
1062573093 9:137194502-137194524 GTGTTCTCAGCCGTGGGGGCTGG - Intronic
1192331346 X:70177761-70177783 GTGATCTCCACCCTCTGGGAAGG + Intronic
1199783178 X:151082036-151082058 CTGAGCTCCTCCATGGGGGCGGG - Intergenic