ID: 1166874977

View in Genome Browser
Species Human (GRCh38)
Location 19:45891421-45891443
Sequence GGGGGTGAGAAGGATAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166874977_1166874992 16 Left 1166874977 19:45891421-45891443 CCAGAACTATCCTTCTCACCCCC 0: 1
1: 0
2: 1
3: 20
4: 244
Right 1166874992 19:45891460-45891482 ACAGTCTTGGTCTGTCACCCAGG 0: 18
1: 1409
2: 14044
3: 51761
4: 108078
1166874977_1166874993 30 Left 1166874977 19:45891421-45891443 CCAGAACTATCCTTCTCACCCCC 0: 1
1: 0
2: 1
3: 20
4: 244
Right 1166874993 19:45891474-45891496 TCACCCAGGCTGTAGTGCAGTGG 0: 984
1: 88556
2: 177808
3: 206875
4: 177759
1166874977_1166874986 3 Left 1166874977 19:45891421-45891443 CCAGAACTATCCTTCTCACCCCC 0: 1
1: 0
2: 1
3: 20
4: 244
Right 1166874986 19:45891447-45891469 CCCCAGCCCCAAGACAGTCTTGG 0: 1
1: 0
2: 2
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166874977 Original CRISPR GGGGGTGAGAAGGATAGTTC TGG (reversed) Intronic
900267902 1:1768834-1768856 GGTGGGCAGAAGGAAAGTTCAGG + Intronic
900285891 1:1900120-1900142 GGGGGTGAGAAGGACTGTCTCGG + Intergenic
900497238 1:2981386-2981408 GGGGGATAGAAGGAAACTTCTGG - Intergenic
901236933 1:7672202-7672224 GGGGGTGAGGAGGAAAGGTACGG + Intronic
902499176 1:16896942-16896964 GGGGGTGGGAAGGATGGGTCTGG - Intronic
904359343 1:29961822-29961844 TGGGGTGAGAAGGAGTGTGCTGG - Intergenic
905334365 1:37234044-37234066 GAGGGTGAGAAGGCTAATTTAGG - Intergenic
905631559 1:39521777-39521799 GGGGGAGAGAGGGAGACTTCTGG - Intronic
905666195 1:39764394-39764416 GGGGGAGAGAGGGAGACTTCTGG + Intronic
905879182 1:41452407-41452429 GTTGGTGAGCAGGACAGTTCGGG - Intergenic
906295983 1:44649479-44649501 GAGGGTGAGGAGTTTAGTTCTGG + Intronic
908324082 1:63006368-63006390 GGAGGTGAGTTGGACAGTTCTGG - Intergenic
909070093 1:70983796-70983818 GGAAGTGACAAAGATAGTTCAGG - Intronic
911826513 1:102493067-102493089 GGGGATGAGAAGGAGAGGTCAGG + Intergenic
912114290 1:106385416-106385438 TGTGGAGAGAAAGATAGTTCTGG + Intergenic
912604365 1:110973308-110973330 GGGAGTGGGAAGGAGAGTGCAGG + Intergenic
914001514 1:143698648-143698670 GGGGGTGGGAAGCATGGGTCGGG + Intergenic
914005406 1:143728597-143728619 GGGGGTGGGAAGGATGGGTCGGG + Intergenic
914096780 1:144550959-144550981 GGGGGTGGGAAGGATGGGTCGGG + Intergenic
914097886 1:144559856-144559878 GGGGGTGGGAAGGATGGGTCGGG + Intergenic
914301105 1:146377757-146377779 GGGGGTGGGAAGGATGGGTCGGG - Intergenic
914517631 1:148387691-148387713 GGGGGTGGGAAGGATGGGTCGGG + Intergenic
916065641 1:161133272-161133294 GGGGGTGGGGAGGATGGTGCGGG + Intergenic
916786431 1:168090419-168090441 GGGGGTGAGAATCATAAGTCTGG - Intronic
917046452 1:170866032-170866054 GGTAGTGAGAAGGGTACTTCTGG - Intergenic
917707010 1:177645086-177645108 GGGGGATAGAAGGATTGATCTGG + Intergenic
918344291 1:183592817-183592839 GGGATTGTGAAGGAAAGTTCTGG - Intronic
919933339 1:202235807-202235829 TGGGGTGAGAAGGAGGGGTCTGG + Intronic
921260799 1:213383718-213383740 GGGGGTGGGGAGGAGTGTTCTGG - Intergenic
921600581 1:217102318-217102340 GGTGGTGAGAGGCATAGCTCTGG - Intronic
921943522 1:220869221-220869243 GGGGGTGAGGGGGATAGTTTTGG - Intergenic
922450588 1:225734185-225734207 GGAGGTGATAAGGATAATGCAGG + Intergenic
1062821652 10:538532-538554 GGGTGAGAGAGGGATGGTTCAGG + Intronic
1063397140 10:5699327-5699349 AGGGGTGAGGAGGATAGCTAAGG + Intronic
1065061780 10:21909660-21909682 TGGGGTCAGAAGACTAGTTCTGG + Intronic
1067058811 10:43067409-43067431 GGGGCTGAGGAGGTGAGTTCAGG + Intergenic
1067802314 10:49367619-49367641 GTGGGTGAGAAGGATTGACCTGG - Intronic
1071480422 10:86061077-86061099 GGGTGGGAGAAGGATAGTGGAGG - Intronic
1073659972 10:105464089-105464111 AGGGGTGGGGAGGATAGTTTGGG - Intergenic
1074294371 10:112170109-112170131 GGGGGTGGGGAGGATGGTTTTGG - Intronic
1075684732 10:124355642-124355664 GAGGCTGGGAAGGATAGTTAGGG + Intergenic
1076265661 10:129107995-129108017 GGGGGTGGGAAAGCTAGATCGGG - Intergenic
1076885409 10:133259936-133259958 TGGGGTGAGAGGGATTCTTCCGG + Intergenic
1078621440 11:12912447-12912469 GGGAGTGAGAAGGAGTTTTCAGG + Intronic
1078725420 11:13926044-13926066 GGGTGAGAGAAGGGGAGTTCAGG + Intergenic
1080121790 11:28686445-28686467 GGGGGTCATAAGGATCGTTAGGG - Intergenic
1083013314 11:59425009-59425031 GGTGGTTACAAGGATAGATCAGG - Intergenic
1083386222 11:62312321-62312343 GGAGGCAAGAAGGGTAGTTCTGG - Intergenic
1083390639 11:62347383-62347405 AGGGGTGAGACTGAAAGTTCAGG + Intronic
1083427173 11:62594216-62594238 GGGGCTGAGAGGGACAGTCCAGG - Intronic
1084593333 11:70103042-70103064 TGGAGAGAGAAGGAAAGTTCTGG - Intronic
1084866968 11:72066644-72066666 GGGGGCGATAAGGAGAGTTTGGG - Intronic
1085288076 11:75377157-75377179 GGGTATGAGGAGGAGAGTTCTGG - Intergenic
1086226350 11:84514674-84514696 GGGGGTGAGGAGGAGAGGTGGGG + Intronic
1086515478 11:87607469-87607491 GAGGCTGAGAAGGGTAGTTGCGG + Intergenic
1086847073 11:91764256-91764278 GAGGCTGAGAAGGGTAGTTGGGG - Intergenic
1089001417 11:115055219-115055241 GGGGGTGAGAGGGAGGGGTCTGG + Intergenic
1089425683 11:118372574-118372596 TGGGGTGAGAAGAACTGTTCGGG - Exonic
1089575871 11:119442686-119442708 GAGGCTGAGAAGGATAGTGTGGG - Intergenic
1090797857 11:130150733-130150755 GGAGCTGAGAAGGAGAGTTCTGG - Intergenic
1090981847 11:131729531-131729553 GGGGGTGATAAAAATCGTTCTGG - Intronic
1091058336 11:132439299-132439321 GGGGGTGAGCAGCATCATTCAGG - Intronic
1095145914 12:38725948-38725970 GGGGGTGGGGAGGATGGTTTCGG + Intronic
1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG + Intergenic
1097389305 12:58989781-58989803 GGGCCTGAGAAGGATGGTTGTGG + Intergenic
1097637987 12:62145435-62145457 GGGGGTGCGGAGGATGGTTTCGG - Intronic
1097745400 12:63296542-63296564 GGGTGTGAGGAGGATAGGTAGGG - Intergenic
1099657984 12:85520098-85520120 GAGGGTGGGAAGGATAGTGAGGG + Intergenic
1101432159 12:104635472-104635494 GGGGGTTGGAAGGAGAATTCAGG + Intronic
1102350559 12:112188870-112188892 GGAGGTGACATGAATAGTTCTGG - Intronic
1102552107 12:113698848-113698870 GGGGGTGGGAAGGGTAGTGGGGG + Intergenic
1103612986 12:122135367-122135389 CGGGGTGAGAAGGACACTGCAGG - Intronic
1105584568 13:21731991-21732013 GGGGCTGAGAAGGAGGGTACAGG - Intergenic
1106254815 13:28012524-28012546 GAGGGTGAGTAGGATATTCCAGG - Intronic
1107224085 13:38026117-38026139 GAGGCTGAGAAGGATAGTAGGGG - Intergenic
1108171094 13:47742862-47742884 GAGGCTGGGAAGGATAGTGCAGG + Intergenic
1111818241 13:93182031-93182053 TGGGGTCAGAGGCATAGTTCAGG - Intergenic
1113220776 13:108099401-108099423 GGGGTTGAGATGGATGGCTCGGG + Intergenic
1113349834 13:109518459-109518481 GGGAGTGAGAAGAAAAGGTCAGG + Intergenic
1114761107 14:25315586-25315608 GAGGCTGAGAAGGATAGTAGAGG - Intergenic
1114905803 14:27124624-27124646 GGGGGTGAGGAAGACAGTTAAGG - Intergenic
1120089473 14:80314237-80314259 GGGGCTGAGAGGGAAAGTTTAGG + Intronic
1121587300 14:95070982-95071004 GGGAGAGAGAAGGAAAATTCAGG + Intergenic
1124396093 15:29303172-29303194 GGGGCTGAGAAGGATACAGCAGG - Intronic
1126330248 15:47523710-47523732 AGGGGTGACTAGGAGAGTTCTGG - Intronic
1127361390 15:58247660-58247682 GCAGGTGAGAGGGATAATTCTGG + Intronic
1127493870 15:59491412-59491434 GAGGCTGAGAAGGATAGTGGGGG + Intronic
1129472699 15:75764168-75764190 GGGGGAGCCAAGGATAGTCCTGG + Intergenic
1129855873 15:78824748-78824770 GGTGGTGAGAAGGTTAGGTCTGG - Intronic
1130730581 15:86488035-86488057 GGGGCTGAGTAGAAAAGTTCAGG - Intronic
1131887819 15:96937460-96937482 GAGGCTGAGAAGGATAGTGGTGG - Intergenic
1132399877 15:101498698-101498720 GGGGGTGAGGAGGTTAGAACAGG - Intronic
1132547159 16:538621-538643 GGGGGTGAGACAGAGAATTCTGG - Intronic
1132747889 16:1444532-1444554 TGGGGAGAGAAGGAAGGTTCTGG - Intronic
1134268132 16:12709302-12709324 GGGGCAGAGAAGGATTGTTCTGG + Intronic
1134834617 16:17350582-17350604 GGGGCAGAGAAGGCTAGTTTGGG - Intronic
1135615211 16:23905400-23905422 GGGGGTGAGGAGTGAAGTTCTGG - Intronic
1139124739 16:64064584-64064606 GAGGTTGAGAAGGATAGTGAGGG - Intergenic
1140513449 16:75525120-75525142 GACCGTGAGAAGGAGAGTTCAGG - Intergenic
1141519148 16:84566205-84566227 GGTGGTGAGAAGGTTAGGTCCGG - Exonic
1142116801 16:88360915-88360937 AGGGGTGAGGAGGATGGTTTTGG + Intergenic
1142747665 17:1968045-1968067 GGGGCTGAGAAGGAACGTCCAGG - Intronic
1143563339 17:7707883-7707905 GGGTGAGGGAAGGAAAGTTCTGG + Intronic
1144627994 17:16854920-16854942 AGTGGTGAGAAGGTTAGGTCTGG + Intergenic
1145945092 17:28767894-28767916 GGGGGTGGGAGAGGTAGTTCAGG - Intronic
1147506112 17:41019157-41019179 GGAGGTGGGTAGGATGGTTCAGG + Intronic
1151421506 17:74001038-74001060 GGGGGTGACCAGAACAGTTCTGG - Intergenic
1153055755 18:944836-944858 AGGGGTGAAAAGGATTTTTCTGG + Intergenic
1153259502 18:3209586-3209608 GGGGGAGTGATGGATAGTGCAGG - Intronic
1153815267 18:8785389-8785411 GGTGCTGAGAAGGATGGTTTTGG + Intronic
1154234990 18:12596876-12596898 GGGGGTTAGCAGGACAGTGCAGG - Intronic
1154234999 18:12596917-12596939 GGGGGTTAGCAGGACAGTGCAGG - Intronic
1155067668 18:22281773-22281795 GGGGGTGAGAGGAACAGCTCCGG + Intergenic
1155316591 18:24577954-24577976 GGGGGTGGGAAGTGTAGGTCAGG + Intergenic
1156782184 18:40863812-40863834 GGGGCTGAGAAGCAATGTTCAGG - Intergenic
1157454755 18:47816030-47816052 GAGGTTGAGAATGAAAGTTCTGG + Exonic
1157625673 18:49048809-49048831 GGTGGTGGGAAGGATAGTCATGG - Intronic
1160331445 18:77995790-77995812 TGGGGAGAGAAGGACAGTTCTGG + Intergenic
1161940598 19:7401105-7401127 GGGGGTGAAATGGATAGTGACGG + Intronic
1162503305 19:11066975-11066997 GGGGGTGGGAAGAATAATACGGG + Intergenic
1164712213 19:30365309-30365331 GGAGGGGAGAAGGAAAGTTTGGG - Intronic
1165454496 19:35902799-35902821 GGGGGTGAGACAGGGAGTTCTGG + Intronic
1166317347 19:41996576-41996598 GGCGGTGAGAAGGAAAGACCTGG + Intronic
1166461609 19:42992758-42992780 GGCCTTGAGGAGGATAGTTCTGG + Intronic
1166874977 19:45891421-45891443 GGGGGTGAGAAGGATAGTTCTGG - Intronic
1167671563 19:50856501-50856523 GGGGGAGAGAGGGAAAGTTCTGG + Intronic
925795978 2:7543291-7543313 GGGGGAGAGAAGGACAGTAATGG + Intergenic
926065048 2:9831926-9831948 AGTGGTGAGACGGATAGATCTGG - Intergenic
927162539 2:20281271-20281293 GGAGGTGTGAAGGTTAGTTTTGG + Intronic
927946511 2:27138011-27138033 GGGGGAGAGAGAGGTAGTTCTGG + Exonic
930691884 2:54373058-54373080 GGGTGTGAGAAGGTGAATTCAGG - Intronic
932039172 2:68280987-68281009 GGGGTTGAGAAGGTTAGTGATGG - Intergenic
933338559 2:80992248-80992270 GAGGCTGAGAAGGATAGTGGTGG + Intergenic
935195289 2:100810303-100810325 GAGGAGGAGAAGGATAGGTCAGG + Intergenic
936088922 2:109488527-109488549 GGGAGTGAGGAGGCTTGTTCAGG - Intronic
938802330 2:134774687-134774709 TGGGGTGAGAAGTTTAATTCGGG + Intergenic
938876510 2:135536958-135536980 GGCGGTGAGGAGGATGGTTATGG - Intronic
939318336 2:140581722-140581744 GAGGGAGAGAAAGATAATTCAGG - Intronic
941623066 2:167800406-167800428 GGGTGTGGGGAGGGTAGTTCAGG - Intergenic
942472986 2:176281786-176281808 GGGGGTGAGTAGAGTAGTGCGGG + Intronic
943229351 2:185226999-185227021 GAGGGAGAGAAAGATAATTCAGG - Intergenic
943263888 2:185700600-185700622 AGAGGTGAGAAGGATAGATACGG - Intergenic
945098208 2:206239369-206239391 GGAGGGGGGAAGGATAATTCAGG + Intergenic
945570106 2:211456689-211456711 GGAGGGGAGAGGGATAGTTTTGG + Intronic
946031817 2:216711411-216711433 TGGGGTGAGAGGGATACTACGGG - Intergenic
946096604 2:217279859-217279881 GGGGGAGATAAGGATTTTTCAGG - Intergenic
1170327381 20:15171452-15171474 GGGGGTGATAAGGAGAGTGATGG - Intronic
1170417954 20:16164410-16164432 GGGGGTGAGAGGAATGGTTTTGG + Intergenic
1170691741 20:18622349-18622371 GGGGGTGAGGAAGATAATTCAGG + Intronic
1171989457 20:31684629-31684651 GGAGATGAGAAGGGTAGATCTGG - Intronic
1172778139 20:37420021-37420043 GGGGGTGTGGAGGGGAGTTCAGG - Intergenic
1173961247 20:47074154-47074176 CGGGGTAGGAAGGATAGTCCTGG - Exonic
1173990457 20:47298585-47298607 GGGGGTGACCAGGATAGAACAGG + Intronic
1176985704 21:15433237-15433259 GGGGGTGGGAAGCATAGCTGAGG - Intergenic
1178319771 21:31596569-31596591 GGGGGTGGGAGGGATGGTTTTGG - Intergenic
1179323699 21:40318726-40318748 GGGAGTGATAAGGATATTGCTGG + Intronic
1181771022 22:25125668-25125690 GGGGATGGGAAGGATGGTGCAGG - Intronic
1182270819 22:29152250-29152272 GGGGGTTAGAGGGATGGCTCAGG - Intronic
1182745389 22:32601747-32601769 GTGGGGAAGCAGGATAGTTCTGG + Intronic
1183748151 22:39704124-39704146 GGAGGGGAGAAGGACAGTGCTGG + Intergenic
1184690489 22:46115159-46115181 GGTGGTGAGCAGGAGAGTCCTGG - Intergenic
950444099 3:13026107-13026129 GGAGGAGAGAATGATAGGTCAGG + Intronic
952474321 3:33690931-33690953 GGGGGTGGGGAGGATGGTTTTGG + Intronic
958175728 3:89993797-89993819 GAGGCTGAGAAGAATAGTGCAGG + Intergenic
958683133 3:97356385-97356407 GGGGGTGAGGGGGATGGTTTTGG - Intronic
960784598 3:121358259-121358281 GAGGGTGAGAAGGGTAGTGGGGG - Intronic
960880971 3:122344522-122344544 GGGGCTGAGCATGATAGATCAGG + Intergenic
961527080 3:127511249-127511271 GGGGCTGAGCATGCTAGTTCAGG - Intergenic
962958068 3:140284898-140284920 GGGGGTTGGCAGGCTAGTTCAGG - Intronic
965063604 3:163814376-163814398 GGGGGAGATAATGATAGATCTGG - Intergenic
965605032 3:170489935-170489957 GAGGCTGGGAAGGATAGTTGGGG + Intronic
966634173 3:182113845-182113867 AGGGGTGAGGGGGATATTTCTGG - Intergenic
966772941 3:183520105-183520127 GAGGCTGTGAAGGAGAGTTCTGG + Intronic
967144273 3:186593007-186593029 GGGGCTGAGCATGCTAGTTCAGG - Intronic
969565211 4:7973271-7973293 GGGGCTGAGACGGGTAGATCAGG + Intronic
970626978 4:17896871-17896893 GAGGCTGAGAAGGATAGTGGGGG - Intronic
971232259 4:24809229-24809251 GGGAAGAAGAAGGATAGTTCGGG + Intronic
972271778 4:37517910-37517932 GGGGCTGGGAAGGGTAGTTGGGG - Intronic
974078897 4:57193146-57193168 GGAGGTAAGAATGATATTTCAGG + Intergenic
974472512 4:62337047-62337069 GGGGGTGAGTATGCTAGCTCAGG - Intergenic
975754849 4:77562134-77562156 GGGGGTGGGAAGGCTTGTGCCGG - Intronic
978534394 4:109745693-109745715 GGGAGTGAGAAGGAGGGTTGTGG + Intronic
981258411 4:142690831-142690853 GGGGGTGAGGAGGAAGGTGCTGG - Intronic
982065701 4:151652734-151652756 GCAGGTGAGAATGATAGTCCAGG + Intronic
982086297 4:151840197-151840219 GGGGGTGGGGAGGATGGTTTAGG - Intergenic
982633619 4:157864721-157864743 AGGGGTGAGAAGGAAAGTTCAGG - Intergenic
983421440 4:167523389-167523411 GAGGCTGGGAAGGATAGTTGGGG - Intergenic
984682457 4:182625469-182625491 GGGGGTGGGGAGGATGGTTTCGG - Intronic
985868999 5:2538982-2539004 GAGGGTGGGTAGGAAAGTTCGGG - Intergenic
986173814 5:5334804-5334826 GGGGGTGAGAAGAATGGATAAGG - Intergenic
986866604 5:11996502-11996524 GAGGCTGAGAAGGGTAGTGCAGG - Intergenic
989823325 5:45822559-45822581 GTGGATGAGAAGGATATTCCAGG - Intergenic
990015744 5:51060063-51060085 GAGGGTGAGAAGGGAACTTCAGG + Intergenic
991264468 5:64700793-64700815 GGGGGTGGGAGGGATGGTTTTGG + Intronic
993423750 5:87736051-87736073 AGTGGTCAGAAGGAGAGTTCTGG + Intergenic
993683073 5:90903912-90903934 GAGGCTGAGAAGGGTAGTTGGGG - Intronic
995354424 5:111222700-111222722 GGGGGTGGGGAAGATGGTTCTGG - Intergenic
995572643 5:113496593-113496615 GAGGCTGGGAAGGATAGTTGGGG - Intergenic
996091875 5:119359267-119359289 GGTGGAGAGAAGGATATTTTGGG - Intronic
996505375 5:124262532-124262554 GGGGGAAAGGAGGATATTTCTGG - Intergenic
997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG + Intronic
997802802 5:136883659-136883681 CTGGGGGAGAAAGATAGTTCAGG + Intergenic
999874601 5:155788868-155788890 TGGGCAGAGAATGATAGTTCAGG + Intergenic
1000600311 5:163265938-163265960 GGGGGTGATAATGAAAGTCCAGG + Intergenic
1001528198 5:172444083-172444105 GGTAGTGAGAGGGATAGTTGTGG - Intronic
1002431972 5:179208980-179209002 GGGGGTGAAAAGTGTTGTTCTGG - Intronic
1005282172 6:24286069-24286091 AGGAGTGAGAAGAATATTTCAGG - Intronic
1006007360 6:31013103-31013125 GGGGGTGAGGAGGAGAGTGGAGG - Intronic
1007317453 6:41000585-41000607 GGAGGGGAGAAGCATAGTGCTGG + Intergenic
1007526885 6:42503768-42503790 GGGGCTGAGCATGCTAGTTCAGG + Intergenic
1008237523 6:49068306-49068328 GAGGGTGAAAAGGATAGTGTGGG + Intergenic
1014620522 6:123661273-123661295 GGTGGTGAGAAGTAGAATTCTGG - Intergenic
1015364674 6:132384553-132384575 GGGGATCAGAAGGCTATTTCAGG + Intronic
1015918732 6:138245434-138245456 GAGGATGGGAAGGATGGTTCAGG + Intronic
1016367013 6:143330412-143330434 GGTGGTGAGGAGTATTGTTCTGG + Intronic
1016891720 6:149014253-149014275 GTGGGTGGGAAGGTTATTTCAGG + Intronic
1018126497 6:160687962-160687984 GAGGCTGAGAAGGGTAGTTGGGG + Intergenic
1019530921 7:1502996-1503018 GGGGGTGTGGAGGAGAGTTTGGG + Exonic
1019824264 7:3270488-3270510 GGTGGTGATAAGGATAGTGGTGG + Intergenic
1020611010 7:10398092-10398114 GAGGGAGAGAAGAATAGTTGTGG + Intergenic
1022052516 7:26691764-26691786 GAGGATAAGAAGGATATTTCCGG + Intronic
1022121033 7:27308260-27308282 GGAGGTGGGAGGGATAGTTTAGG - Intergenic
1026321494 7:69271912-69271934 GGGGATGAGAAGGATAAATTGGG - Intergenic
1028328857 7:89563050-89563072 GAGGGAGAGAAGGATATTTTTGG + Intergenic
1030109832 7:106017784-106017806 GGGGTAGAGAAGGATGATTCAGG - Intronic
1033137708 7:138798536-138798558 GGGGCTGAGAAGGAGCCTTCAGG - Intronic
1036999585 8:13702687-13702709 AGGGCAGAAAAGGATAGTTCAGG - Intergenic
1037493697 8:19419315-19419337 GGGGGTGTGAAAGAGAGTCCTGG + Intronic
1040725450 8:50377129-50377151 GAGGGTGAGAAGGACAATTGAGG + Intronic
1041634989 8:60132897-60132919 GGGGGTGAGAAGGACATTCCAGG - Intergenic
1045190133 8:99873669-99873691 GGGGGTGAGTAGGAGAGGTTGGG - Intronic
1045392917 8:101733056-101733078 GAGGGTGAAGAGGATGGTTCTGG - Intronic
1045616775 8:103923426-103923448 GAGGATGAGAAGCATAGGTCAGG + Intronic
1047844698 8:128793437-128793459 GGAAGTGAGAAGGACATTTCAGG - Intergenic
1048602601 8:135933929-135933951 GGGGGTGAGCATGTTAGCTCAGG - Intergenic
1048899149 8:139021661-139021683 GGGTGTGAGATGTTTAGTTCCGG - Intergenic
1049102505 8:140589653-140589675 GAAAGTGAGAAGGATAGCTCAGG + Intronic
1049452385 8:142669288-142669310 GGGGGTCAGAAGGAGAGTATGGG + Intronic
1050640588 9:7663199-7663221 GGGGGTGAGAAAGAAAGGTAGGG - Intergenic
1051056359 9:12991931-12991953 GGGGGTGAAAAGGAGAGTTGAGG - Intergenic
1055874783 9:80928839-80928861 GTGTGTGCCAAGGATAGTTCTGG - Intergenic
1058415095 9:104779081-104779103 GTGGGTGCGAAGGATATTCCCGG - Intergenic
1059930280 9:119253592-119253614 GAGGCTGGGAAGGATAGTTGGGG + Intronic
1059991117 9:119867612-119867634 GGGGGAGAGGAGGAGAGTACAGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061638807 9:131935053-131935075 GCGGCTGAGAAGGGTAGTTGGGG + Intronic
1185930873 X:4202140-4202162 GGTGGTGGGGAGGATGGTTCCGG + Intergenic
1187283032 X:17876495-17876517 GCTGGTAAGAAGGATAGATCAGG - Intergenic
1187444073 X:19345105-19345127 GGGGGTCAGAATGCTAGCTCAGG - Intronic
1188322110 X:28752609-28752631 GGGGGTGAGAAGCAGAGGTTTGG - Intronic
1189847171 X:45148525-45148547 GGGAGTGAGAGGGAGAGTTGGGG + Exonic
1189868305 X:45354415-45354437 GAGGCTGAGAAGGATAGATGGGG - Intergenic
1190245634 X:48688725-48688747 GGGGGTAACAAGGGTCGTTCTGG + Exonic
1193829314 X:86269132-86269154 GAGGCTGAGAAGGGTAGTTGGGG - Intronic
1194017120 X:88636651-88636673 GAGGCTGAGAAGAGTAGTTCAGG + Intergenic
1194469421 X:94273616-94273638 AGGGGTGAGCATGCTAGTTCAGG - Intergenic
1195970758 X:110470608-110470630 TGGGGAGAGAAGGATAAATCTGG + Intergenic
1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG + Intergenic
1197897727 X:131333285-131333307 GAGGCTGAGAAGGGTAGTGCGGG - Intronic
1198139497 X:133788663-133788685 GGAGATGAGAAGGAGAGTTTTGG - Intronic
1198301196 X:135335422-135335444 GGGAGTGAGAAGGCAACTTCAGG - Intronic
1198613870 X:138432224-138432246 TGGGCTGAGAAGGATAGAGCTGG - Intergenic
1198935633 X:141900515-141900537 GGAGGTGACAAGGATACTTTGGG + Intergenic
1199287552 X:146070708-146070730 AGGGGTGAGAAGGAAAGCTCTGG - Intergenic
1199458986 X:148061784-148061806 AGAGGTGGGAAGGATAGTTAGGG - Intergenic
1200114265 X:153763284-153763306 GGGGGTGAGAAGCTTGGCTCAGG - Intergenic