ID: 1166876390

View in Genome Browser
Species Human (GRCh38)
Location 19:45900429-45900451
Sequence GGTGGTCCAGGAGGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166876390_1166876407 11 Left 1166876390 19:45900429-45900451 CCAGGAAGCCCTCCTGGACCACC No data
Right 1166876407 19:45900463-45900485 CGAAATCAGAAACCCTCTCTGGG No data
1166876390_1166876411 28 Left 1166876390 19:45900429-45900451 CCAGGAAGCCCTCCTGGACCACC No data
Right 1166876411 19:45900480-45900502 TCTGGGCTCCCACAGTCCCTGGG No data
1166876390_1166876406 10 Left 1166876390 19:45900429-45900451 CCAGGAAGCCCTCCTGGACCACC No data
Right 1166876406 19:45900462-45900484 CCGAAATCAGAAACCCTCTCTGG No data
1166876390_1166876410 27 Left 1166876390 19:45900429-45900451 CCAGGAAGCCCTCCTGGACCACC No data
Right 1166876410 19:45900479-45900501 CTCTGGGCTCCCACAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166876390 Original CRISPR GGTGGTCCAGGAGGGCTTCC TGG (reversed) Intronic