ID: 1166878915

View in Genome Browser
Species Human (GRCh38)
Location 19:45914923-45914945
Sequence GAGCTGGGACCAGAGATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166878915_1166878922 5 Left 1166878915 19:45914923-45914945 CCCCTGATCTCTGGTCCCAGCTC 0: 1
1: 0
2: 2
3: 31
4: 375
Right 1166878922 19:45914951-45914973 CCAAGGTGCTCTGTGACCTCTGG 0: 1
1: 0
2: 1
3: 38
4: 389
1166878915_1166878923 6 Left 1166878915 19:45914923-45914945 CCCCTGATCTCTGGTCCCAGCTC 0: 1
1: 0
2: 2
3: 31
4: 375
Right 1166878923 19:45914952-45914974 CAAGGTGCTCTGTGACCTCTGGG 0: 1
1: 0
2: 4
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166878915 Original CRISPR GAGCTGGGACCAGAGATCAG GGG (reversed) Intergenic
900078118 1:834373-834395 GAGCTGGGTGTGGAGATCAGGGG + Intergenic
900165980 1:1244545-1244567 GAGCTGGGACCCCAGGGCAGCGG + Intronic
900700753 1:4047384-4047406 GGGCTGGGACCAGAGCACAAAGG + Intergenic
900834083 1:4986501-4986523 GAGCAGGGACCACAGACCACCGG + Intergenic
900926694 1:5710456-5710478 GAGCTTGGCCCAGGGAACAGGGG - Intergenic
901044347 1:6386443-6386465 CAGGTGGGAGCAGAGACCAGAGG - Intronic
901166997 1:7228489-7228511 GGGCTGGGAACAGAGACCACAGG - Intronic
901430530 1:9211356-9211378 GAGCTGGGCCCTGAAATCCGAGG - Intergenic
901957469 1:12797114-12797136 GAGCTGGGGCCATCCATCAGGGG + Intergenic
902659669 1:17892335-17892357 GAGAGGAGAGCAGAGATCAGAGG - Intergenic
902753404 1:18533165-18533187 GGGCTGGGACTGGAGATCATGGG - Intergenic
903177891 1:21591400-21591422 GAGCAGGGGGCAGAGTTCAGGGG + Intergenic
903539118 1:24086893-24086915 GGGCTGGGGACAGAGATCATGGG - Intronic
904337960 1:29810286-29810308 GAGCTGGGACCAGAGAGGGAGGG - Intergenic
904430729 1:30462434-30462456 TTGCTGGGAGCAGAGACCAGAGG - Intergenic
905389467 1:37626868-37626890 GTGCAGGGACCCCAGATCAGGGG + Intronic
906109235 1:43312285-43312307 GCTCTGGGGCCAGAGGTCAGGGG - Exonic
906295239 1:44645511-44645533 GCCCTGGGACCACAGTTCAGTGG + Intronic
906546163 1:46620855-46620877 GAGCTTGGAGCAGAGAACACTGG - Intergenic
906647571 1:47486741-47486763 GAGCTGGGCACAGAGATCCAGGG - Intergenic
908838223 1:68250046-68250068 GAGCAGGGAGAAGACATCAGGGG - Intergenic
910278303 1:85471222-85471244 GAGCTGGAACCATAGAATAGGGG - Intronic
912094245 1:106119778-106119800 GAGCTGCAACCAGAGATCACTGG - Intergenic
912458946 1:109818557-109818579 GTTCTGGGACCCCAGATCAGAGG - Intergenic
913966546 1:143381741-143381763 GACCTGGGAGCACAGAGCAGAGG + Intergenic
914060921 1:144207348-144207370 GACCTGGGAGCACAGAGCAGAGG + Intergenic
914118229 1:144759021-144759043 GACCTGGGAGCACAGAGCAGAGG - Intergenic
914452430 1:147804448-147804470 GAGCTGGGACCTGAACCCAGAGG - Intergenic
915022826 1:152797279-152797301 GAGCTCCAACCTGAGATCAGGGG + Intronic
918076155 1:181173071-181173093 CACCTGGGGCCAGAGGTCAGGGG - Intergenic
919587933 1:199462790-199462812 GAGCTGGGACCTCAGCTGAGGGG - Intergenic
919980970 1:202642896-202642918 GCGCTGGGACCAGGGACCTGCGG - Intronic
919982204 1:202649135-202649157 GAGCAGGGCCCAGGCATCAGAGG + Intronic
920704722 1:208243127-208243149 GATCGGGGACTGGAGATCAGGGG - Intronic
921069893 1:211649974-211649996 GGGCTGGGGCCACAGATCTGGGG - Intergenic
921154569 1:212429120-212429142 GAGCAGGCGCCAGAGATCAGTGG - Intergenic
922141768 1:222894536-222894558 GTGCTGGGAGCAGGGAGCAGGGG + Intronic
922418516 1:225443491-225443513 GAGCTGGGAAGAGAGACCAGTGG + Intergenic
923046805 1:230361790-230361812 GAGCTGGGACCCAGGCTCAGAGG + Intronic
923516694 1:234703717-234703739 GAGCTGGGAACAGTGAAGAGGGG + Intergenic
923862184 1:237902762-237902784 GGACTAGGACCAGAGAGCAGTGG + Intergenic
924487629 1:244501860-244501882 GAGCTGAGGCCAGAGAAGAGGGG - Intronic
924522881 1:244820695-244820717 GAGCTGCAGCCAGAGATCACTGG - Intergenic
1063308453 10:4930067-4930089 GAGCTGTAGCCAGAGATCACTGG - Intronic
1063318220 10:5027415-5027437 GAGCTGTAGCCAGAGATCACTGG + Intronic
1063496496 10:6514073-6514095 GTGCTGGGACCAGAGCATAGAGG - Intronic
1065068389 10:21997588-21997610 GAGATGGGTCTAGTGATCAGTGG + Intronic
1066213966 10:33267671-33267693 AGGATGGGAACAGAGATCAGTGG + Intronic
1066501669 10:36000931-36000953 GAGATGGAGCCAGAGACCAGAGG - Intergenic
1067387476 10:45829584-45829606 TAGCTGGGACCACAGATGTGTGG - Intronic
1067418651 10:46127681-46127703 TAGCTGGGACCACAGATGTGTGG + Intergenic
1067446795 10:46355027-46355049 TAGCTGGGACCACAGATGTGTGG + Intergenic
1067504002 10:46834259-46834281 TAGCTGGGACCACAGATGTGTGG + Intergenic
1067590587 10:47505740-47505762 TAGCTGGGACCACAGATGTGTGG - Intronic
1067637706 10:48013842-48013864 TAGCTGGGACCACAGATGTGTGG - Intergenic
1067875786 10:50006503-50006525 TAGCTGGGACCACAGATGTGTGG + Intronic
1069408779 10:68130896-68130918 GAGCTGACACTATAGATCAGTGG - Intronic
1069564472 10:69454056-69454078 GAGATGGCACCAGAGATAATAGG - Intronic
1070134305 10:73678263-73678285 TAGCTGGGACCACAGATGTGTGG - Intronic
1070388364 10:75947336-75947358 GAGCTGAGATCACAGGTCAGAGG + Intronic
1072783265 10:98264455-98264477 GAGCTGGGGCCAATGATCAAGGG + Intronic
1073982749 10:109173473-109173495 GAACTGGTAACAGAGATCTGAGG + Intergenic
1074976966 10:118588717-118588739 GAGATGGGTCCTGAGACCAGGGG + Intergenic
1075807696 10:125201991-125202013 GAGCTGGCCCCAGGGATCAGGGG + Intergenic
1075862808 10:125691727-125691749 GTGCTGGGCCCAGAGATTTGGGG + Intergenic
1076861919 10:133141782-133141804 GAGCTGGGACCTGTGAGCATTGG + Intergenic
1077094603 11:793965-793987 GGGCTGGGGCCAGAGGTCACAGG + Intronic
1077892512 11:6429755-6429777 GAGCTGAGAACAGAGGTTAGGGG - Intergenic
1077896384 11:6456623-6456645 GAGCTGCGTGCAGAGATCACCGG - Exonic
1078876591 11:15404984-15405006 GAGGTGGTACCAGGGAACAGAGG - Intergenic
1083464316 11:62835051-62835073 GAGCTGAGGCCAGAGATGGGAGG + Intronic
1083929656 11:65833735-65833757 GAGCTGGGGTCAGAGTTCATAGG - Exonic
1084147370 11:67272232-67272254 GAGCTGGGTGCAGGGCTCAGAGG - Intronic
1085301719 11:75462664-75462686 GAGCTGGTGGCAGAGCTCAGAGG + Intronic
1085414925 11:76313523-76313545 GAGCTGAGGCCAGAGAGAAGCGG + Intergenic
1085440786 11:76560767-76560789 GAGCTGCCCCCAGAAATCAGAGG + Intergenic
1088688716 11:112306315-112306337 GAGCTGGGTAATGAGATCAGAGG + Intergenic
1089336757 11:117730243-117730265 GAGCTGTGACAAGAAAGCAGAGG + Intronic
1089554448 11:119308420-119308442 CAGTTGGCAGCAGAGATCAGGGG - Intergenic
1089622017 11:119727816-119727838 GAGCTGGGAGCAGAGTTCCGAGG + Intronic
1090412045 11:126515959-126515981 GAGATGGGTCCAGAGAACAGTGG - Intronic
1091976807 12:4832111-4832133 TGGTTGGGACCAGAGAACAGGGG + Intronic
1094161744 12:27398002-27398024 GAACTGGCTCCAGAGACCAGAGG - Intronic
1097493633 12:60300690-60300712 GAGCTTCAGCCAGAGATCAGTGG - Intergenic
1099729723 12:86484788-86484810 GACATGGCACCAGTGATCAGAGG + Intronic
1101444938 12:104730901-104730923 CAGCTGGGACCAGGGAGCTGTGG - Intronic
1101652860 12:106693606-106693628 GAGCTGGGATCAGGGGACAGTGG + Intronic
1101929955 12:109005827-109005849 GAGGTGGGACCAGGGAACAGAGG + Intronic
1102119570 12:110429723-110429745 GAGCTGGGAACTGAGGCCAGGGG + Intergenic
1102990731 12:117313944-117313966 AAGCTAGGACCATAGAACAGAGG - Intronic
1103703379 12:122859239-122859261 GAGGTGGGTGCAGAGGTCAGAGG - Intronic
1104789692 12:131473692-131473714 GAGCTGGTATAAGAGATAAGGGG + Intergenic
1104871228 12:131998054-131998076 GAGCTGGCACTTAAGATCAGTGG - Intronic
1105304474 13:19159115-19159137 GAGATGGGACCAGACATGGGAGG + Intergenic
1105577521 13:21667970-21667992 GAGCTGGGACCCGTGAGGAGAGG + Intergenic
1107311741 13:39085900-39085922 GAGCTGCAGCCAGAGATCACTGG - Intergenic
1108200764 13:48040556-48040578 TAGCTGGGACCACAGACCATAGG + Intronic
1108591428 13:51916321-51916343 GAACTGAGACCAGAGTACAGAGG - Intergenic
1109343383 13:61089375-61089397 GATCAGGGTGCAGAGATCAGAGG - Intergenic
1111028680 13:82568184-82568206 GAGCTGTAGCCAGAGATCACTGG + Intergenic
1111852625 13:93596155-93596177 GAGATGGGATCAGAGGCCAGAGG + Intronic
1114565238 14:23627009-23627031 GAGCTGCAGCCAGAGATCACTGG - Intergenic
1114632311 14:24166951-24166973 GCCCTGGGACCTGAGAACAGAGG + Exonic
1114829343 14:26120596-26120618 GAGGTGGGATCAGAGCACAGTGG - Intergenic
1115649407 14:35392123-35392145 GAGCTGGGACCAGAGCTACCTGG + Intergenic
1115961296 14:38837865-38837887 GCCCTGGGACCAGAGGTCTGGGG + Intergenic
1116702575 14:48259983-48260005 GATCAGGGAGCAGAGATAAGAGG + Intergenic
1117950829 14:61081275-61081297 GATCTGGGCCCAGAGACCACAGG + Intronic
1119492610 14:75049854-75049876 GAGCTGTGCCTAGAGATCAGCGG - Intronic
1119601672 14:75980898-75980920 GAGCTGGGAAGAGAGGCCAGGGG + Exonic
1119822624 14:77630921-77630943 GAGCTGCAGCCAGAGATCACTGG + Intergenic
1119861691 14:77940586-77940608 GAACTGGGGACAGAGGTCAGGGG + Intergenic
1120948786 14:90022182-90022204 GAGCTGGGTGCTGAGATCTGAGG + Intronic
1122131383 14:99605914-99605936 GAGCTGAGGTCAGAGGTCAGAGG + Intergenic
1122150232 14:99721709-99721731 GAGCTGGGACCAGGAATCAGGGG - Intronic
1123067525 14:105626106-105626128 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123071542 14:105644830-105644852 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123076503 14:105669885-105669907 GAGCTGGGCCCAGGGTGCAGAGG + Intergenic
1123091205 14:105743111-105743133 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123096973 14:105771446-105771468 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123193577 14:106594962-106594984 GAGCTGCAGCCAGAGATCATTGG - Intergenic
1123202204 14:106677182-106677204 GAGCTGCAGCCAGAGATCATTGG - Intergenic
1124809322 15:32918835-32918857 GAGCTGAGTCCAGAAAGCAGAGG - Intronic
1125602393 15:40922859-40922881 CAGCTGGGATCAGAGATCAGAGG + Intergenic
1126666629 15:51081242-51081264 GAGCTGGGACCAGGGAGATGGGG + Intronic
1127757156 15:62103882-62103904 GTACTGGGACCAGAGAGGAGGGG + Intergenic
1129297908 15:74609905-74609927 AAACTGAGACCAGAGAGCAGAGG - Intronic
1129604793 15:77019595-77019617 GAGCCGGGACCAGAGCTCCAAGG - Intronic
1129782479 15:78282178-78282200 GAGCTGGTATGAGAGATAAGTGG + Exonic
1133180307 16:4049256-4049278 GACCTGGGACCAGAGAGAAGAGG + Intronic
1134594550 16:15485315-15485337 GAGCTGGGCTCAGAGGCCAGAGG + Intronic
1135323771 16:21513197-21513219 TAGCAGTGACCAGAGAGCAGAGG - Intergenic
1136019739 16:27432465-27432487 GAGGTGGCACCAGGGATGAGAGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136335254 16:29606462-29606484 TAGCAGTGACCAGAGAGCAGAGG - Intergenic
1136475948 16:30513473-30513495 GAGCAGGGCCCAGAGGACAGTGG + Intronic
1136551807 16:30985994-30986016 GAGCTGGGGCCAGAGGCCAGAGG - Intronic
1136870279 16:33800807-33800829 GAGCTGCAGCCAGAGATCATTGG + Intergenic
1138558086 16:57784616-57784638 GTGCTGGGCCCAGAGCTCAGAGG + Intronic
1139438312 16:66949437-66949459 AAGCTGGGACTAGAGGTCACAGG - Intergenic
1140133244 16:72182909-72182931 AAGCAGGGGCCAGAGAGCAGAGG - Intergenic
1140728768 16:77837514-77837536 GTGCTGGGTACTGAGATCAGTGG - Intronic
1140836401 16:78798136-78798158 GAGCTTGGACCAGAGCGCAGAGG + Intronic
1141244087 16:82290339-82290361 AAGACTGGACCAGAGATCAGGGG + Intergenic
1141440328 16:84025853-84025875 AACCTGGGGCCAGAGAGCAGGGG - Intronic
1141685723 16:85568783-85568805 AAGATGGGAGCAGAAATCAGAGG + Intergenic
1142035979 16:87862304-87862326 TAGCAGTGACCAGAGAGCAGAGG - Intronic
1142123374 16:88398118-88398140 CAGCAGGGAGCAGGGATCAGAGG - Intergenic
1203101892 16_KI270728v1_random:1315247-1315269 GAGCTGCAGCCAGAGATCATTGG - Intergenic
1142707476 17:1705302-1705324 GAGGTGGGAACAGAGAAGAGCGG - Exonic
1143557925 17:7674102-7674124 GAGGTGGGCCCAGGGGTCAGAGG + Intronic
1144836241 17:18158078-18158100 GAGATGGGACCAGAGATGGTTGG + Intronic
1145935400 17:28711954-28711976 AAGCTGGAACCAGAGATGGGTGG - Intergenic
1147771792 17:42872994-42873016 GAGATGGGAACACAGATCGGAGG + Intergenic
1147982357 17:44282418-44282440 GTGCTGGGCCCTGAGACCAGGGG + Intergenic
1148439170 17:47702896-47702918 GAGCTGGGCCCAGAGAGAAGGGG - Intronic
1151572224 17:74932563-74932585 GAGGTGGGGCCAGAGGGCAGGGG - Intronic
1153728049 18:7978072-7978094 GAGCAGGCACCAGTTATCAGAGG - Intronic
1156312656 18:35939097-35939119 GAGCTTGGACAAGAGCCCAGTGG + Intergenic
1156361800 18:36390199-36390221 GAGCTGGGTCCAGAGGTGATAGG + Intronic
1157505045 18:48220104-48220126 GCTCTGGGACCAGAGATCCCAGG + Intronic
1157533884 18:48444451-48444473 GAGCTGGAACCATATGTCAGAGG + Intergenic
1159542499 18:69795935-69795957 GAGCTCGGATCACAGTTCAGTGG - Intronic
1159785880 18:72713975-72713997 GAGCTTGGAGCAGAGATGAGGGG - Intergenic
1160716729 19:580125-580147 GAGCAGGGACCAGAGGTGTGGGG + Intronic
1161520813 19:4722801-4722823 GAGCTGGGACTAAAGCCCAGGGG - Intronic
1162114261 19:8418982-8419004 AAGCTGGGAACAGAGATCCTTGG + Intronic
1163576710 19:18115173-18115195 GGGCCGACACCAGAGATCAGTGG + Intronic
1163676137 19:18656208-18656230 GAGCTGGGAGCAGAAAGCTGAGG - Intronic
1164169803 19:22715315-22715337 GTGCTGGGCCCAGAGATATGTGG + Intergenic
1164412210 19:28015283-28015305 TTGCTGAGACCAGAGGTCAGGGG + Intergenic
1164561195 19:29293340-29293362 GAGCTGGAAACAGAGGTCACGGG + Intergenic
1164564288 19:29314881-29314903 GAGCAGGGACTAGAGCTCAGAGG - Intergenic
1165155186 19:33782545-33782567 GATCTGGGACCACAGAGAAGTGG + Intergenic
1165227432 19:34365032-34365054 GAGCTGAGGCCCCAGATCAGCGG + Intronic
1165735663 19:38173942-38173964 GAGCTGGGGGCAGAGAAGAGAGG + Intronic
1165925492 19:39323594-39323616 CAGCTGGGACCAGAGCTCACAGG - Intergenic
1166105610 19:40596819-40596841 GAACTGGGAGCAGAGAGCTGAGG + Intronic
1166228072 19:41409515-41409537 GAGCTGGGACCAGAGTAGAGTGG + Intronic
1166878915 19:45914923-45914945 GAGCTGGGACCAGAGATCAGGGG - Intergenic
1166900701 19:46059511-46059533 GAACTGCAACCAGAGATCACTGG + Intronic
1167491087 19:49792930-49792952 GAGGTGGTACCTGAGAGCAGAGG - Intronic
1167604667 19:50475453-50475475 CACCTGGGGCCAGAGGTCAGAGG + Exonic
1167644476 19:50698240-50698262 GAGCTGTGACCAGTTACCAGGGG - Intronic
1168599658 19:57707693-57707715 TAGCTGGGAACAAAGAGCAGGGG - Intronic
1168694298 19:58396132-58396154 GAGCTGGGACCCGAGCCCTGGGG - Exonic
1202650019 1_KI270706v1_random:171512-171534 GAGCTGGTGCCAGCTATCAGTGG + Intergenic
1202700329 1_KI270712v1_random:159236-159258 GACCTGGGAGCACAGAGCAGAGG + Intergenic
925287153 2:2723305-2723327 CAGCTGTAACCAGAGGTCAGAGG + Intergenic
925911778 2:8578469-8578491 GAGTTGGGACAAGAACTCAGTGG - Intergenic
926286954 2:11496206-11496228 GAGCTGGGATCAGCGCACAGTGG - Intergenic
927869338 2:26613779-26613801 GGGCTGGGGCCAGAGCTAAGAGG + Intronic
927972736 2:27315986-27316008 GAGATGGGCTCAGAGGTCAGTGG + Intronic
928394701 2:30934586-30934608 GAGCTGGGAGGAGGGATCATAGG - Intronic
930377137 2:50582348-50582370 TAGCTGGGACCACAGGTGAGAGG - Intronic
931636533 2:64345318-64345340 GAGCTGTGACCACTGAGCAGAGG - Intergenic
933678080 2:85075723-85075745 GAAATGGGACCAGAGATAACAGG - Intergenic
934171262 2:89542712-89542734 GACCTGGGAGCACAGAGCAGAGG + Intergenic
934281568 2:91617030-91617052 GACCTGGGAGCACAGAGCAGAGG + Intergenic
935110801 2:100092567-100092589 GAGCTGGGAGCAGCTCTCAGAGG - Intronic
936124172 2:109772595-109772617 GAGCTGGGAGCAGCTCTCAGAGG + Intergenic
936220517 2:110598869-110598891 GAGCTGGGAGCAGCTCTCAGAGG - Intergenic
936526934 2:113247682-113247704 AGGCTGGGGCCAGAGAGCAGAGG - Intronic
937395171 2:121528906-121528928 GAGCTGTGAGCAAAGATGAGTGG - Intronic
940855195 2:158723920-158723942 GAGCTGGAACCAGAGATAGCAGG - Intergenic
942942335 2:181632951-181632973 GTGCTGGGCCCAGAGAGCTGAGG + Intronic
943717491 2:191168192-191168214 GAGCTGGGACCAGAGGTATCTGG + Intergenic
943951483 2:194135539-194135561 GATCAGGGTGCAGAGATCAGGGG + Intergenic
944420664 2:199526552-199526574 GTGCTGGGACCAGACATCACTGG - Intergenic
945040428 2:205739422-205739444 GGGCTGGGACAAGAGAACTGGGG - Intronic
945071014 2:205989120-205989142 GAGCTGGGATCAGGGGCCAGGGG - Intergenic
945392177 2:209277680-209277702 GAGCAAGGACCAGACATCTGAGG + Intergenic
946925061 2:224618249-224618271 TAGCTGGGACCAAAGATCCATGG - Intergenic
947900879 2:233720451-233720473 AAGCTGGGACCAGTGATGAATGG + Intronic
1169389873 20:5181232-5181254 GAGCTGCAGCCAGAGATCACTGG + Intronic
1169429129 20:5520906-5520928 GAGCTGTAGCCAGAGATCACTGG - Intergenic
1171387185 20:24778391-24778413 GAGCATGGCCTAGAGATCAGGGG + Intergenic
1172009652 20:31839037-31839059 GAGCTGGGGCCAGACCACAGTGG + Intergenic
1173731125 20:45329494-45329516 GAGGTGGGCCCAGTCATCAGGGG + Intronic
1174068598 20:47883768-47883790 GAGCTGGGACCTGAGCCCATGGG - Intergenic
1175445823 20:59018808-59018830 GAGATGGGACGACAGAGCAGGGG + Intergenic
1175677744 20:60961309-60961331 GAGCTGGGAAGAGAAATCAGAGG + Intergenic
1176077500 20:63254957-63254979 GACCCGGGTCCAGAGCTCAGAGG + Intronic
1176262522 20:64189809-64189831 GAGCTGGGACAACAGTGCAGGGG + Intronic
1177414629 21:20777737-20777759 GAGCTGCAGCCAGAGATCACTGG + Intergenic
1180076134 21:45464024-45464046 TGGCTGGGTCCAGAGCTCAGAGG + Intronic
1180904274 22:19397672-19397694 GAGCTGAGCCCAGAGCCCAGTGG + Intronic
1181258131 22:21577607-21577629 GAGCAAGGCCCAGAGAGCAGGGG - Intronic
1181307017 22:21922799-21922821 GGGGTGGGACCAGAGGTCATAGG - Exonic
1181313203 22:21956569-21956591 GAGATGGGAGCAGGGAGCAGGGG + Intergenic
1181346309 22:22222641-22222663 GAGATGGGAGCAGGGAGCAGGGG + Intergenic
1181956715 22:26592595-26592617 GAGGTGAGAGAAGAGATCAGAGG + Intronic
1182584147 22:31334034-31334056 GAACTGGGGTCAGAGACCAGAGG - Intronic
1183987625 22:41578174-41578196 GAGCTGGGACCTGAGCCGAGTGG + Intronic
1184303321 22:43576977-43576999 CAGCTGGGAGGAGGGATCAGGGG + Intronic
1184634804 22:45818624-45818646 GGGCAGGGATCAGGGATCAGGGG + Intronic
1185195570 22:49467333-49467355 GTGCTGGGCTCAGGGATCAGGGG - Intronic
1185310193 22:50150090-50150112 CAGGTGGGAGCAGAGAACAGAGG - Intronic
1185317556 22:50185636-50185658 GAGCTGCGACCAGAGAACGTGGG + Intergenic
1185382078 22:50514141-50514163 AAGTTGGGACCATAGAGCAGAGG + Intronic
1185415981 22:50710483-50710505 GTGCTGGGGCCACAGGTCAGTGG + Intergenic
949388651 3:3535039-3535061 GAGGTGGCACCAGGGAGCAGGGG + Intergenic
949980717 3:9500385-9500407 GCGCTGGGACCAGAGCACTGCGG + Exonic
951067354 3:18282550-18282572 GAGCTGGAACCAGGGAGGAGAGG + Intronic
952327955 3:32337770-32337792 GGCCTGGGACCAGACATCATTGG + Intronic
953045914 3:39294184-39294206 GAGATGGGACCTGAAAACAGGGG - Intergenic
953449904 3:42997317-42997339 GAGCAGGGAGCAGAGGCCAGAGG - Intronic
953699394 3:45184205-45184227 GGGCTGGGGCCAGAAAGCAGAGG + Intergenic
954108669 3:48422457-48422479 GACCTGGGATCAGAGACCACAGG + Exonic
954542828 3:51406663-51406685 TAGAGGGGACCAGAGAGCAGCGG - Intronic
954711721 3:52508189-52508211 GAGATGGGGCCAGGGAGCAGAGG + Intronic
954933266 3:54302836-54302858 GAGCAGGGAGGAGAGATCACAGG - Intronic
955272733 3:57517921-57517943 GAGCTGGGACTACAGATGTGAGG - Intronic
955358052 3:58247948-58247970 GGGCTGGGGACAGAGATGAGAGG - Intronic
955419480 3:58722143-58722165 TAGCTGGGACCATTGACCAGAGG - Intronic
955656223 3:61247507-61247529 TAGGTGGAACCATAGATCAGGGG + Intronic
955784510 3:62522759-62522781 TAGGTGGAACCAGAGACCAGGGG - Intronic
956456041 3:69421234-69421256 GAGCTGGCACCAGAATTCAAGGG - Intronic
956612929 3:71142929-71142951 GAGGTGGGAAGAGAGATAAGGGG + Intronic
958592374 3:96174624-96174646 GAGCTGCAGCCAGAGATCACTGG - Intergenic
959166431 3:102784770-102784792 GAGCTGGTACCAGCCAACAGAGG + Intergenic
960709195 3:120510744-120510766 GAGCTGCAGCCAGAGATCACTGG - Intergenic
961934811 3:130571804-130571826 GAGCTGGGACTACAGATGTGTGG + Intronic
962455314 3:135559961-135559983 GAGCAGGGACCAAAGACAAGAGG - Intergenic
962648858 3:137467659-137467681 GAGCTGGGCCCAGAGCACCGCGG + Intergenic
962717187 3:138136841-138136863 GAACTGGGACCAGGCTTCAGTGG + Intergenic
963330497 3:143909982-143910004 GAGCTAGGACCTGGAATCAGGGG - Intergenic
963863612 3:150336164-150336186 GAGGTGGGAGCAGAGAGAAGAGG - Intergenic
963942374 3:151107976-151107998 GATTTGGGGCCAGAGATAAGTGG + Intronic
964546088 3:157835256-157835278 GAGCAGGGGAGAGAGATCAGTGG - Intergenic
965070142 3:163908594-163908616 GATCAGGGCCCAGAGATAAGAGG - Intergenic
967411424 3:189169965-189169987 GAGCTGGGAGGAGTGTTCAGTGG + Intronic
967606266 3:191450533-191450555 GAGCTGCAATCAGAGATCACTGG + Intergenic
968084993 3:195870218-195870240 GAGCTGGGTCAAGAGAGCAGGGG + Intronic
968486610 4:866003-866025 GTGTAGGGACCAGAGGTCAGAGG - Intronic
968712055 4:2126557-2126579 GAGCAGAGACCAGAGAGGAGCGG + Intronic
968712057 4:2126574-2126596 GAGCGGAGACCAGAGAGAAGCGG + Intronic
969028510 4:4193176-4193198 GACCTGGGAGCACAGAGCAGAGG - Intronic
969302781 4:6307095-6307117 GAGCTGGGCCCAGAGCTGGGTGG + Intergenic
969519474 4:7667538-7667560 GGGATGGGACCAGAAAACAGAGG - Intronic
970990705 4:22209907-22209929 GAGCTGGGGCCAGAGAGCTGAGG - Intergenic
971040392 4:22745254-22745276 GAGTTGGAAGCAGAGAGCAGGGG - Intergenic
971426379 4:26520057-26520079 GAGCTGGGAACTCAGAGCAGAGG - Intergenic
971735434 4:30443570-30443592 GAGCTGGGAACAGAGAAGAGAGG - Intergenic
974072496 4:57137068-57137090 GAGCTGCAGCCAGAGATCACTGG + Intergenic
975127185 4:70796066-70796088 TAGCTGGGACTAGAGACTAGAGG - Intronic
975329629 4:73099360-73099382 GAGCTGGGAACTGAGGCCAGGGG - Intronic
975906938 4:79224584-79224606 GAGACAGGAACAGAGATCAGAGG + Intergenic
977065072 4:92304286-92304308 GAGCTGGGACCGGAGACCCGCGG + Intergenic
978233161 4:106424792-106424814 CAGCTGGGTCCAGCCATCAGAGG + Intergenic
980469568 4:133233986-133234008 CAGCTGGGACTAGAGATTATTGG - Intergenic
981525800 4:145706017-145706039 GAGCTGCAGCCAGAGATCACTGG + Intronic
981588029 4:146325581-146325603 GCCCTAGGACCAGGGATCAGAGG - Intronic
983262419 4:165471274-165471296 GAGCTGTGGCCAGAGATCACTGG + Intronic
983773602 4:171578928-171578950 GAGCTGCAACCAGAGATCACTGG + Intergenic
985329981 4:188821425-188821447 GATCTGGGACCACAGATAACAGG + Intergenic
985381115 4:189396159-189396181 GAGCTGGAACCAGAATTAAGGGG + Intergenic
985552173 5:539352-539374 GATCGGGGACCAGAGGCCAGAGG + Intergenic
985923132 5:2995209-2995231 CAGGTGGGACAAGAGAACAGAGG - Intergenic
986290611 5:6396398-6396420 GAGCTGGAACCATAAATCACAGG - Intergenic
986939755 5:12936155-12936177 TATCTGGGATCAGGGATCAGTGG - Intergenic
988361197 5:30238975-30238997 GAGCTGCAGCCAGAGATCACTGG - Intergenic
989400074 5:40999372-40999394 CAGCTGGGAGCAAAGATCTGGGG + Intronic
991298022 5:65102148-65102170 AAGATGGGAGTAGAGATCAGGGG - Intergenic
992652714 5:78876623-78876645 GAGCTGAGTCCAGAGACCAAGGG + Intronic
993803717 5:92377121-92377143 TAGCTGGGACCACAGGTGAGAGG - Intergenic
994990451 5:106989914-106989936 GAGCAGAAACCAGAGAGCAGGGG + Intergenic
995837774 5:116415343-116415365 GAGGTGGTTGCAGAGATCAGAGG - Intergenic
996251855 5:121344991-121345013 GAGCTGAGAGCAGAGATAAAAGG - Intergenic
996472780 5:123879320-123879342 GAGCTGGCACTAGAGAACCGTGG + Intergenic
996708671 5:126522617-126522639 GAGCTGGGGCCAGAGGCAAGTGG - Intergenic
998184338 5:139967167-139967189 GTGCTGGGGCCAGGGATCATGGG + Intronic
1000010109 5:157223118-157223140 GAGGTGGGAGAAGAGAGCAGAGG + Intronic
1001042675 5:168348216-168348238 GAGCTGGTTCCTGAGCTCAGGGG + Intronic
1001090189 5:168734353-168734375 GAGTTGGAACCAGAGGTCAAGGG - Intronic
1001881256 5:175246158-175246180 GAGCTGGGAAAAGAAATCAGAGG + Intergenic
1003318710 6:5033956-5033978 GAGCTGGGACAAGAAAGCAGAGG - Intergenic
1003358741 6:5402799-5402821 GAGCAGGGACCACAGAAAAGTGG - Intronic
1005925398 6:30440487-30440509 GACATGGGATCAGAGATCAAGGG - Intergenic
1006382354 6:33706952-33706974 AGGCTGGGACCAAGGATCAGAGG + Intronic
1006474346 6:34245098-34245120 GAGCTGGGAACTGAGGCCAGGGG - Exonic
1006593889 6:35178774-35178796 AAGATGGGACCAGAAATCAAAGG + Intergenic
1006716875 6:36126075-36126097 GAGCTGGGGCCAGAGCTCTAGGG + Intergenic
1007091296 6:39186368-39186390 GAGCTGAGACCAAACCTCAGGGG + Intergenic
1007476505 6:42123060-42123082 GAGCTGGGTCCATAGAACAGTGG - Intronic
1009735395 6:67670312-67670334 GAGCTGCAGCCAGAGATCACTGG + Intergenic
1010567294 6:77431633-77431655 GAGTTGGGAGCAGAGGTGAGGGG + Intergenic
1010714732 6:79215326-79215348 GAACAGGGGCCAGAGGTCAGTGG + Intronic
1011480069 6:87784933-87784955 GAGCTGGAACAAGAGGTCAGAGG + Intergenic
1011667493 6:89648693-89648715 TAGCTGGGACCACAGATGTGGGG - Intronic
1013111452 6:107068421-107068443 GGGCAGGGACCAGAGGTTAGGGG - Exonic
1015303175 6:131677318-131677340 GAGCCAGCACCAGAGATCAGAGG + Intronic
1015509010 6:134018968-134018990 GAGTTGGTAGAAGAGATCAGGGG + Intronic
1015813213 6:137181427-137181449 GAGCTGCAGCCAGAGATCACTGG + Intergenic
1015818283 6:137232968-137232990 GAGGTGGGGGCAGAGATAAGTGG + Intergenic
1016598561 6:145829262-145829284 GAGCTGGGAAGAGAGCACAGTGG - Intergenic
1017106012 6:150888850-150888872 GAGCAGGTACCACAGATCAGTGG + Intronic
1017445355 6:154502584-154502606 GAGCTGGGACCAGGCCTCACAGG - Intronic
1018616891 6:165695375-165695397 GAGCTGGGAGAAGGGAACAGAGG - Intronic
1018655731 6:166033985-166034007 GAGCTGGGACCTGGGGGCAGGGG + Intergenic
1019126993 6:169847142-169847164 GAGCTGAAACCAGAGGGCAGTGG - Intergenic
1019586917 7:1810002-1810024 AAACTGGAACCAGAGAACAGGGG - Intergenic
1019732700 7:2636674-2636696 GGACTGGGACCAGCCATCAGGGG - Intronic
1020130845 7:5557869-5557891 GAGCTGGGTGCAGAGAGCTGTGG - Intronic
1020156000 7:5725386-5725408 GAGCTGTCACCAGAAACCAGTGG - Exonic
1021512759 7:21452028-21452050 GAGCTGTAGCCAGAGATCACTGG + Intronic
1022402010 7:30047513-30047535 GAACTGGGAGCAGAGCTAAGGGG - Intronic
1022456787 7:30564743-30564765 GAGCTGGGACTAGAAATGGGTGG + Intergenic
1023664090 7:42502264-42502286 GAGATGGGTTCAGTGATCAGGGG - Intergenic
1024454937 7:49594670-49594692 GAGCTGGGAGGACAAATCAGGGG + Intergenic
1024686370 7:51750425-51750447 GAGATGGGACCACAGATTTGAGG - Intergenic
1025145396 7:56496750-56496772 GGGCTGGGGCAAGAGAGCAGAGG + Intergenic
1026969590 7:74459887-74459909 GAGTTGGGATCAGGGCTCAGTGG + Intronic
1027420152 7:78011047-78011069 GAGCTGCAGCCAGAGATCACTGG - Intergenic
1027826166 7:83119051-83119073 GAGTTAGGACCTGGGATCAGGGG - Intronic
1029653926 7:101912050-101912072 GACCTGGGACCTGGGACCAGGGG + Intronic
1031239563 7:119219945-119219967 GGGTTGGGACCAAAGTTCAGTGG + Intergenic
1032858838 7:135858927-135858949 GAGCTGGGGCCATACTTCAGGGG - Intergenic
1033684405 7:143625184-143625206 GAGCTGGAACCACAGATGAAAGG + Intronic
1033687581 7:143704403-143704425 GAGCTGGAACCACAGATGAAAGG + Intronic
1033700206 7:143832439-143832461 GAGCTGGAACCACAGATGAAAGG - Intergenic
1034213883 7:149388375-149388397 GAGCTGGGGTCACAGAACAGGGG + Intergenic
1034274756 7:149819230-149819252 GAGCTGGGAGCAGAGAGGAAAGG + Intergenic
1034831707 7:154314150-154314172 GAGCTCGGATCAGAAGTCAGGGG - Intronic
1034895724 7:154875300-154875322 GAGCTGGGAGGAGAGCACAGTGG + Intronic
1034970567 7:155416849-155416871 GAGGTGGGACCTGAGTCCAGAGG + Intergenic
1035456371 7:159011602-159011624 GAGCCAGGACCACAGAGCAGGGG + Intergenic
1035481728 7:159192362-159192384 AAACTTGGACCAGAGGTCAGCGG - Intergenic
1035527500 8:325297-325319 GAGCTGGGTGTGGAGATCAGGGG - Intergenic
1038827515 8:31020938-31020960 GAGCTGGGGCCAGCAATCTGTGG + Intronic
1040831749 8:51684676-51684698 AATCTGGGTCCAGAGGTCAGAGG + Intronic
1041228457 8:55724660-55724682 GAGCTGCAGCCAGAGATCACTGG + Intronic
1041393761 8:57371768-57371790 GAGCTGCAGCCAGAGATCACTGG - Intergenic
1042314364 8:67409817-67409839 TAGCTGGGACCAGAGGCCTGTGG - Intergenic
1043815058 8:84792032-84792054 GGCCTGGGGCCAGAGACCAGGGG - Intronic
1044008909 8:86967426-86967448 GAGTTGGGACCAGAGCTCCCGGG - Intronic
1044795172 8:95889508-95889530 AAGCTGGGACCAGAGAATATAGG - Intergenic
1046387813 8:113526235-113526257 GAGCTGCAGCCAGAGATCACTGG - Intergenic
1046801843 8:118437251-118437273 AAGCAGGGGCCAGAGAACAGGGG + Intronic
1050604411 9:7285704-7285726 GAGCTGGGAGCATAGATTAAGGG + Intergenic
1051114883 9:13683322-13683344 GATCTAGGATCAGTGATCAGAGG - Intergenic
1051389720 9:16551314-16551336 TAGCTGGGACAGGAGAGCAGTGG - Intronic
1052399181 9:27979125-27979147 GAGCTGTGAACAGTCATCAGTGG + Intronic
1057458326 9:95235183-95235205 AAGGTGGCACCACAGATCAGTGG + Intronic
1057458335 9:95235238-95235260 AAGGTGGCACCACAGATCAGTGG + Intronic
1057458341 9:95235283-95235305 AAGGTGGCACCACAGATCAGTGG + Intronic
1057708090 9:97412191-97412213 GAGCTGGGCCCAGAGACGCGGGG + Exonic
1057846145 9:98526250-98526272 GAGGTGGGGCAAGAGATCTGTGG - Intronic
1058038827 9:100282442-100282464 AAGCTTGGACCCCAGATCAGGGG + Intronic
1058350878 9:104022449-104022471 GAGATATGACTAGAGATCAGAGG + Intergenic
1058652787 9:107192417-107192439 AAGCTGCTCCCAGAGATCAGGGG + Intergenic
1059218304 9:112588078-112588100 GAGCAGGGAGGAGAGAACAGTGG - Intronic
1059566113 9:115384935-115384957 GAGCTGTGGTCAGAGATCACTGG - Intronic
1059806699 9:117809085-117809107 AAGTTGTGCCCAGAGATCAGAGG + Intergenic
1060788512 9:126469298-126469320 GAGAAGGGTCCAGGGATCAGCGG + Intronic
1061190578 9:129080571-129080593 AAACTGAGACCAGAGAGCAGAGG - Intergenic
1062044405 9:134418401-134418423 GGGCTGGGACCAGAGCCCTGTGG + Intronic
1062489546 9:136798676-136798698 GAGCTGGGAGAAGGGATCAAAGG + Intronic
1185870785 X:3663190-3663212 CAGCAGAGATCAGAGATCAGTGG + Intronic
1188156457 X:26748569-26748591 GAGCTGGGAACTGAGGCCAGGGG - Intergenic
1190213914 X:48467831-48467853 GAGGTGGGCTCAGGGATCAGGGG - Intronic
1190946199 X:55096284-55096306 GGGCTGGGACCAGGGAGCTGCGG + Intronic
1192177185 X:68893423-68893445 GAGCTGGGACAGGACAGCAGGGG - Intergenic
1192315068 X:70044721-70044743 GAGCAGGGCCCAGAGAGGAGAGG - Intronic
1194159531 X:90433449-90433471 GAGCTGCAGCCAGAGATCACTGG + Intergenic
1195108407 X:101622798-101622820 GATCTGGGACTAGATTTCAGAGG + Exonic
1195360994 X:104084024-104084046 GAGCAGGGAGCAGGGAGCAGGGG + Intergenic
1195452040 X:105026025-105026047 GAGTTGGGACCAGGAATCTGCGG + Intronic
1200505832 Y:4010419-4010441 GAGCTGCAGCCAGAGATCACTGG + Intergenic