ID: 1166879575

View in Genome Browser
Species Human (GRCh38)
Location 19:45919574-45919596
Sequence GTGTAGCGACAGATTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166879572_1166879575 -6 Left 1166879572 19:45919557-45919579 CCTGGGGGTCTTGCAGTGTGTAG No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data
1166879562_1166879575 26 Left 1166879562 19:45919525-45919547 CCTGCCTAAGACCCCAAGGGAAA No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data
1166879563_1166879575 22 Left 1166879563 19:45919529-45919551 CCTAAGACCCCAAGGGAAAGCAG No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data
1166879565_1166879575 14 Left 1166879565 19:45919537-45919559 CCCAAGGGAAAGCAGCAGACCCT No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data
1166879566_1166879575 13 Left 1166879566 19:45919538-45919560 CCAAGGGAAAGCAGCAGACCCTG No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data
1166879564_1166879575 15 Left 1166879564 19:45919536-45919558 CCCCAAGGGAAAGCAGCAGACCC No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data
1166879571_1166879575 -5 Left 1166879571 19:45919556-45919578 CCCTGGGGGTCTTGCAGTGTGTA No data
Right 1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166879575 Original CRISPR GTGTAGCGACAGATTGAGGT GGG Intergenic
No off target data available for this crispr