ID: 1166882873

View in Genome Browser
Species Human (GRCh38)
Location 19:45939947-45939969
Sequence GGCCGCGGGGCTGCCCGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166882864_1166882873 26 Left 1166882864 19:45939898-45939920 CCTGCTCGTAGGTGACCCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 156
1166882866_1166882873 11 Left 1166882866 19:45939913-45939935 CCCGCTGACTGATGAGGTATTGA 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 156
1166882863_1166882873 27 Left 1166882863 19:45939897-45939919 CCCTGCTCGTAGGTGACCCGCTG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 156
1166882867_1166882873 10 Left 1166882867 19:45939914-45939936 CCGCTGACTGATGAGGTATTGAG 0: 1
1: 0
2: 0
3: 14
4: 87
Right 1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166882873 Original CRISPR GGCCGCGGGGCTGCCCGTGA TGG Exonic
900124751 1:1064461-1064483 GGCCGTGGGGGTGGCGGTGAGGG - Intergenic
900337000 1:2169322-2169344 GGCTGCGGGGCCGCTCGTGAAGG - Intronic
901002285 1:6154784-6154806 TGCCGCGGAGCTGCCCTTGAAGG + Exonic
901686998 1:10948561-10948583 GGCCTCGGGGCTGGCGGTGAAGG + Exonic
903184710 1:21622534-21622556 GGCGGCGGCGCTGCCTGCGATGG + Intronic
903669708 1:25028205-25028227 GGCTGGGGGGCTGCACGTGCTGG - Intergenic
904181370 1:28668905-28668927 GGCCGCGCGGCGGCCGGCGAGGG + Intronic
904750989 1:32741584-32741606 GGTCGTGGGGCCGCCCGGGAGGG - Intergenic
914803197 1:150974862-150974884 GGCCGGGAGGCTGGGCGTGACGG + Exonic
914901123 1:151711701-151711723 GGCTGCGGAGGTGCCTGTGAGGG - Intronic
915431215 1:155868470-155868492 GGCCCATGGGCTGCCAGTGATGG + Exonic
918015949 1:180632453-180632475 GGCAGCGGGGCTGCGGGGGAGGG - Intronic
920331451 1:205211317-205211339 GGCCCCGCCGCCGCCCGTGAGGG + Exonic
920929789 1:210376648-210376670 GGCCCCTGGGCTGCCTGTGACGG + Intronic
922234484 1:223712789-223712811 GGCCGAGGGGATGGCCGGGAAGG - Exonic
923514179 1:234680770-234680792 GGATGCGGGGCTGGCGGTGATGG + Intergenic
924763121 1:247007635-247007657 GGGCGCGGGGCTGCCCCGGGAGG + Intronic
1067296751 10:44979064-44979086 GGCCCTGGGGCTACCTGTGAGGG - Intronic
1068335766 10:55630861-55630883 GGGCGCGGGGCTGACCCTGCGGG - Intergenic
1070660644 10:78303202-78303224 GGCCGAGGGGCGGGCCGTGCCGG - Intergenic
1072787757 10:98295768-98295790 GGAGGAGGGGCTGCCTGTGATGG - Intergenic
1075629463 10:123992243-123992265 GGCGGCGGGGGTGCCCATGAAGG + Intergenic
1075786982 10:125056785-125056807 GTCCGCATTGCTGCCCGTGATGG - Intronic
1076262519 10:129078975-129078997 GGCTGCTGGGCTGCTCGTGAAGG + Intergenic
1077187370 11:1241349-1241371 GGCCGAGGGGGTGACCGTCACGG - Exonic
1077190757 11:1255176-1255198 GGCTGCGGGGCTGGCAGTGGGGG - Exonic
1079353514 11:19712872-19712894 GGCCGCCGCGCTTCCCGGGAAGG - Intronic
1083624201 11:64063728-64063750 GACCGCGTGGCTGCCCATGGAGG - Intronic
1083682296 11:64357232-64357254 GGCCCCGGCGCTGACCGTGGAGG - Exonic
1084471379 11:69361205-69361227 GGCCCCAGTGCTGCCAGTGAGGG - Intronic
1085561100 11:77473673-77473695 CGCCGCCGCGCTGCCCGTGGCGG + Exonic
1089755277 11:120681712-120681734 GGTTGCTGGGCTGCCTGTGACGG - Intronic
1090188117 11:124751566-124751588 GGCCCCAGGGCTGGCCGTGGAGG - Exonic
1103247738 12:119472511-119472533 GGCCCTGGGGCTGCCACTGAAGG - Intronic
1103922057 12:124404247-124404269 GGCCCCTGGGCTGCCCGGCATGG + Intronic
1104970268 12:132527770-132527792 GGCTGCGGGGCTGCCGGGCAGGG + Intronic
1105472191 13:20704081-20704103 GGCCGCGGGGCTGCGCGGACCGG + Exonic
1106227092 13:27793796-27793818 GGCGGCGGGGGTGCCGGTGGTGG + Exonic
1110630179 13:77698167-77698189 GGCCGCGGCGGTGGCCGTGGCGG - Intronic
1113542020 13:111115923-111115945 GGCGGCGGGGGTCCCCGGGAAGG + Intronic
1122582201 14:102777772-102777794 GGCCTCGGGGCTGCCCGGCGCGG + Intronic
1122624238 14:103075900-103075922 CGCCCCGGGGCTGCCCCTGTGGG + Intergenic
1122802687 14:104239522-104239544 GGCCTCTGGGCTGGCCCTGAAGG + Intergenic
1122921927 14:104883892-104883914 GGCCGCTGGGGTGCCCTTGGAGG + Exonic
1129675858 15:77632262-77632284 CGCCGCGGGGCTGCCCGCTCGGG + Intronic
1131514130 15:93066125-93066147 GCCCGGGGAGGTGCCCGTGAAGG - Intronic
1132365123 15:101251558-101251580 GGCGGCGGCGCTGCCCGGGCCGG - Exonic
1132537921 16:492453-492475 GGCCTCGGGTCTCCCCGGGAAGG - Intronic
1132621189 16:868946-868968 GGGCGGGGGCCTGCCCGCGAAGG + Exonic
1132915722 16:2342071-2342093 GGGCGCGGGGCTGGCGGTGCGGG - Intergenic
1133784374 16:8963430-8963452 GGCCCCGGGGCGGCCCGCGGCGG + Exonic
1136419313 16:30122449-30122471 GGCAGCGGGGCTGTCCCAGAGGG + Intronic
1136523730 16:30814478-30814500 GGCCGCGGCGCTGCCCGGGTTGG + Intergenic
1139546842 16:67653488-67653510 GGCCGCGGGCCGCCCCGAGACGG - Intronic
1141445323 16:84054424-84054446 GGCAGCCTGGCTGACCGTGAGGG - Exonic
1141848844 16:86630357-86630379 GGGCAAGGAGCTGCCCGTGAGGG - Intergenic
1141989689 16:87602779-87602801 CCCCGCGGGGCTGCCGGCGAGGG + Intronic
1142421450 16:89972844-89972866 GGCCGCGGGGGAGCGCGGGAGGG + Intergenic
1142901216 17:3013041-3013063 GGCTGCCGGGCTGGCTGTGATGG + Intronic
1143345128 17:6243614-6243636 GGCAGCAGGGCTGACAGTGAAGG - Intergenic
1144763981 17:17723071-17723093 GGCCGTGGGGCTGCGCATGTAGG - Intronic
1145777097 17:27536779-27536801 GGCCCTGGGCCTGCCCCTGATGG - Intronic
1146054050 17:29572514-29572536 GGGCCCCGGGCTGCCCGTGGAGG - Exonic
1151786164 17:76276026-76276048 GGCCGCAGGGCTGCTGGTCATGG + Intronic
1151969771 17:77451593-77451615 GGCCGCGAGGCGGACCCTGATGG + Intronic
1152070451 17:78131542-78131564 GGGCGCCGGGCTGCCGGTGGGGG - Exonic
1152321691 17:79611490-79611512 GGGCTTGGGGCTGCCCTTGAAGG - Intergenic
1152732123 17:81977568-81977590 GGCCGCGTGGCTGCGCGTCCTGG + Exonic
1152760677 17:82105650-82105672 GGCCCCGGGGCTGCCTTTGTGGG + Intronic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1155474826 18:26227014-26227036 GGCCGGGGCGCTGCCGGTGCGGG + Exonic
1160733489 19:651581-651603 GGCCCCGGGGGTGGCCGCGAGGG - Intronic
1160844453 19:1160278-1160300 GGGTGGGGGGCTGCCCATGAGGG - Intronic
1160894166 19:1395013-1395035 GGGCCCGGGGCTGCCCTGGACGG - Intronic
1160921869 19:1524382-1524404 AGCCGCGGGGCCTCCCGTGCGGG + Intronic
1160943115 19:1629275-1629297 GGCCCCGGGGCTCCCCGCCAGGG - Intronic
1161161105 19:2762278-2762300 GGCCGCAGGGCTGCCCGCGGAGG - Intronic
1161470213 19:4453473-4453495 GGCCTCGGGGCTCCCGCTGACGG + Exonic
1161703105 19:5805408-5805430 GGCCGCGCGGCCGCCACTGACGG + Intergenic
1162050698 19:8030836-8030858 GGCTGCGCTGCTGGCCGTGAAGG + Intronic
1162061365 19:8097431-8097453 GGGGGCTGGGCTGCCCCTGATGG - Intronic
1163104623 19:15116173-15116195 GGCCGCGGGGCTGTACCAGATGG + Exonic
1163242005 19:16070144-16070166 GGCAGGTGGGCTGCCCGTGGTGG + Intronic
1163424916 19:17235995-17236017 GCCCGGGGGGCTGCCCGAGGAGG + Exonic
1166126303 19:40717177-40717199 GGCCGGGGCGCTGCCCGCGGCGG + Exonic
1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG + Exonic
1167035586 19:46993398-46993420 GGCAGCCTGGCTGCCAGTGATGG + Intronic
1167399428 19:49255187-49255209 GGTAGCGGGGCTGGCCGTCAGGG + Intergenic
927483051 2:23469348-23469370 GGCAGCTGGCCTGCCCGTCAGGG + Intronic
930014187 2:46959259-46959281 GACCGAGGGGCTGCCTGGGAAGG - Intronic
930124038 2:47782887-47782909 CGCCGCGGGGCTGGCCGGGCCGG - Intronic
932735637 2:74252260-74252282 GGCGGCGGGGCTGGCAGTGGCGG - Exonic
934045442 2:88169865-88169887 GGCCGCGGGGCTGGGCGCGGTGG + Intergenic
934133211 2:88969628-88969650 GGCCGCAGGGCTGCCTGGCAGGG + Intergenic
935645316 2:105329640-105329662 GGCCGCGGGGCGGCGCGGGACGG - Exonic
941448909 2:165635183-165635205 GGCCCCTGGGGTGCCCGTGAGGG + Intronic
948462691 2:238138042-238138064 GGCCTCGGGGCTGCCCAGGACGG - Intergenic
948597920 2:239092360-239092382 GGCCCCGAGGCTGCCCCTGTGGG + Intronic
948805714 2:240452822-240452844 GGCTGCGGCGCTGCCCGGGGTGG + Intronic
948835221 2:240623103-240623125 GGCCGCGGGGCTGCGAGTGCCGG - Intronic
948843708 2:240672881-240672903 GGCCGCTGGGCTGCCGCTGGAGG + Intergenic
1171376123 20:24695122-24695144 GGCCGTGGAGCTGCCAGGGAGGG - Intergenic
1174804634 20:53594329-53594351 GGGGGCGGGGCGGCCGGTGAAGG - Intronic
1176179547 20:63742870-63742892 CGCCGCGGGGCTTCCTGTGCGGG - Exonic
1176215304 20:63944981-63945003 GGATGCGGTGCTGCCCGTCAGGG + Intronic
1176546673 21:8205338-8205360 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1176554568 21:8249528-8249550 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1176565624 21:8388385-8388407 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1176573489 21:8432553-8432575 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1177792517 21:25735649-25735671 GGCCGCGGGGGGGCCCTTGTGGG - Intronic
1178561628 21:33643274-33643296 CGCCGCGGGGCCGCCCCTGAAGG + Intronic
1179040898 21:37801505-37801527 TGCCCTGGGGCTGCCCGTGAGGG - Intronic
1179973761 21:44851426-44851448 GGCCGGAGAGCTGCCCCTGAAGG - Exonic
1180075722 21:45460486-45460508 GGCCACGGGAGTGCACGTGAAGG + Intronic
1180535891 22:16392443-16392465 GGCCACGTGGCTGCATGTGAGGG + Intergenic
1183217552 22:36490609-36490631 GGCCGAGGGTCTGCTCATGAAGG - Intronic
1184184783 22:42857274-42857296 GGGGGCGGGGCTGCGCGTAACGG + Exonic
1184736071 22:46398465-46398487 AGCCTCGGAGCTGCCTGTGAGGG + Intronic
1185188552 22:49418065-49418087 GGCCGCGCGGGTGCACGTGTGGG - Intronic
1203251538 22_KI270733v1_random:121604-121626 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1203259588 22_KI270733v1_random:166686-166708 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
953246550 3:41199240-41199262 GGCCTGAGGGCAGCCCGTGAGGG - Intronic
953883426 3:46702888-46702910 GGCCTCAGGGCAGCCTGTGAGGG - Intronic
954106198 3:48410973-48410995 GGCCCAGGGCGTGCCCGTGAAGG - Exonic
960925997 3:122795291-122795313 GGCGGCGGCGCTGCCCGCGGCGG + Exonic
962677064 3:137765102-137765124 GGCGGCTGGCCTGCCCGTGGGGG + Exonic
966696328 3:182793699-182793721 GGCCGCGGGGCTGCAGGTGGAGG - Exonic
967976204 3:195035986-195036008 GGGCGCAGGGCTGCCCGTGCAGG + Intergenic
968082113 3:195853838-195853860 GGCCTCGGGGCTGCCTGTGGAGG - Intergenic
969116953 4:4876489-4876511 GGCAGGGGGGCAGCCCGGGAAGG - Intergenic
975495685 4:75033874-75033896 GGCGGCGATGCTGCCTGTGAAGG - Exonic
997297382 5:132776781-132776803 GCCCGCGGGGCCGCAGGTGAGGG - Intronic
1002385060 5:178860274-178860296 GGCACCGGAGCGGCCCGTGAGGG - Intronic
1002429070 5:179192614-179192636 GGCCTGGGGGCTGCCCATGCTGG - Intronic
1002465644 5:179407120-179407142 GGTCCCTGGCCTGCCCGTGATGG - Intergenic
1002896193 6:1381944-1381966 GCCCGCGGGGCTGCCCGGCGCGG - Intergenic
1004690286 6:17987515-17987537 GGCGGCGGCGCCGCGCGTGAGGG - Exonic
1006089637 6:31620806-31620828 GGCCTAGGGGCTCCCCGGGACGG - Exonic
1006097265 6:31663967-31663989 GGCCGTGGGGCTGCCTGGGTGGG - Exonic
1006133998 6:31884749-31884771 GATGGCGGCGCTGCCCGTGAAGG + Exonic
1006671396 6:35731822-35731844 AGCGACGGGGCTGCCCGGGAAGG - Intergenic
1006717274 6:36128701-36128723 GGCTGCAGGACTGCCCGGGAGGG + Intronic
1006837176 6:37005985-37006007 GAACGCGGGGCTGCCCCTGCAGG - Intronic
1006925215 6:37650241-37650263 GCCCTCGGGGCTGCCCCTGGAGG - Exonic
1013230443 6:108157514-108157536 GCCCTCGGGGATGCCCGAGAGGG - Intronic
1014517632 6:122399557-122399579 GGCCGGGCGGCCGCACGTGACGG - Exonic
1015366372 6:132401538-132401560 GGCCGCGCGCCCGCCCGGGAGGG + Exonic
1016863798 6:148747192-148747214 GTTCGGGGCGCTGCCCGTGACGG - Intergenic
1019293112 7:259989-260011 GGCCGCTGCGCTGCCCGGGACGG + Exonic
1019379327 7:712766-712788 GGCCGCGGGGCCGCCTCTGATGG + Intronic
1019404569 7:876887-876909 GGCCGCGCCGCTGCCCGTCGCGG + Intronic
1019774705 7:2905719-2905741 GGAAGCGGGGCTGCCCTTTAGGG + Intergenic
1020099920 7:5388935-5388957 GGACGTGGGGCTGCCCGCGCTGG - Exonic
1020431530 7:8120923-8120945 TGCGGTGGGGCTGCCCGTGAAGG + Intronic
1021125915 7:16851095-16851117 GGCAGCAGGGCTGGCCCTGAGGG + Intergenic
1025829816 7:65038781-65038803 GGCCGCGAGGCAGCCGGGGAGGG + Intergenic
1025917071 7:65873781-65873803 GGCCGCGAGGCAGCCGGGGAGGG + Intronic
1030820466 7:114086345-114086367 GGCCGCGGAGCTGCACGCGCCGG - Intronic
1034491583 7:151395857-151395879 GGCGTCGGTGCTGCCTGTGAAGG + Exonic
1035765951 8:2105540-2105562 GGCTGCTGGGCTTCCCCTGAGGG + Intronic
1036691817 8:10949136-10949158 GGCCCCGGGGCTGCCTCTGCAGG + Intronic
1036710906 8:11077936-11077958 GGCCGCCGGGCTGGCCCTGCTGG + Intronic
1037752652 8:21692799-21692821 GGCAGCGGGGCTGGCCATGAGGG - Exonic
1042050104 8:64694532-64694554 GGCCTCGGGACTGCCTGTGCTGG + Intronic
1045516338 8:102863750-102863772 GGACGCGGGGCTGGCCTTGGGGG - Intronic
1049302138 8:141877106-141877128 GGGCGAGGGGCTGCCAGAGAAGG + Intergenic
1049710213 8:144060015-144060037 GCCCTCGGGGCTGCCCATGGTGG + Exonic
1049762218 8:144336730-144336752 GGCCGCGGTGCTGCCCAGGCCGG - Intergenic
1050294955 9:4195578-4195600 GGCCGCGTGGGAGCCCGTGGAGG - Intronic
1057869780 9:98708910-98708932 GGCAGCGGCGGCGCCCGTGACGG + Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061261339 9:129482501-129482523 GGCCGCGGGGCTGTGCGTGCCGG + Intergenic
1061908384 9:133710410-133710432 GGGCTCCGGGCTGCGCGTGAGGG - Intronic
1203467940 Un_GL000220v1:104755-104777 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1203475761 Un_GL000220v1:148727-148749 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1192510485 X:71718059-71718081 GGCTCCGGGGCTGGCCGTGCGGG + Exonic
1192516212 X:71763494-71763516 GGCTCCGGGGCTGGCCGTGCGGG - Exonic
1196669134 X:118346769-118346791 GGCCGGGAGGCTGCCCGAGGTGG - Intronic
1200112051 X:153745319-153745341 GGCCACGTGGCTGCATGTGAGGG + Intergenic