ID: 1166883442

View in Genome Browser
Species Human (GRCh38)
Location 19:45942995-45943017
Sequence AGGGACTGACTCTCCATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166883442_1166883446 -1 Left 1166883442 19:45942995-45943017 CCCACAATGGAGAGTCAGTCCCT No data
Right 1166883446 19:45943017-45943039 TCACAAGAAAGAGCTGTCCCAGG 0: 1
1: 0
2: 2
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166883442 Original CRISPR AGGGACTGACTCTCCATTGT GGG (reversed) Intronic
No off target data available for this crispr