ID: 1166886632

View in Genome Browser
Species Human (GRCh38)
Location 19:45965223-45965245
Sequence TTGAAGAAGCAGAGAGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1222
Summary {0: 1, 1: 0, 2: 13, 3: 132, 4: 1076}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166886632 Original CRISPR TTGAAGAAGCAGAGAGAGGA CGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901416334 1:9119413-9119435 GTGAAGACGCAGGGAGAAGATGG + Intronic
901920943 1:12537210-12537232 TTCAAGAAGGAGAGAGTGGCTGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902936361 1:19767661-19767683 ATGAAGAAGCAATGAGAGAAAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903385458 1:22923319-22923341 TCCAGGAAGCTGAGAGAGGATGG + Intergenic
903542358 1:24103934-24103956 TTAAAGAATCAGAGAGATGGAGG - Intronic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904285827 1:29452764-29452786 TTCAAGAAGAAGAGAGGTGAGGG + Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904944585 1:34189938-34189960 TGGAAGAAGGAGAAAGAGCAAGG - Intronic
904977435 1:34467982-34468004 TTGAGGAAGTAAAGAGAGGTTGG - Intergenic
905295483 1:36951825-36951847 GGGAAGAAGCAGAGAGAAGGAGG + Intronic
905324753 1:37143410-37143432 GGGAAGAAGAGGAGAGAGGAGGG + Intergenic
905373066 1:37497065-37497087 TAGAAGAAACAGAGAAAGAAAGG + Intronic
905602247 1:39263256-39263278 TTGAAGGAGAAGGGAGAGGCTGG + Intronic
905602764 1:39268529-39268551 TGGAAGAGACAGAGAGAGGCGGG + Intronic
906155918 1:43613825-43613847 TTTCAGGAGCACAGAGAGGAGGG + Intronic
906220807 1:44077692-44077714 TTGAAGAAGCAGAGATCACACGG - Intergenic
906362691 1:45177075-45177097 TTCAGGAACTAGAGAGAGGAGGG + Intronic
906373705 1:45276476-45276498 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906815738 1:48876408-48876430 ATCAAGAGGCAGCGAGAGGAAGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907474247 1:54695069-54695091 GTCAGGCAGCAGAGAGAGGAAGG - Intronic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
908926660 1:69263973-69263995 TTACAGAAGCAAAGAGATGATGG + Intergenic
908992596 1:70111230-70111252 CTGAAGAAGAAAAGAGTGGATGG - Intronic
909683488 1:78319374-78319396 TGCAAGAGGCAGTGAGAGGAGGG + Intronic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
909837713 1:80277360-80277382 CAGAAGAAGCAAAGAGAGGTGGG - Intergenic
909899066 1:81109908-81109930 TAGAAGAAAAAGAGAGATGATGG + Intergenic
909926529 1:81444057-81444079 TTGCAGAAGCTGAGAGAAGTAGG + Intronic
910002128 1:82353859-82353881 TGGAAGCAGGAGAGAGAGGGAGG + Intergenic
910199434 1:84683480-84683502 TTCTAGAAGCACAGAGAGAAGGG - Intronic
910579332 1:88805156-88805178 TTGAGAAAGTAGTGAGAGGATGG - Intronic
911327145 1:96481463-96481485 TAGAAAACCCAGAGAGAGGAGGG - Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912504379 1:110146047-110146069 TTGAGGAAGCACACAGAAGATGG - Intergenic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
913008399 1:114657905-114657927 CTAAAGAAGGAGAGAGAGCATGG + Intronic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913455916 1:119030608-119030630 TAGAAGAAAAAGACAGAGGAAGG + Intergenic
913663690 1:121028643-121028665 TTGTAGAAGCAAAGAGAAGTAGG - Intergenic
914015088 1:143811924-143811946 TTGTAGAAGCAAAGAGAAGTAGG - Intergenic
914162733 1:145149301-145149323 TTGTAGAAGCAAAGAGAAGTAGG + Intergenic
915064904 1:153216967-153216989 GTGAAGGGGAAGAGAGAGGAAGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915660873 1:157403893-157403915 TGGAGGAGGCTGAGAGAGGAAGG - Intergenic
915713160 1:157920399-157920421 CTGAAGGAGCAAGGAGAGGAAGG - Intergenic
915816301 1:158969693-158969715 TTGAAGTAGCAGAGAGTAAATGG - Intronic
915864903 1:159488907-159488929 CTGAAGAAGACAAGAGAGGATGG + Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
916889239 1:169100570-169100592 CTGAAGAAGCAGAGAAAGTCAGG + Intergenic
917090937 1:171352534-171352556 TACAAGATGCAGAGAGAGAAAGG - Intergenic
917261112 1:173171174-173171196 TAGAAGGAGCAGACAGAGAAAGG - Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917462638 1:175245619-175245641 TTGCAGAAGCAAAGAGATCAGGG - Intergenic
917615392 1:176738309-176738331 TTAAAGAAGGAGAGAAAGAAGGG + Intronic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
917904689 1:179576729-179576751 TTGAAGAATCATAGGCAGGAAGG + Intergenic
918331242 1:183462984-183463006 TTGAAAAAGCAGAGAAAGATGGG + Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918437490 1:184531324-184531346 TGAAAGAAGGAGAGAGAAGATGG - Intronic
918936434 1:190928270-190928292 TTAGAAAAGCAGAGAGATGATGG - Intergenic
919427417 1:197449935-197449957 TTGAAGAACCAGAGAAAAGAGGG - Intronic
919496791 1:198282704-198282726 ATGAAGATGCAGAGAAAGAAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919846094 1:201643143-201643165 GGGAAGAAAGAGAGAGAGGAAGG - Intronic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920574336 1:207046951-207046973 CTGAAGTAGCAAAGAAAGGAAGG + Exonic
920759052 1:208763927-208763949 GTGAGGCAGCAGAGAGAGGGAGG - Intergenic
920765407 1:208827985-208828007 TTGAAGAAGCAGACAAGGCAGGG + Intergenic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921692564 1:218166434-218166456 TGAAATCAGCAGAGAGAGGAGGG + Intergenic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
921822054 1:219628552-219628574 TTGAAGCAGAATAGAGAGCAAGG + Intergenic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922095495 1:222439800-222439822 TTGAAAAAGCAGAAAGTGAAAGG + Intergenic
922297724 1:224266232-224266254 AGAAAGAAGCAGAGAGAGGGGGG - Intronic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
922894430 1:229089283-229089305 TTGAGGAGGGGGAGAGAGGAGGG + Intergenic
922929813 1:229380330-229380352 TTGCAGAAGGAAAGAGGGGAGGG + Intergenic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923408114 1:233683211-233683233 TTGGTGAAGGAGAGAGATGAAGG + Intergenic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924634078 1:245768274-245768296 TTAAACAAGCAGAGAAAAGAAGG + Intronic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1063672342 10:8109430-8109452 ATGAAGACGCAGAGATAAGAAGG - Intergenic
1063913402 10:10855070-10855092 TTCAGGAACCAGAGAGAGGCTGG - Intergenic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065545233 10:26812724-26812746 GTGAAGACGCAAAGAGAAGATGG - Intronic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1066432410 10:35363815-35363837 CTGAAGGTGCAGAGAGAGGGAGG + Intronic
1067205588 10:44209314-44209336 TTGAACAAGCATAGAGGTGAAGG - Intergenic
1067278027 10:44851683-44851705 TTGAAGACACAGGGAGAAGATGG - Intergenic
1067714234 10:48674223-48674245 TTGAAAAAAGAGAGAGAGGCTGG - Intergenic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1067784988 10:49239329-49239351 TTGAGCAAGCAGGGAGAGGATGG + Intergenic
1067965392 10:50906617-50906639 TTTAGGAAGCATAGAGGGGATGG + Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068112644 10:52697856-52697878 TTGAAGATGCAGAGAAACAATGG - Intergenic
1068268546 10:54687783-54687805 TTAAAGGAGCAGAGAGAGATTGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068731012 10:60357861-60357883 TTGCAGAAGGAGAGAGAGTAGGG - Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070395456 10:76008093-76008115 TTGAAGAAGCAGGGAGGGCGGGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070491505 10:76981161-76981183 TTGGGGAAGGAGAGAGAGTATGG - Intronic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1070629340 10:78073646-78073668 TTGAAGACCCTGAGAGAGGAAGG - Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072085758 10:92077750-92077772 GGGAAGAAGAGGAGAGAGGATGG + Intronic
1072450389 10:95534882-95534904 TTGGGGAAGCACAGAGTGGAGGG - Intronic
1072723264 10:97793919-97793941 ATAAAGAAAAAGAGAGAGGAAGG - Intergenic
1073502118 10:103949638-103949660 TATAGGAAGCAAAGAGAGGAGGG + Intergenic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073603071 10:104865624-104865646 TTGATGAAGCATAGAGAAGTAGG + Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1073685199 10:105745058-105745080 TTGAAGAATGAGAGAGAGAAGGG + Intergenic
1073752815 10:106549172-106549194 TTGAAGAAAAAGAGAGACAAAGG - Intergenic
1074383380 10:112998040-112998062 TAGAAGATGCAGAGAGTGAAGGG + Intronic
1074454291 10:113583852-113583874 TTGAGGAAGGAGAGAGAGGTGGG - Intronic
1074614083 10:115048899-115048921 TTGAAGATGCAGTGAGAAGCTGG + Intergenic
1074723367 10:116283241-116283263 TTCTAGAAGCAGAGATAGAAAGG + Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1075265602 10:120997858-120997880 TTGAAGAAGCACAGCTGGGAAGG - Intergenic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1076233427 10:128842260-128842282 TTCCAGAAGGAGAGAAAGGACGG + Intergenic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1077479332 11:2806284-2806306 GTGAGGAAGAAGAGAGGGGAGGG + Intronic
1077578364 11:3401523-3401545 TTGGGGAAGCTGGGAGAGGAGGG + Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078572932 11:12475097-12475119 TTGAAGAGGCAGCTAGAGCAAGG - Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079568138 11:21908476-21908498 TTAAAGAAGGAAAGAGAGGGAGG - Intergenic
1080143717 11:28953736-28953758 TTGAAGAAAGAGAGAGAGATGGG - Intergenic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080825957 11:35849643-35849665 GTGAAGATGCAGGGAGAAGATGG - Intergenic
1081004440 11:37717405-37717427 TTGAAGAGACAGAGAGAGTGGGG + Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081633122 11:44702759-44702781 TAGAAACAGCAGAGAGATGAGGG + Intergenic
1082785817 11:57315857-57315879 TCGATGCAGGAGAGAGAGGAGGG - Intronic
1082937614 11:58670673-58670695 TGCAAAAAGCAGAGAGGGGAAGG - Intronic
1083059296 11:59852837-59852859 TTGAACATGTAGAGAGAGAAGGG + Exonic
1083127244 11:60582812-60582834 TTGAATAAGGTGAGAGATGAGGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083751461 11:64763173-64763195 TGGCAGAATCAGAGAGAGAAAGG - Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084370668 11:68740530-68740552 CTGAAACAGCAGAGAAAGGAAGG + Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084465199 11:69319250-69319272 ATGAAGAATATGAGAGAGGAAGG - Intronic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085461899 11:76699080-76699102 GTGAGGAAGAAGAGAGAGAAGGG - Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1085770902 11:79325105-79325127 TGGAAGAGAGAGAGAGAGGAAGG + Intronic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1086070431 11:82793356-82793378 TAGAAGGAGGAGAGAGAGCATGG - Intergenic
1086134097 11:83429688-83429710 CTGAGGAAGCTAAGAGAGGAAGG + Intergenic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086268858 11:85035231-85035253 TTGAAACAGCAGATAGAAGATGG + Intronic
1086407727 11:86513170-86513192 GATAAGAAGGAGAGAGAGGAGGG + Intronic
1086572537 11:88302056-88302078 TTGAAGGAGCAGAGAGAGAGAGG - Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087042254 11:93813018-93813040 TTGAAAAAGCAGAGAGCTGATGG - Exonic
1087271270 11:96114470-96114492 TTGCAAAAGCAGAGATAGGTGGG - Intronic
1087409853 11:97777671-97777693 TTTAAGACGGGGAGAGAGGATGG + Intergenic
1087578488 11:100021976-100021998 TGGAAAAAGCAGGGAGAAGAAGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1088058444 11:105612652-105612674 AGGAAGAAGCAAAGAGAGGGAGG - Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088750450 11:112838064-112838086 TGGAGAAAGCAGAGAGAGGCAGG + Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089419363 11:118319588-118319610 TTAAAAAGGCAGAGAGAGAAAGG - Intergenic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1089961644 11:122622212-122622234 TTTAAGAAACAGAGAGAGCAGGG + Intergenic
1090122751 11:124049953-124049975 GTGAAGAATAAGAGAGATGATGG - Intergenic
1090259595 11:125309167-125309189 AGGAAGAAAGAGAGAGAGGAAGG - Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090446729 11:126770806-126770828 TGGAAGGGGCAGAAAGAGGAAGG + Intronic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1090898894 11:131007560-131007582 GGGAGGTAGCAGAGAGAGGAAGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091448807 12:560122-560144 GAGAAGGGGCAGAGAGAGGATGG + Intronic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091661655 12:2388528-2388550 ATGAAGAATCTGAGAGAGGTAGG + Intronic
1091947542 12:4561916-4561938 TTGAAGAAGGGGAGAGAGTAGGG + Intergenic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092531410 12:9348674-9348696 GTGAAGGAGCAGAGAGAGTCAGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092733406 12:11556237-11556259 TGCAGGAAGCAGAGAGAGCAGGG + Intergenic
1093196184 12:16132044-16132066 TTGACCAAGCAGAGAGAGAATGG - Intergenic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1093482570 12:19619787-19619809 TTGAAGGAGAATAGAGAGAAAGG - Intronic
1094077090 12:26489303-26489325 TGGAAGAGGCAGAGAAGGGAAGG + Intronic
1094123831 12:27001621-27001643 TTGAAGGAAAAGAGAGAGGATGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095489538 12:42718593-42718615 TTTAAGGAGGAGAGAGAGAAAGG - Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1096401740 12:51313169-51313191 TTGAGGTTGCAGTGAGAGGAAGG + Intronic
1096404943 12:51336912-51336934 TTGAAGAAGACAAGAGAGGCAGG - Intronic
1096638941 12:52978950-52978972 TTCAAGAAGGAGGGAGAGGCTGG - Intergenic
1096741615 12:53697577-53697599 GTGAAGAGCCAGAGAAAGGAAGG - Intergenic
1096742237 12:53702303-53702325 TGGAGGAAGCACTGAGAGGAGGG - Intergenic
1096939879 12:55331671-55331693 TGGAAGAAGGAGAGAGAGAAAGG + Intergenic
1097397844 12:59097731-59097753 GGGAAAAAGAAGAGAGAGGAGGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098080130 12:66775175-66775197 TTTAAGGAGCACAGAGAGGGAGG + Intronic
1098244395 12:68501303-68501325 TGAAAGTAGCAGAGAGAGGACGG + Intergenic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1098307751 12:69118460-69118482 TGGAGGATGAAGAGAGAGGAGGG - Intergenic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1098460794 12:70731024-70731046 GAGAGGAAGGAGAGAGAGGAAGG + Intronic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099044600 12:77700177-77700199 TTGAAGAAAGAGTGAGAGGTGGG + Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099313315 12:81054610-81054632 TTGAAGAAGGTAGGAGAGGAAGG - Intronic
1099415786 12:82384417-82384439 TTAAAGATTCAGAGAGAGGGAGG - Intronic
1099837596 12:87927011-87927033 TTTAAGAAGAAGAGGGAGCATGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1099972650 12:89515859-89515881 TTGAATAAGGAGAGAAATGAAGG - Intronic
1099975620 12:89542838-89542860 TTGAAGAAGAGGAGAGAGGTTGG - Intergenic
1100001047 12:89835550-89835572 TTGAAGAAGGAGGCAGGGGATGG + Intergenic
1100633348 12:96409958-96409980 TTGAGGAAGTAGAGGGAGAAGGG - Intergenic
1100916002 12:99422673-99422695 AGGAAGAAGAAGAGAGAGAATGG + Intronic
1101745732 12:107540040-107540062 GTGAAGATGCAGAGAGATGTAGG + Intronic
1101814084 12:108131736-108131758 ATGAGAAAGCAGAGAGAGGGCGG - Exonic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102115787 12:110402255-110402277 ATGAAGTCGCAGAGAGTGGAGGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103038190 12:117673282-117673304 TTGATGAAGGACAGAGAGGATGG + Intronic
1103046964 12:117744152-117744174 TTCAAGCAGCAGAGGCAGGATGG - Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1104083999 12:125458037-125458059 TTGAAGAAGGAGGCAGAGGGTGG + Intronic
1104374243 12:128250004-128250026 TCCAACAAGAAGAGAGAGGAAGG - Intergenic
1104641516 12:130470214-130470236 TTGTAGGATCAGAGAAAGGAGGG - Intronic
1105416827 13:20220699-20220721 TTAAAAAAGGAGAGAGAGAATGG + Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106600306 13:31181672-31181694 TGGAAGCAGCACAGAAAGGATGG - Intergenic
1106777983 13:33026892-33026914 ATCAAGAAGCAGAGAGAAGCTGG - Intronic
1107094341 13:36518598-36518620 TTGAAGACACAGTGAGAAGATGG - Intergenic
1107107448 13:36660448-36660470 CTTAAGAAGCTGAGAGAGAATGG + Intergenic
1107160578 13:37222597-37222619 TTGAAGATGCAGAAAAAGAATGG - Intergenic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107666924 13:42700159-42700181 CTGAAGAAGTAAAGACAGGAAGG + Intergenic
1107736903 13:43408311-43408333 TTGAAGAAGCAGTGAGGAAAGGG + Intronic
1107777611 13:43862992-43863014 TTTAAAAAGGAGAGAGAAGAAGG - Intronic
1108216920 13:48194519-48194541 TTAAAGAGTCAGAGAGAGAAGGG - Intergenic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108439740 13:50438765-50438787 TTGATGAAGGTTAGAGAGGAGGG + Intronic
1108732148 13:53246327-53246349 GTGAAGAAGAGGAGAGAGAAAGG - Intergenic
1108969332 13:56352518-56352540 TTGAAGGAGCAGGGAAAGAAAGG - Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109333243 13:60958360-60958382 TAGAAAAAGCAGACAGAAGAAGG + Intergenic
1109341914 13:61073315-61073337 TTGAAGGAGGAGAGAGAGCTGGG + Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110334940 13:74316814-74316836 TCAAGGAAGGAGAGAGAGGAAGG + Intergenic
1110468554 13:75830868-75830890 TTGAAGAATAAAAGACAGGATGG - Intronic
1111226984 13:85287718-85287740 GTGAGGCAGGAGAGAGAGGAGGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112036441 13:95500925-95500947 TGGAAGAAGCAGAGAGGGCGCGG + Intronic
1112126267 13:96471753-96471775 TTTAAGAAGCAGAGGTTGGAGGG + Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1112749534 13:102567951-102567973 TGGAAGAAGCTGGGAGAGGGAGG - Intergenic
1112892460 13:104255111-104255133 TTGAAGAAGCAGCGATAAGTGGG + Intergenic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113360552 13:109627159-109627181 GTGAAGAGGGAGAGAGATGATGG - Intergenic
1113991164 14:16029376-16029398 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115197468 14:30816867-30816889 GTGAAGAAAGAGAGAGAGGTAGG - Intergenic
1115995162 14:39188523-39188545 TAGAGGAAGCAGAGAGGTGAAGG + Intergenic
1116113522 14:40618396-40618418 CTTAAGAAGCAATGAGAGGAAGG + Intergenic
1116141999 14:41008513-41008535 TTGAAAAGGAAGAGAGAGAAAGG - Intergenic
1116384185 14:44310524-44310546 TTGAAGAAGTATACAGAGCAAGG - Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116964194 14:50997765-50997787 TTGAAGAAGCTGAAAAATGAAGG - Intronic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117218200 14:53573879-53573901 TTCAAGGAGGAGAGAGAGAATGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117389247 14:55247446-55247468 TTAAAGAGAGAGAGAGAGGAGGG + Intergenic
1117570487 14:57044334-57044356 TTGAAGAAAGAAAGACAGGAAGG + Intergenic
1117611101 14:57484332-57484354 GTGAAGATGAAGAGAGAGGTTGG + Intronic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1118231036 14:63950116-63950138 TGGAAGAAGCACAGAGAGGAAGG - Intronic
1118689771 14:68326955-68326977 TTGAAGGAGCAGAGTGATGTTGG - Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1118918648 14:70129782-70129804 TTCAAGAGGCAGAGAAAGGAGGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119420421 14:74504907-74504929 TGAAAGAAGGGGAGAGAGGAAGG - Intronic
1119476910 14:74935563-74935585 TTGAGGATGGAGAGAGAGAAGGG - Intergenic
1119477449 14:74939337-74939359 TTGAAGAGGCAGAGACAGACAGG - Intergenic
1119484150 14:74977482-74977504 TGGAGGAAGCAGAGAAGGGAAGG - Intergenic
1119497387 14:75091809-75091831 TTAAAGAAGCAGAGTAAGCATGG - Intronic
1119890329 14:78177642-78177664 TTAAAGGAATAGAGAGAGGAAGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120108365 14:80522739-80522761 TTGAAACAGCTGAGACAGGAAGG + Intronic
1120540245 14:85742218-85742240 TTTCAGAAGCAGAGAGAGAGAGG - Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120680681 14:87477412-87477434 AGCAGGAAGCAGAGAGAGGAGGG + Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1120959703 14:90113634-90113656 TAGAAGAAACTGAGAGAGGCCGG + Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121447458 14:93988001-93988023 TGGAAGGAGGAGTGAGAGGAGGG + Intergenic
1121554094 14:94823262-94823284 TTAAAGAAGCTCAGAGAGGTTGG + Intergenic
1121564380 14:94897763-94897785 TTGCAGAATGAGAGAGTGGAGGG - Intergenic
1121568224 14:94926411-94926433 TTGACGAGCCAGGGAGAGGAGGG - Intergenic
1121718515 14:96093008-96093030 TTTCAGAATCAGAGATAGGATGG - Exonic
1122018190 14:98814811-98814833 TTAAAGATGCAGAGACAGGCTGG + Intergenic
1122297537 14:100713804-100713826 TGGAAGCAGGAGAGAGAGGACGG + Intergenic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122382764 14:101321387-101321409 TTCGAACAGCAGAGAGAGGATGG + Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124683172 15:31755106-31755128 TTTAAGGAGGAGAGAGATGAAGG + Intronic
1124795690 15:32775900-32775922 TTGAAAAATCCGAGAGAGGAGGG + Intronic
1125299183 15:38236082-38236104 CTGAAGAAGCACAGATAGGCTGG + Intergenic
1125932893 15:43612733-43612755 TGGAAGAGGTAGAGAGAGGAAGG - Intronic
1125945992 15:43712195-43712217 TGGAAGAGGTAGAGAGAGGAAGG - Intergenic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126661319 15:51036610-51036632 TTTAAGGAGCTGAGAGAAGAAGG - Intergenic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127044309 15:55010069-55010091 TTGAAGAAGAAGAGAAATGATGG - Intergenic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127707459 15:61561447-61561469 TTGAAATTGAAGAGAGAGGAGGG - Intergenic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1127960042 15:63884058-63884080 TTGGAGAACAAGAGAGATGAAGG + Intergenic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1129312400 15:74721843-74721865 TTGCAGAGGCAGAGAGAAGCTGG - Intronic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131357434 15:91757912-91757934 AGGAAGAAGCAAAGAGGGGAGGG - Intergenic
1131761595 15:95628736-95628758 TTGAAGTCCCAGAGAGAGCAAGG + Intergenic
1131830286 15:96350342-96350364 TTAAAGAAGGAAAGAGAGAAAGG - Intergenic
1131961497 15:97794103-97794125 TTGTAGAGGCAAAGAAAGGAGGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132237449 15:100232762-100232784 GTGAGGAGGCAGTGAGAGGAGGG - Intronic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132324193 15:100953313-100953335 TTAAAGAAGCCGAGAGTGAATGG - Intronic
1132850247 16:2021780-2021802 TTGAAGAGGCAGCGGGAGGGAGG - Intergenic
1132880002 16:2157944-2157966 TGGAAGGAGCCGAGAGAAGATGG - Intronic
1132953869 16:2580709-2580731 TGGAAGCAGCAGAGAGAAGAGGG - Intronic
1132960476 16:2619454-2619476 TGGAAGCAGCAGAGAGAAGAGGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1134294622 16:12934773-12934795 TTGAAGGATGAGAGAGATGAGGG - Intronic
1134480546 16:14615119-14615141 TTGAAAATGGAGAGAGATGAGGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134680881 16:16124637-16124659 TTGAAAAAGCAGTGCCAGGAAGG + Intronic
1135326248 16:21527514-21527536 TGGAAGCAGCAGCCAGAGGAAGG - Intergenic
1135784104 16:25332565-25332587 TAGAAGGAACAGAGACAGGAAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1135978491 16:27127591-27127613 TTAAGGGAGAAGAGAGAGGATGG - Intergenic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1136910349 16:34140508-34140530 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137281877 16:46984164-46984186 TTGAAGGAACAGAGAGGTGAGGG - Intergenic
1137608846 16:49805517-49805539 TTGAAGGGGCCGAGAGAGGCAGG - Intronic
1138060369 16:53883805-53883827 TTGAAGAATCAGAGATTGGGGGG - Intronic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138644011 16:58409648-58409670 TTGAAAAAGCAGATACAGAAAGG - Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1139342476 16:66277496-66277518 TTGGAGATGCTGAGAGAGAAAGG + Intergenic
1139364471 16:66425516-66425538 ATGAAGGATCAGAGAAAGGAGGG - Intergenic
1140638447 16:76943898-76943920 TTGAAAGAGGAGAGAGAGAAAGG - Intergenic
1140737695 16:77912867-77912889 ATGAGGAAGCAGTGAGAAGACGG - Intronic
1140740270 16:77935533-77935555 TTTAAGAGGCAGAGAGAGATGGG + Intronic
1140767164 16:78170819-78170841 TTGAGAAAGCAGAGAGATGAGGG + Intronic
1140908388 16:79429522-79429544 AGGAAGCAGCAGAGAGAGGGAGG + Intergenic
1140936216 16:79672685-79672707 GTGAAGAAGCTGTGAGAGGTTGG - Intergenic
1141095899 16:81162967-81162989 TTGAAAAAGAAGACAGAGGCTGG + Intergenic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141431537 16:83972722-83972744 TTAAAGAGGCTGAGAGAGAAAGG - Intronic
1141760343 16:86025048-86025070 TGGTAGAAGAAGAGAGAGAAAGG + Intergenic
1141801123 16:86309957-86309979 TTGAGGAAGCAGACAGAGGCTGG + Intergenic
1142039295 16:87882241-87882263 TGGAAGCAGCAGCCAGAGGAAGG - Exonic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142728126 17:1831156-1831178 TGGAATAAGCAGACAGATGACGG - Intronic
1142858647 17:2748240-2748262 TTCAAGAGGCAGAGATAGGGTGG - Intergenic
1142882844 17:2894893-2894915 TGCAAGCAGCAGAGAGAGAACGG - Intronic
1143132810 17:4691139-4691161 TGGAAGAAGCAAAGAAAGAAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143857391 17:9862288-9862310 TTGAAGACCCAGAGAGAAGGAGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144161136 17:12559340-12559362 TAGAAGAAGGAAAGAGAGGAAGG - Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144377199 17:14656241-14656263 TTGAAAAATCAGGGAGAGAAAGG - Intergenic
1145027450 17:19478964-19478986 TTGAAGGAGGAGAGAGATGTAGG - Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145095823 17:20025165-20025187 GTGAAGACGCAGGGAGAAGATGG + Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1146272453 17:31493309-31493331 TTGAGGTACCAGAAAGAGGAAGG + Intronic
1146597343 17:34181713-34181735 AAGAAGAAGAAGAGAGAGAAAGG + Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147305785 17:39563534-39563556 TGGAAGAAGAAGAGAGAGGGAGG - Intronic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147422991 17:40331837-40331859 TTGAAGGAGCAGACCGAGGAAGG + Intronic
1147465931 17:40610877-40610899 GAGAAGAGGCAGAGAGAGCAGGG + Intergenic
1147530215 17:41269257-41269279 ATTAAGAAGCAAAGAAAGGAGGG + Intergenic
1147540685 17:41356194-41356216 TTGAAGAAGCACAGAAATGGTGG + Intergenic
1147760676 17:42795707-42795729 TTGGAGAACCAGAGAGAGTGGGG - Exonic
1147912372 17:43863456-43863478 GTGAAGAAGAAAAGAGTGGAAGG - Exonic
1148153297 17:45409130-45409152 TGGAAGCAGCGGGGAGAGGAAGG + Intronic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148760135 17:49995390-49995412 GGGAAAAAGAAGAGAGAGGAGGG - Intergenic
1149525449 17:57351985-57352007 GTGAAGAAACACTGAGAGGAAGG + Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149569374 17:57661627-57661649 TTGAGAAAGCAGACACAGGAGGG + Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150943342 17:69717469-69717491 TGGAAGCAGGAGAGAGAGGTGGG - Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151978240 17:77494327-77494349 ATGAAGGGACAGAGAGAGGAAGG - Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152287655 17:79422067-79422089 TTGAAGGGGCTGAGAGAGGCGGG + Intronic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152537594 17:80959697-80959719 TTTAGGAAACAGAGAGAGGTTGG + Intronic
1152728049 17:81957317-81957339 GTAAAGAGACAGAGAGAGGAAGG - Intronic
1152805505 17:82353977-82353999 TGGAAGAAGGCCAGAGAGGAAGG - Intergenic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153239912 18:3021684-3021706 TTGAAGAAAAACAGAGAGGGAGG + Intergenic
1153883494 18:9441070-9441092 TTGAAGAACCAGAGATAGTGTGG - Intergenic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1154437229 18:14356240-14356262 TCAAAGAAACAGAGAGATGAAGG + Intergenic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155432163 18:25771001-25771023 GTGAAGATGCAAAGAGACGATGG - Intergenic
1156277545 18:35598042-35598064 TTGAAAAAGAAGAGAAGGGAGGG - Intronic
1156278276 18:35606162-35606184 TTGTAGAAGGAAAGAGAGCAGGG + Intronic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157238013 18:45982174-45982196 TTGAAGAAGTAGTGATAGGATGG + Intergenic
1157334135 18:46724974-46724996 AGGAAGAAAGAGAGAGAGGAAGG + Intronic
1157694536 18:49710398-49710420 TTCCAAATGCAGAGAGAGGAGGG - Intergenic
1158224555 18:55187097-55187119 TTCAAGAAGCTGAGAAGGGATGG + Intergenic
1158442133 18:57485690-57485712 ACAAAGAAGCAAAGAGAGGAAGG + Exonic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159790301 18:72770874-72770896 TTAAAGAATCAAAGAGAAGAGGG - Intronic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161238762 19:3210471-3210493 GAGAAGAAGCAGGGAGAGGTGGG + Intergenic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161756673 19:6138804-6138826 GGGAAGAAGCAAAGGGAGGAAGG + Intronic
1162147532 19:8621850-8621872 GTGAAGACGCAGAGAGAAGGTGG + Intergenic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163657958 19:18558691-18558713 TTGAAGAAACGCAGAGAGGTAGG - Intronic
1163779576 19:19239452-19239474 TGGAAGGAGGAGGGAGAGGAGGG - Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1166064751 19:40350935-40350957 TTGAAGGAGAAGAGAGAGTAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166672688 19:44720855-44720877 TTTAGGAAGCAGAGGTAGGAGGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167608005 19:50492136-50492158 CTGAAGGTGCAGGGAGAGGAAGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167748749 19:51367749-51367771 TGGAAGAAGCCGAGAGAGGTGGG - Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925026047 2:608125-608147 TTGAGGAGCCAGAGAGGGGAAGG - Intergenic
925197263 2:1936217-1936239 TTTAAGATGCAGGTAGAGGACGG - Intronic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926908292 2:17826251-17826273 TTGGAGGAGCAGGGAAAGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927081954 2:19639343-19639365 TTGTAGAAGCAGAGAGTGTTGGG - Intergenic
927405733 2:22764264-22764286 TCACAGAAGCAGAGAGAGAATGG - Intergenic
928639334 2:33281396-33281418 TGGAAGAAGAAGAGAGCAGAAGG + Intronic
929545375 2:42852096-42852118 GTGAAGAGGCAGTGAGAGGGTGG - Intergenic
930030432 2:47055357-47055379 TTGAAGAAGGGAGGAGAGGAGGG - Intronic
930059380 2:47275605-47275627 TTGAAGGAACAGAGAGGGAAAGG - Intergenic
930371466 2:50506740-50506762 AGGAAGAAAGAGAGAGAGGAGGG + Intronic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
930919857 2:56739412-56739434 TTGAAGAAAGAGAGAAGGGAGGG - Intergenic
931430073 2:62202319-62202341 TTTCAGAGGCAGAGAAAGGAAGG + Intronic
931668366 2:64625903-64625925 GAGAGGAAGGAGAGAGAGGATGG + Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931936817 2:67207579-67207601 GCAAAGAAGCAGAGAGAGGTGGG + Intergenic
932038751 2:68276217-68276239 CTGAAGTGGCAGAGAGAGAATGG + Intergenic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932609086 2:73185411-73185433 TTGAAGAAGCCAAGGAAGGAAGG - Intergenic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
932823654 2:74921701-74921723 GTGAAGAAGTGGAGAAAGGAGGG - Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933983421 2:87572072-87572094 GTGAAGATGCAGAGACAGGTTGG - Intergenic
933986609 2:87597005-87597027 TTAAAGAGGAAGAGAAAGGAAGG + Intergenic
934040773 2:88126031-88126053 TGGGAGAAGCAGAGAGACAAAGG - Intronic
934744670 2:96751305-96751327 TTGAGGAAAGAGAGAGAAGAAGG - Intergenic
934976693 2:98807808-98807830 TTCAAGAAGCTGATAGAGGGGGG + Intronic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935468204 2:103425038-103425060 GTGAAGAAACACAGAGAAGATGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935829012 2:106979780-106979802 CTATAGAAGCAAAGAGAGGAGGG + Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
935923067 2:108035829-108035851 ATCAAGAAGTAGTGAGAGGAAGG - Intergenic
936307228 2:111353796-111353818 TTAAAGAGGAAGAGAAAGGAAGG - Intergenic
936310427 2:111378722-111378744 GTGAAGATGCAGAGACAGGTTGG + Intergenic
936469238 2:112783846-112783868 TTCAGGAAGCACAAAGAGGAGGG - Intronic
937065527 2:119013984-119014006 TTGAAGAAGAAGAGGAAGCAGGG + Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937320343 2:120957002-120957024 GTGAAGGAGCAGCCAGAGGAGGG - Intronic
937356376 2:121200515-121200537 TTGAAGGAGGAGGGAGAGGCAGG + Intergenic
937386330 2:121436774-121436796 TTTAAGAAGAAGAGGGAGAATGG - Intronic
937519570 2:122695647-122695669 TTTAAGAAGCAAAGTGAAGAAGG - Intergenic
937907299 2:127058550-127058572 TTAAAGGGACAGAGAGAGGAAGG - Intronic
939526302 2:143299061-143299083 TTGAAGAAACAATGAAAGGAAGG - Intronic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
940024739 2:149193999-149194021 TTAAATAAGCAGAGAGAGATGGG - Intronic
940046453 2:149415589-149415611 TTAACGAAGGAGAGAGAGAAGGG + Intronic
940101182 2:150040806-150040828 TTGAAGAAGAAGACAAAGGTGGG + Intergenic
941246938 2:163110161-163110183 GTGAAGAAGGAGGGAGAGTATGG - Intergenic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
941808730 2:169734495-169734517 TTAAGGAAGGAGAGAAAGGAAGG - Intronic
941883218 2:170502542-170502564 CTGAAGAGCCAGAGAGGGGACGG - Intronic
941947763 2:171118958-171118980 TAGAAGAAGTAGACAGAGGAAGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942244834 2:173998360-173998382 TTGAAGGAGGTGAGAGAAGATGG - Intergenic
942336793 2:174896987-174897009 GTGAAAGAGCACAGAGAGGAGGG + Intronic
942404061 2:175634350-175634372 TTGAGGTAGGAGATAGAGGATGG - Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943008405 2:182415628-182415650 TAGAAGAAGTAAAGACAGGAGGG - Intronic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
944325535 2:198399669-198399691 TTGAAGGATAACAGAGAGGAGGG + Intronic
944842451 2:203637367-203637389 GTGAGGAAGTAGAGAAAGGAGGG + Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
944902201 2:204226862-204226884 TTCAATAAGCAGAGAGATGAGGG - Intergenic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946490421 2:220144054-220144076 TTTAAGGACTAGAGAGAGGAGGG - Intergenic
946643268 2:221806911-221806933 TTTGGGAAGGAGAGAGAGGAAGG - Intergenic
946698606 2:222386832-222386854 TTTGGGAAGCAGAGAAAGGAAGG - Intergenic
946941297 2:224772557-224772579 CTGAAGATGCAAGGAGAGGAGGG - Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169645587 20:7806174-7806196 TGGGAAAAGCAGAGAGAGGTTGG - Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170215912 20:13891057-13891079 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
1170544546 20:17424405-17424427 CTGAGGAAGCAAAGAGGGGAAGG + Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171230540 20:23480670-23480692 TTGGAGGGGCAGAGAGATGAGGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171770723 20:29320330-29320352 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171813419 20:29763097-29763119 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171905817 20:30899239-30899261 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1172219049 20:33259834-33259856 TTTAAGAACAAGAGAGAGCAGGG - Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174803389 20:53584313-53584335 TTAAGGAAGTAGAGAGAGGGAGG - Intronic
1174863789 20:54116242-54116264 TGAAAGAAGGAGAGAGAGGCTGG + Intergenic
1174956120 20:55100443-55100465 TAGAAAAAGCAGGCAGAGGAAGG - Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1176511308 21:7750661-7750683 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1177153666 21:17480164-17480186 TTGAAACAGCAAACAGAGGATGG - Intergenic
1178054224 21:28781035-28781057 TTTAGGAACCAGAGAGAGAAAGG - Intergenic
1178366764 21:31994909-31994931 TTTGGGAAGCAGAGACAGGAGGG + Intronic
1178466135 21:32849793-32849815 TTGCAGGAGCAGGGAGGGGAGGG + Intergenic
1178477636 21:32951216-32951238 TTTAAGAAGCACAGAGAACACGG - Intergenic
1178480531 21:32976162-32976184 GGGAAGTAGGAGAGAGAGGAAGG - Intergenic
1178612214 21:34093963-34093985 TATAAGAAGCAGAGAAAAGAGGG - Intronic
1178645422 21:34381190-34381212 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179326905 21:40355582-40355604 TTGAATTAGAAGAGAGAGCAGGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180118435 21:45727501-45727523 GTCAAGAGGCAGAGAGAGCAAGG + Intronic
1180121195 21:45749503-45749525 TTGAAGAGTCAGGGAGAGGGAGG + Intronic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180234610 21:46450266-46450288 ATTAGGAGGCAGAGAGAGGATGG - Intergenic
1180316104 22:11278148-11278170 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1180338467 22:11599797-11599819 ATCAAGAAACAGAGAAAGGAAGG - Intergenic
1180339233 22:11605340-11605362 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1180645769 22:17337610-17337632 GAGAAGAGGCAGAGAAAGGATGG - Intergenic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181682279 22:24503736-24503758 ATGAAGAGTCAGAGAGAGTATGG - Intronic
1181684961 22:24522080-24522102 TGGAGGAAGCAGACAGAGAAGGG - Intronic
1182779836 22:32858655-32858677 TTGAAGATGAAGTGAGAGAATGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183534376 22:38388686-38388708 TTAAGGAAGTAGAGAGAGGGAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184791899 22:46705232-46705254 TGGAAGATGCAGAGAGAGTATGG + Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
949132112 3:515990-516012 GGGAAGGAGAAGAGAGAGGAAGG + Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
951984063 3:28598358-28598380 TTGAAGAATAACAGAGAGGGAGG + Intergenic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952330159 3:32357339-32357361 TAGAAGCAGTGGAGAGAGGAGGG - Intronic
952474050 3:33686962-33686984 TTAAAAAAGAAGAGAGAGGGTGG - Intronic
952657010 3:35799045-35799067 TTGAACACACAGAGATAGGATGG + Intergenic
952721734 3:36540730-36540752 TAGAAAAAGCAAAGAAAGGAAGG + Intronic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952909538 3:38170596-38170618 TTGAAGACACAGAGACAGAAAGG + Intronic
953119576 3:40026809-40026831 TTCAAGAAGGGGAGAGTGGATGG - Intronic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953890320 3:46746906-46746928 TTGAAGAAGCACAGCAAAGAAGG + Intronic
954113386 3:48448733-48448755 TTGAAGGAGCTGAGAGCTGAAGG - Intronic
955067487 3:55545717-55545739 TAAAAGAGGCAAAGAGAGGATGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956054343 3:65282618-65282640 TTGAAGAGGCAGAGAAAGCTGGG - Intergenic
956342835 3:68246068-68246090 TGGAAATAGCAGACAGAGGATGG - Intronic
956567861 3:70659640-70659662 TTGAAGAGGGAGAGAGTGGGTGG + Intergenic
956639110 3:71397942-71397964 AGGAAGAAGCAGAGAGAGTGGGG + Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957117534 3:76045816-76045838 AAGAAGAGGAAGAGAGAGGAAGG - Intronic
957134048 3:76262386-76262408 TTGAAAAAGCAGACAGTGCATGG - Intronic
957433068 3:80138830-80138852 TTGAAGGGGAAGGGAGAGGAGGG + Intergenic
957504352 3:81100492-81100514 TTTAAGAAGCAGAGATGAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957792777 3:84960566-84960588 AAGAAGCGGCAGAGAGAGGATGG - Intronic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958557755 3:95702451-95702473 TGCAAGAAGGAGAGAGAGAAGGG - Intergenic
958779894 3:98528216-98528238 TTGAAGATGAAGACAGAGAAAGG - Intronic
959333490 3:105035794-105035816 TTTTAGAAGCTGAGAGAGCAAGG - Intergenic
959451633 3:106510759-106510781 AGGAAGAAGCAAAGAAAGGAAGG - Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959677047 3:109048156-109048178 TTAAGGAAGAACAGAGAGGAGGG + Intronic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
959820486 3:110729653-110729675 TTGAAGTAGGAGAGAGAGGTAGG + Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960812444 3:121637491-121637513 TTGAAGAAGAAGGGAGAAAATGG - Intronic
961080259 3:124020924-124020946 GTGAAGAAGGAAAGAAAGGAAGG + Intergenic
961166281 3:124766096-124766118 TTGAAACTGCAGGGAGAGGAGGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961303115 3:125934760-125934782 TTGGGGAAGCCGGGAGAGGAGGG - Intronic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
962057628 3:131888751-131888773 TTCAAAATGCAGAGAGTGGAGGG + Intronic
962068003 3:132003531-132003553 TAGAAGTAGTAGAGAGAGAAGGG - Intronic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962886639 3:139633774-139633796 ATGAAGCTGCAGAGAGTGGAAGG + Intronic
962990916 3:140576630-140576652 TTGACACAGCAGAGAGAGGAGGG + Exonic
963005488 3:140723105-140723127 GTGAAGAAGTTGGGAGAGGAAGG - Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
964430312 3:156598741-156598763 ATGAAGAAGCAGCGAGAAAATGG + Intergenic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964737252 3:159929583-159929605 TTGAGGAAGAAGTGTGAGGAGGG + Intergenic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965030417 3:163358442-163358464 TTGAAGAATTAGAGGGAGCAAGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965450760 3:168834801-168834823 GTGAAGAAGCTGGGAGAAGAGGG - Intergenic
965653233 3:170955402-170955424 TTCAGGAACAAGAGAGAGGACGG - Intergenic
965864892 3:173194501-173194523 TAAAAGAAAGAGAGAGAGGAGGG + Intergenic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966384230 3:179378344-179378366 TTAAATAAGCACATAGAGGATGG + Exonic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967232695 3:187355285-187355307 TTGTAGAAACAAAGAAAGGAAGG - Intergenic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
968942072 4:3644091-3644113 TGGAAGAGGCAGGAAGAGGAAGG + Intergenic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969819783 4:9711023-9711045 TTGGGGAAGCTGGGAGAGGAGGG - Intergenic
970216867 4:13767832-13767854 ATGAAGATGCTGAGAGAGTAAGG - Intergenic
970258174 4:14191673-14191695 TTCAAGAAGCAGAGAGAATGTGG - Intergenic
970386116 4:15558474-15558496 TCAAAGAAGCCTAGAGAGGATGG - Intronic
970689328 4:18603888-18603910 GTGAAGAAGAAGAGAAAGCAGGG - Intergenic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
972129296 4:35809976-35809998 AGAAAGAAACAGAGAGAGGAGGG - Intergenic
972623163 4:40768911-40768933 GTGAAAAAGTAGAGAAAGGAGGG + Intronic
973189740 4:47373244-47373266 TGGAAGAAGCAGAAAGAAAAAGG - Intronic
973693632 4:53467498-53467520 TTCAACAAGTTGAGAGAGGAAGG + Intronic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
974823110 4:67093069-67093091 TGAAATGAGCAGAGAGAGGAGGG + Intergenic
974907371 4:68075143-68075165 TAGAAGAGTCAGGGAGAGGAAGG - Intronic
975524987 4:75339243-75339265 TGGAAGAAAAGGAGAGAGGAGGG - Intergenic
975648818 4:76571991-76572013 TGGAGGAAGCAGAGAGAAGATGG - Intronic
975818718 4:78247522-78247544 GTGAAGAAAGAAAGAGAGGAAGG - Intronic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
976747385 4:88417488-88417510 ATGAAGCAGCTGAGAGATGATGG - Exonic
977233612 4:94480722-94480744 TCCACAAAGCAGAGAGAGGAAGG + Intronic
977333365 4:95664862-95664884 TTTGACAAGCTGAGAGAGGAAGG + Intergenic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
978144208 4:105352924-105352946 TTGAAAAGGCAGAGAAAGAAGGG - Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
979014474 4:115415893-115415915 TTTAAGAAACAGAGAAAGAAGGG - Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
981622460 4:146717921-146717943 TCAAAGAAGCAGAGAGCAGAAGG - Intronic
982089335 4:151866903-151866925 GAGAAGAGGCAGAGAGAAGACGG - Intergenic
982097620 4:151937040-151937062 ATGATGAAGCAGAGAGATGCAGG - Intergenic
982244732 4:153340303-153340325 TTTCAGAATCAGAGAGAGGGTGG + Intergenic
982417926 4:155158311-155158333 GAGAAGAAGCAAAGAGAGAAGGG - Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983889147 4:173013105-173013127 TTATAGAAACAGACAGAGGAAGG - Intronic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984720151 4:182963986-182964008 TTAAAGAAGCTGAGAGAAGAAGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
985040043 4:185880986-185881008 GTGAAGAAAAAGAGAAAGGAAGG + Intronic
985138928 4:186819247-186819269 TTGAAGGAGAGGAGAGAGAAAGG - Intergenic
985254858 4:188059580-188059602 TTGAAGATGGAGGGAGAGGCTGG - Intergenic
985987374 5:3527386-3527408 TGGCAGATGCAAAGAGAGGAGGG + Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986177873 5:5367100-5367122 TGGAAGAAGGAGGGAGAGAAAGG - Intergenic
986333630 5:6736549-6736571 TTAAAGATGGAGAGAGGGGAAGG - Intronic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986785989 5:11114348-11114370 TAGAAGAAGAAGAGAAAGTAGGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
987613148 5:20234819-20234841 TTGAAGAAACACAGACAGAAAGG + Intronic
987698980 5:21370476-21370498 TTGAAGGAGCTGAGAGCTGAAGG - Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
988193355 5:27967235-27967257 TTGAAGAAGTAAAGAGAGATAGG + Intergenic
988327157 5:29785202-29785224 GTGAAGAAGCAGAGAGGTTATGG + Intergenic
988544643 5:32143800-32143822 TTGAATTAGCATTGAGAGGAAGG - Exonic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
990047015 5:51445125-51445147 TGGGGGAAGCAGAGAGAGGGTGG - Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
991304047 5:65157971-65157993 TTGAGAAAGCAAAGAGAGAAAGG - Intronic
991741458 5:69681850-69681872 TTGAAGGAGCTGAGAGCTGAAGG + Intergenic
991756160 5:69872589-69872611 TTGAAGGAGCTGAGAGCTGAAGG - Intergenic
991793032 5:70261588-70261610 TTGAAGGAGCTGAGAGCTGAAGG + Intergenic
991820917 5:70557924-70557946 TTGAAGGAGCTGAGAGCTGAAGG + Intergenic
991835563 5:70748506-70748528 TTGAAGGAGCTGAGAGCTGAAGG - Intergenic
991885481 5:71261893-71261915 TTGAAGGAGCTGAGAGCTGAAGG + Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992508672 5:77412375-77412397 TTGAATGAGCAGAGAGACTATGG + Intronic
992554150 5:77886785-77886807 TACAAGAAGCAGTGAGAGGTGGG - Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
992811177 5:80390187-80390209 TTTAAAAATCAGGGAGAGGAGGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
993768448 5:91893182-91893204 TTGAAGATTGAGAGAGGGGAAGG + Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995459554 5:112388547-112388569 TTGAAGAGACCGAGAGAGAATGG + Intronic
995585184 5:113641449-113641471 TTGAAGAAGGAGAGAGACAGAGG - Intergenic
995715539 5:115078787-115078809 TTAAGGAAGCAGAGAGAGAAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996557201 5:124790673-124790695 TGGAGGAGGCAGAGAGAGGGAGG + Intergenic
996890171 5:128409546-128409568 TTCAGTAAGCAGAGAGAGGTGGG + Intronic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997606141 5:135176993-135177015 CTGAAGAAGCAGGGAATGGAGGG + Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998524714 5:142831849-142831871 TGCAAGGAGCAGAGAGAGAAAGG - Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998700991 5:144699638-144699660 TTGAAGGAGCCAGGAGAGGAGGG - Intergenic
998798300 5:145841929-145841951 GTGAAGAAAGAGAGAGACGAAGG + Intergenic
998953581 5:147415664-147415686 AAGAAGAAGCTAAGAGAGGAGGG + Intronic
999008531 5:148008823-148008845 TTGAGGAAGCAGAGACCAGAAGG + Intergenic
999125747 5:149244661-149244683 TTGGAGCACCAGAGAGGGGAAGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
999885546 5:155918930-155918952 TTTAAGAGGTAAAGAGAGGAAGG + Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000553515 5:162695750-162695772 TTCAAAAAGTTGAGAGAGGAAGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1001264865 5:170266877-170266899 TTGAAGGAGCAGGGACTGGAAGG + Exonic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1002851748 6:1003099-1003121 AGGAAGAGGCAGAGAGAGAAAGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003038378 6:2664879-2664901 TTTAAAAATCAGGGAGAGGAGGG - Exonic
1003265035 6:4558195-4558217 TAGGAGAACCAGAGATAGGATGG + Intergenic
1003384987 6:5659154-5659176 GTGAACAAGCAGAGAAAAGATGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1003694080 6:8384971-8384993 TTGAAAAAGCAGAAAAGGGAAGG + Intergenic
1003734334 6:8860939-8860961 TTGAATAAACTGAGAGATGATGG + Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004632627 6:17436561-17436583 TTGGAGAGGAAGAGAGAGGGAGG + Intronic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1005352496 6:24949954-24949976 TGGAGGAAGCAGAGCGGGGAAGG + Intronic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005551841 6:26927827-26927849 TTGAAGGAGCTGAGAGCTGAAGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005773076 6:29097256-29097278 TTAAAGATCCAGAGAGAAGAAGG + Intergenic
1005968011 6:30741385-30741407 GAGAAAAAGCAGAGAGAGAAGGG + Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006580327 6:35073360-35073382 TGGAAGAGGCAGAGCCAGGATGG - Intronic
1006803651 6:36775069-36775091 GTGAAGAAGAAGAGAGGGAAAGG + Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007825581 6:44598301-44598323 CTGAAAAAGCAGAGAAATGAGGG - Intergenic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008433476 6:51447478-51447500 GGGAAGAAGAAGAGAGAGAAAGG + Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1008900442 6:56608586-56608608 TTGAAGAAGCTGTCAGAGAAGGG - Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009501947 6:64425029-64425051 TGGAAGAAGCAGTGAGATTAAGG + Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010696802 6:78985372-78985394 CCGAAGAAGAAGAGAGAGCATGG - Exonic
1010824222 6:80453240-80453262 CTGAAGCAGCAAAGAGAAGATGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011589665 6:88960043-88960065 TTGAGGAAGAAGAGATGGGAAGG - Intronic
1011704010 6:89983137-89983159 TTAAAGAAGGAGGCAGAGGATGG - Intronic
1011710012 6:90043515-90043537 GTGAGGGAGGAGAGAGAGGAAGG - Intronic
1012140828 6:95624777-95624799 TTTAAGAAGCAGTGAGATAATGG - Intergenic
1012707785 6:102555030-102555052 TGAAAGAAGGAGAGAGAGGGGGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1014229248 6:118884184-118884206 TTGAAGAAGCTCAGAAAAGAAGG - Intronic
1014475359 6:121865518-121865540 TTAAAAAAGGAGGGAGAGGAAGG - Intergenic
1014595886 6:123338281-123338303 TTAGAGAAACAGAGAGAGAATGG + Intronic
1014831195 6:126104760-126104782 TGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1014878762 6:126695171-126695193 TTGATGAGGAAGAGAAAGGACGG - Intergenic
1015156853 6:130106355-130106377 TTGAAACCCCAGAGAGAGGATGG - Intronic
1015166428 6:130205037-130205059 TTCAAGAGGTAGAGAGAGGTGGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015732198 6:136360754-136360776 GTGAAGAAGCAGAGAGGGTCCGG - Exonic
1015806570 6:137115805-137115827 TACAACAGGCAGAGAGAGGAAGG - Intergenic
1016278064 6:142378648-142378670 GAAAGGAAGCAGAGAGAGGAAGG - Intronic
1016306669 6:142692186-142692208 TTGAGGTGGCAGAGGGAGGAAGG - Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017386504 6:153891033-153891055 TTAAAAAAGCAGAGAGAGGCCGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017848247 6:158278803-158278825 TTGTAGAACCAGTGAAAGGAAGG + Intronic
1017912969 6:158810600-158810622 TAGAACACACAGAGAGAGGATGG + Intronic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018561544 6:165105523-165105545 TGGAAAACACAGAGAGAGGAGGG + Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019209991 6:170397310-170397332 TTCAAGCAGCAGAGAGAGTGAGG - Intronic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019627980 7:2030903-2030925 ATGAGGAAGAACAGAGAGGATGG - Intronic
1019929208 7:4212492-4212514 TTGAACCAGCAGAGAGGGCATGG + Intronic
1020318429 7:6923581-6923603 TTGAGGAAGCCGGGAGAGGAGGG + Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020690291 7:11346671-11346693 GTGAAGAAGAGAAGAGAGGAGGG - Intergenic
1020735170 7:11939312-11939334 TTAAAGGAGCAGAGAAAGAATGG + Intergenic
1021276681 7:18660721-18660743 TTGAGGGAGTAGAGAGAGCACGG + Intronic
1021799789 7:24293597-24293619 GTGAAGAAGCAGAGGGATCAAGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1022845744 7:34207998-34208020 TTTAAGAAACAGAGGGAAGATGG + Intergenic
1023057783 7:36303688-36303710 TGGAAGGAGCAGAGAGAGCCTGG - Intergenic
1024774759 7:52771121-52771143 TTGAAAGGGCAGAGAAAGGAGGG + Intergenic
1024936017 7:54713027-54713049 TCGAAGAAGCTGAGAGAGCAAGG + Intergenic
1026211658 7:68311307-68311329 TTGACAAAGAAGAGAGAAGATGG + Intergenic
1026500147 7:70937005-70937027 TTAAGGAAGAAGAGAGAGGTGGG + Intergenic
1026869001 7:73839622-73839644 GTGAGGAAGCAGTGAGAGGAAGG + Intronic
1027047875 7:75003060-75003082 TTCAAGAAGCAAGGACAGGAGGG + Intronic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027386362 7:77663043-77663065 GGAAAGAAGGAGAGAGAGGAAGG + Intergenic
1027460023 7:78440653-78440675 TTAAAGTACCTGAGAGAGGATGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028223808 7:88226482-88226504 TTCAATAAGCTGGGAGAGGAGGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1029139532 7:98400537-98400559 GGGAAGAAGCACAGGGAGGAGGG + Intronic
1029271528 7:99379948-99379970 TTAAGAAACCAGAGAGAGGAGGG - Intronic
1029385128 7:100238586-100238608 TTCGAGAAGCAAAGATAGGAAGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030063306 7:105640230-105640252 TTGAAGGTGCAGAGAGGGCAGGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030217256 7:107057121-107057143 TTCAAGCAACAGAGGGAGGAAGG - Intronic
1030796873 7:113799585-113799607 TTGAAAAAGCAAAGAAACGAAGG - Intergenic
1030883814 7:114914891-114914913 TCGAAGTAGGAGAGAGAAGAAGG + Intergenic
1030897971 7:115085311-115085333 TTAAAGTGGGAGAGAGAGGAAGG - Intergenic
1030925700 7:115451522-115451544 CTGATGAAGCAGAGAGTGGGAGG - Intergenic
1030997151 7:116372392-116372414 TTTGACAAGCTGAGAGAGGAAGG + Intronic
1031372169 7:120981705-120981727 GTGAAGATGCAGAGAGAACAGGG - Intergenic
1031469439 7:122151495-122151517 TTCTGGAAGCAAAGAGAGGAAGG - Intergenic
1032725544 7:134587129-134587151 GGGAAGAAGCAGAGAGAGAGGGG + Intergenic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1032937639 7:136751780-136751802 TTACAGAAGCAGAGATAGAATGG + Intergenic
1033635623 7:143209211-143209233 TTGAGCAAGCAGGGAAAGGAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034539735 7:151749371-151749393 TGGAGGAAGCAGAGAGAGTGAGG - Intronic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1035144401 7:156799555-156799577 TAGGAGAAGGAGAGAGATGAAGG - Intronic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1036110128 8:5889761-5889783 GTGATGATGCAGGGAGAGGATGG - Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1037835847 8:22214315-22214337 GGGAGGAAGGAGAGAGAGGATGG + Intergenic
1037870042 8:22485546-22485568 TTGCAGAAGCCGTTAGAGGAGGG + Intronic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1038416845 8:27403068-27403090 GTCAGGAAGCAGAGAGAAGAAGG - Intronic
1038447416 8:27613512-27613534 TTGAAGAAGCAGATAGGAGCCGG - Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1038995473 8:32918258-32918280 TTGGAGAAGGTGAGAGACGATGG + Intergenic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1040436138 8:47393543-47393565 TTAATTAGGCAGAGAGAGGAGGG - Intronic
1040594824 8:48827107-48827129 TTTAAAAAGGAGAGAGAGGTGGG - Intergenic
1040639182 8:49312407-49312429 AAGAAGAAGTAGAGAGAGAAAGG + Intergenic
1040639786 8:49320140-49320162 GAGAAGGAGCAGGGAGAGGAGGG + Intergenic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1041051748 8:53941046-53941068 GTGAGGCAGCAGAGAAAGGAGGG - Intronic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1041746153 8:61211331-61211353 GAGAAGAAGGAGGGAGAGGAAGG - Intronic
1042115582 8:65427498-65427520 TTTGACAAGTAGAGAGAGGAAGG + Intergenic
1042346282 8:67731384-67731406 TTGTGGAAGAAGTGAGAGGATGG - Intronic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042491412 8:69402681-69402703 TTGAAGTAGCTTAGAGAAGAAGG - Intergenic
1042552353 8:70005213-70005235 AGGAAGAAAGAGAGAGAGGAAGG + Intergenic
1042817780 8:72896718-72896740 TTGAAAAAGCACAGTGAGAAAGG - Intronic
1043185084 8:77138182-77138204 TGAAAGAAGAAGACAGAGGAAGG - Intergenic
1043383092 8:79723484-79723506 GTGAGGAGGAAGAGAGAGGAAGG - Intergenic
1043392769 8:79807628-79807650 GTGAAGACGCAGGGAGAAGACGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044644232 8:94421072-94421094 TTGAAGAAGCAGAGGCAGTGTGG - Intronic
1044704670 8:94996847-94996869 ATGAAGACGCAGGGAGAAGATGG + Intronic
1044737088 8:95290101-95290123 TTGAGGAAGCAGTGGGGGGAAGG - Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045686662 8:104719827-104719849 TTTAAGTAGAAGAGTGAGGAGGG + Intronic
1045714843 8:105029618-105029640 TTAATGAAGCAGACAGTGGAGGG - Intronic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046318021 8:112532261-112532283 TTAAAGAAGGAGTGAGAGGTAGG + Intronic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1046807207 8:118492552-118492574 GTGAAACAGCAGAGAGAGCATGG - Intronic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047232159 8:123006862-123006884 TTCAAGGAGCTGAGAGAAGATGG + Intergenic
1047254503 8:123205687-123205709 TTGAAGCAAGAGGGAGAGGATGG - Intronic
1047328661 8:123864965-123864987 TTTGAGGAGCTGAGAGAGGAAGG - Intronic
1047642014 8:126830853-126830875 TTGAATAAGAACAGAGAGGGTGG + Intergenic
1048082419 8:131143045-131143067 TTGTAGATGCAGAGAAGGGAAGG - Intergenic
1048225994 8:132586125-132586147 TTAGAGAAGGAGAGAGAGAACGG + Intronic
1048236339 8:132694400-132694422 GTGAAGATGCAGGGAGAAGATGG + Intronic
1048275304 8:133061565-133061587 TGGTGGAAGCACAGAGAGGAAGG + Intronic
1048545367 8:135381879-135381901 GTGAAGAGCCAGTGAGAGGAAGG + Intergenic
1048612527 8:136039330-136039352 TTGAAGAAGCACATAGATTACGG + Intergenic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049675830 8:143888608-143888630 CTGAAGGAGCAGGGAGAGGTCGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1050930682 9:11320869-11320891 TTGAAGAAGGAAAGAGAAGAGGG - Intergenic
1051014913 9:12463019-12463041 TGGAAGAAGGAGGGAAAGGAAGG - Intergenic
1051595641 9:18822012-18822034 TTCAAGCAGCAGGGAGAGCATGG + Intronic
1051605328 9:18912574-18912596 TGGAAGAAACAGGGAGATGAAGG + Intergenic
1051819504 9:21148539-21148561 TTGAAGAAAGCTAGAGAGGAGGG - Intergenic
1052167648 9:25352789-25352811 TTAAGGAAGAAGAGAGAGGAAGG - Intergenic
1052380906 9:27770023-27770045 TTGTAGAAGCAAAGAAAGGCAGG + Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052864480 9:33456781-33456803 TTTAGGAGGCAGAGTGAGGAGGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053312211 9:37027090-37027112 TCGGAGAAGCAGAGAAAGAAAGG - Intronic
1053419349 9:37967501-37967523 TAGTAGAAGCACAGAGGGGAAGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053596245 9:39564546-39564568 TTGAAGAAGGAAGGAGGGGAAGG + Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053854214 9:42321187-42321209 TTGAAGAAGTAAGGAGGGGAAGG + Intergenic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054570010 9:66800471-66800493 TTGAAGAAGGAAGGAGGGGAAGG - Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055362879 9:75513088-75513110 TGGAAGAGGCAGGGAGAAGATGG - Intergenic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056439115 9:86602860-86602882 TCCAAGAATCAGACAGAGGAAGG + Intergenic
1056463057 9:86826647-86826669 GGGCAGAAGAAGAGAGAGGAAGG - Intergenic
1056493229 9:87128823-87128845 TTGAGGTAGCAGAGAGGAGAAGG - Intergenic
1056704835 9:88943236-88943258 AGGAAGAGGCAGAGAGAGAAAGG - Intergenic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1056819613 9:89829476-89829498 ATTAAGAAGCAGAGAGAACAGGG + Intergenic
1056901103 9:90600215-90600237 GTGAGGAGGCTGAGAGAGGAGGG - Intergenic
1056975003 9:91245064-91245086 TTGAATAACCAGAGAGGGAAGGG + Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057770773 9:97965934-97965956 TAGAAGACACAGAGAGGGGATGG + Intergenic
1057867773 9:98694739-98694761 TCGGAGAAAGAGAGAGAGGAAGG - Intronic
1058007743 9:99937346-99937368 TTGAAGGAGAAGAGAAGGGAGGG - Intronic
1058242850 9:102587922-102587944 TTGAAGAAGAAAATAAAGGATGG - Intergenic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1058861730 9:109123054-109123076 TTGGAGTAGGACAGAGAGGAGGG - Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059670440 9:116485908-116485930 AGGAAGAGGCAGGGAGAGGAAGG + Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060419214 9:123455486-123455508 TTTACTAAGCAGAGAGAGTAGGG - Intronic
1060817207 9:126641334-126641356 CTGAGGATGCAGAGAGATGATGG - Intronic
1061743961 9:132726294-132726316 AGGAAGAAGAAGAGAAAGGAAGG - Intronic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062228151 9:135465527-135465549 TTGAAGAATCAGCGACAGGACGG + Intergenic
1185449548 X:275191-275213 AGGAAGAAGGAGGGAGAGGATGG + Intergenic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1186020047 X:5245025-5245047 TTGAAGAGGAAAAGAAAGGAGGG - Intergenic
1186045481 X:5532410-5532432 GAGAAGAAGAAGGGAGAGGAAGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186368345 X:8919397-8919419 TTGAAGATGCAGTGAGAGAATGG - Intergenic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1187135195 X:16541277-16541299 TAGACGAAGGAGGGAGAGGAGGG + Intergenic
1187276704 X:17822471-17822493 TAGACGAGGCAGAGAGTGGAGGG - Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187581750 X:20614630-20614652 GTGAAGGAGCAGGGAGAGTAAGG - Intergenic
1187659525 X:21525476-21525498 TTAAAGAAAGAGAGAGAGAAAGG - Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188758367 X:33993751-33993773 TTGAAGGTGGAGTGAGAGGAGGG - Intergenic
1188829701 X:34881396-34881418 TTTAGGAGGCAGAGAGAGCAAGG + Intergenic
1189530526 X:41877167-41877189 TTGAAGAAACAGAGAGGGACGGG - Intronic
1189910974 X:45810289-45810311 TTGAAGCTGCAAAGAGAGAAGGG + Intergenic
1190614278 X:52213934-52213956 TTGAAGATGCAGAGAAACAATGG - Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1190942616 X:55056880-55056902 TTCTAGAAACAGAGAGAGGCAGG + Intergenic
1191012537 X:55775477-55775499 CTGAAGAAGTAAAGAGAGCATGG + Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191915832 X:66200384-66200406 TTAAAGTGGCATAGAGAGGAAGG + Intronic
1192002415 X:67168110-67168132 TTGTATAAGCAGAGAAAGAAAGG - Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192369098 X:70498709-70498731 AGGAAGAAGCATAGAGAAGAAGG - Intronic
1192638458 X:72842902-72842924 CTGAGGTAGCAGAGAGGGGAAGG - Intronic
1192643256 X:72877906-72877928 CTGAGGTAGCAGAGAGGGGAAGG + Intronic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1194167863 X:90542798-90542820 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1194700082 X:97103405-97103427 TTAAGGAAGCAGAGAGAAAAAGG - Intronic
1194762899 X:97815482-97815504 ATGAAATAGCAGAGAAAGGATGG + Intergenic
1195123969 X:101786682-101786704 TAGAAAAAGCAGACAGAAGAAGG - Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195342221 X:103917387-103917409 TTCAAGTAGGAGAGAGACGAGGG + Intergenic
1195356706 X:104046205-104046227 TTCAAGTAGGAGAGAGATGAGGG + Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195813589 X:108860503-108860525 TTGAAAATGCAGGGAAAGGAAGG - Intergenic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1195993589 X:110708770-110708792 TTGAAAGAGCAGAGTGTGGATGG - Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196071198 X:111524468-111524490 TTGAAGAAGCACAGTGAGTGAGG + Intergenic
1196552125 X:117041251-117041273 TTAAAGAAGTAGTGAGAGGAAGG - Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1197662822 X:129192513-129192535 TAAAAGAAAAAGAGAGAGGATGG + Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199495793 X:148451020-148451042 GTGAAGATGCAGAGAGAAGGTGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199843857 X:151676618-151676640 TTGGAGAAGCCCAGAGAGAATGG + Exonic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200093888 X:153648281-153648303 CTGCAGAAGCTGCGAGAGGAAGG + Exonic
1200514120 Y:4120588-4120610 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic
1200843781 Y:7810814-7810836 TTTAATAACCACAGAGAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201074241 Y:10175163-10175185 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1201298505 Y:12486102-12486124 TTTAAAAAGCAGACAGAGAAAGG - Intergenic
1201516633 Y:14825320-14825342 TGGAAGGAGGGGAGAGAGGAAGG - Intronic
1201697402 Y:16841019-16841041 GTAAAGAAGGAGAGAAAGGAAGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic