ID: 1166887755

View in Genome Browser
Species Human (GRCh38)
Location 19:45972356-45972378
Sequence GTGTGTGACACAGGCGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166887755_1166887764 16 Left 1166887755 19:45972356-45972378 CCAGCCACGCCTGTGTCACACAC 0: 1
1: 0
2: 0
3: 12
4: 199
Right 1166887764 19:45972395-45972417 CTGATCTACACGGCCTCTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1166887755_1166887760 6 Left 1166887755 19:45972356-45972378 CCAGCCACGCCTGTGTCACACAC 0: 1
1: 0
2: 0
3: 12
4: 199
Right 1166887760 19:45972385-45972407 CCCCTTTCCTCTGATCTACACGG 0: 1
1: 0
2: 1
3: 13
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166887755 Original CRISPR GTGTGTGACACAGGCGTGGC TGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900956337 1:5888294-5888316 GGCTGTGCCCCAGGCGTGGCTGG + Intronic
901012310 1:6208776-6208798 GTGTTTGTCCCAGCCGTGGCCGG - Intronic
906083188 1:43107612-43107634 GTGGGAGACTCAGGCATGGCGGG + Intergenic
906702581 1:47870700-47870722 GTGTGGGACACAGACATGGGAGG + Intronic
908492885 1:64663966-64663988 GTGTGTGGCCCAGGGGAGGCTGG + Intronic
908605685 1:65794063-65794085 GTGTGTGTCACACACGTGCCTGG + Intronic
913685142 1:121224674-121224696 CTGAGTGACACAGGAGTAGCTGG - Intronic
914036988 1:144012279-144012301 CTGAGTGACACAGGAGTAGCTGG - Intergenic
914152467 1:145055653-145055675 CTGAGTGACACAGGAGTAGCTGG + Intronic
915525505 1:156473665-156473687 GTGGGTGACACAGGCCAGGATGG + Intronic
916170467 1:161998028-161998050 GTGTGGGCCACAGTGGTGGCTGG + Exonic
918096802 1:181342931-181342953 CTGTGTGACAAATGGGTGGCAGG + Intergenic
919591548 1:199510255-199510277 GTGTGTAGCACAGGAGTGACAGG - Intergenic
920472459 1:206243231-206243253 CTGAGTGACACAGGAGTAGCTGG - Intronic
920565342 1:206968637-206968659 GTTTGTGACACAGGCTGTGCAGG + Intronic
921110834 1:212035300-212035322 ATGGGTGAAACAGGCGTGGGGGG - Intronic
923324780 1:232871544-232871566 GTGGGAGACTCAGGCATGGCGGG + Intergenic
1062920179 10:1273587-1273609 GTGGGGGGCACAGGCGGGGCCGG - Intronic
1064981578 10:21172273-21172295 CTGTGTCACCCAGGTGTGGCAGG - Intronic
1066084594 10:31963697-31963719 GGGAGAGACACAGGCCTGGCTGG + Intergenic
1066657654 10:37711012-37711034 GTATGTGACACAGGCACAGCGGG - Intergenic
1067042135 10:42960614-42960636 GTATGTGACACAGGCACAGCAGG - Intergenic
1067829051 10:49599559-49599581 GTGTGGGGGACAGGCGTGGGGGG - Intergenic
1072618557 10:97065368-97065390 ATGTGTGCCACAGGCGAGGTTGG + Intronic
1073207812 10:101777899-101777921 GTATCTGCCACAGGCTTGGCAGG + Intronic
1074629841 10:115240026-115240048 GTGTGTGAGGCAGGCGTGAGGGG + Intronic
1075096965 10:119478358-119478380 GTGTGTGGCAGGGGCGTGGCGGG + Intergenic
1075255654 10:120924085-120924107 GTGGGAGACTCAGGCATGGCCGG - Intergenic
1075269349 10:121035439-121035461 GTGGGAGACTCAGGCATGGCGGG + Intergenic
1075641596 10:124068520-124068542 GTGTGTGACACAGACCAGACTGG - Intronic
1075877843 10:125822934-125822956 GTGTGTGACACAGTGGGGCCAGG - Intronic
1076440420 10:130477443-130477465 GGGAGGGACACAGGCGGGGCTGG + Intergenic
1076852770 10:133101204-133101226 GGGTGTGACAAGGGCGGGGCAGG - Intronic
1076866797 10:133170404-133170426 CTGCAGGACACAGGCGTGGCAGG + Intronic
1077074595 11:694648-694670 GTGTGAGGGACAGGTGTGGCGGG + Intronic
1079100117 11:17535941-17535963 GATTGTGACTCAGGCCTGGCAGG + Intronic
1079905889 11:26246701-26246723 GTGTGTGGCAGAGACGTGGTGGG + Intergenic
1080018022 11:27527549-27527571 CTGTGTGACACTGGCAAGGCAGG - Intergenic
1080268653 11:30426971-30426993 GCGTGTGTCACATGCCTGGCTGG + Intronic
1084089210 11:66869286-66869308 GTGGATGACACAGCCTTGGCGGG - Intronic
1084191043 11:67498869-67498891 GTGGGTGTCACAGCAGTGGCCGG + Intronic
1085245628 11:75098467-75098489 GTGGGAGACTCAGGCATGGCGGG - Intergenic
1086404411 11:86487677-86487699 GTGTCTGACAGAGGCTTGCCTGG - Intronic
1089373540 11:117978587-117978609 GTGGGTGGCTCAGGCATGGCGGG + Intergenic
1090133532 11:124170821-124170843 GTGGGAGACTCAGGCATGGCGGG + Intergenic
1090804576 11:130194886-130194908 GTGTGTGAGACAGAGGTGGATGG + Intronic
1091846535 12:3660334-3660356 CAGTGTGAGACAGGCGAGGCTGG + Intronic
1092471799 12:8787527-8787549 GTGGGAGGCTCAGGCGTGGCGGG - Intergenic
1094834841 12:34317478-34317500 GGGTGTGAAACAGGGGTGCCAGG + Intergenic
1102260820 12:111442409-111442431 AGGTGTGGCAGAGGCGTGGCTGG + Intronic
1102468915 12:113148474-113148496 CTGTGTTACACAGGCTGGGCTGG + Intergenic
1106096199 13:26646517-26646539 GGGAGTGACACAGGTGTGGGGGG - Intronic
1106526073 13:30542383-30542405 GTGGGAGGCACAGGGGTGGCAGG - Intronic
1106924936 13:34604056-34604078 GTGGGTGGCACAGCCCTGGCGGG + Intergenic
1108249227 13:48548559-48548581 GTGTGGGAAACAGGCATTGCTGG + Intergenic
1112319899 13:98396244-98396266 GTGTGTGCCAGAGGCATGGCGGG + Intronic
1112408620 13:99143019-99143041 ATGTGTCACCCAGGCCTGGCAGG + Intergenic
1112470854 13:99687365-99687387 GTGTGTGCCAAAGGCATGCCTGG - Intronic
1116883936 14:50200259-50200281 GTGTGTGAGGCAGGCGGGGCGGG + Intronic
1119386614 14:74261327-74261349 GTCTGTGTCACAGCCATGGCAGG - Exonic
1121087510 14:91157730-91157752 GTGGGTGACACTGGGGTGCCTGG + Intronic
1121234012 14:92379437-92379459 GGGTCTGAGACAGGCCTGGCAGG + Intronic
1121647624 14:95530671-95530693 TTGTGTGACACAGTGGAGGCTGG + Intergenic
1123061479 14:105596668-105596690 GTGTGTGGCCCTGGAGTGGCTGG - Intergenic
1123085932 14:105717579-105717601 GTGTGTGGCCCTGGAGTGGCTGG - Intergenic
1126439905 15:48676110-48676132 GTGTTTGTGAGAGGCGTGGCTGG - Intergenic
1128861443 15:71077595-71077617 GTGTGGGACACAGGGGAAGCTGG - Intergenic
1129767756 15:78181007-78181029 GTGTGTGCCACCGGCATGCCTGG - Intronic
1132873852 16:2127295-2127317 GTGTGTGAGACGTGCGGGGCTGG - Intronic
1133127663 16:3656821-3656843 GTGTGTGACACAGGCATTCCAGG - Intronic
1134460173 16:14423553-14423575 GTGTGTCAGAGAGGCGTGCCAGG - Intergenic
1134552940 16:15146469-15146491 GTGTGTGAGACGTGCGGGGCTGG - Intergenic
1137519770 16:49182337-49182359 GTGTGTTACACAGACTTGCCGGG + Intergenic
1137751445 16:50863854-50863876 GTGTGTGTCACTGTCCTGGCTGG + Intergenic
1138519484 16:57562976-57562998 GCGTGTGACAGAGGTGTGGGTGG + Intronic
1140909369 16:79437889-79437911 GAGTGGGACACAGGCCAGGCGGG + Intergenic
1141436320 16:84001787-84001809 ATGTGTGAGTCAGGGGTGGCAGG - Intronic
1141697668 16:85627866-85627888 GTGGGGGACACAGGGATGGCGGG - Intronic
1142134837 16:88447018-88447040 GTTTGTGACACGGGCGTAGATGG - Intergenic
1143728322 17:8865465-8865487 CTCTGTGCCACAGGAGTGGCTGG - Intronic
1144816736 17:18040043-18040065 GTGTGAGACACAGGCTGGGAAGG - Intronic
1147164920 17:38587926-38587948 GTGTGTGAAAGAGGAGGGGCAGG - Intronic
1151946529 17:77322893-77322915 CTGTGTGACAGAGGCCTGCCCGG + Intronic
1152248065 17:79196264-79196286 GTGTGAGAAACAGCTGTGGCTGG - Intronic
1152468767 17:80479170-80479192 GTGTGGGACTCAGGCAGGGCCGG - Intergenic
1152470340 17:80487619-80487641 GGGAGTGACACAGGAGTGGAAGG - Intergenic
1153812406 18:8763489-8763511 GAGTGTGACACAAGCTGGGCTGG - Intronic
1156465603 18:37346392-37346414 GAGTGTGACAGAGGCAGGGCAGG + Intronic
1156522861 18:37736365-37736387 GTGTGTGACAGAGTGGGGGCTGG + Intergenic
1157150748 18:45215278-45215300 GTGTGTAAGACAGGCGTGTAAGG - Intronic
1157564000 18:48667678-48667700 GCTGGTGACACAGGTGTGGCTGG - Intronic
1160005195 18:75063983-75064005 GTGTGTGACACGGCCGCGGCCGG + Exonic
1160527974 18:79548312-79548334 GAGTGTGACTCAGCCGTGCCCGG + Intergenic
1161108744 19:2456818-2456840 GTGGGCGACAGCGGCGTGGCGGG + Exonic
1161241983 19:3227840-3227862 CTGTGTGACATAGGGGTGACAGG + Intronic
1163363380 19:16862134-16862156 GTGTGTGACAGATGGGTGGGAGG + Intronic
1164004095 19:21133299-21133321 TTGTGTGCCAAAGGCATGGCTGG + Intergenic
1164602291 19:29570463-29570485 GTGGCTCACACAGGCGAGGCAGG + Intergenic
1166887755 19:45972356-45972378 GTGTGTGACACAGGCGTGGCTGG - Intronic
924964895 2:66919-66941 GTGTGTGACACACGGGTGAGCGG - Intergenic
924964921 2:67181-67203 GTGTGTGACACACGGGTGAGCGG - Intergenic
924964924 2:67235-67257 GTGTGTGACACAGGGGTGAGTGG - Intergenic
924964936 2:67341-67363 GTGTGTGACACACGGGTGAGCGG - Intergenic
924964942 2:67393-67415 GTGTGTGACACACGGGTGAGCGG - Intergenic
924964947 2:67445-67467 GTATGTGACACAGGGGTGAGCGG - Intergenic
924964968 2:67656-67678 GTGTGTGACACACGGGTGAGCGG - Intergenic
924964985 2:67813-67835 GTGCGTGACACAGGGGTGAGCGG - Intergenic
924964992 2:67865-67887 GTGTGTGACACATGGGTGAGCGG - Intergenic
924965001 2:67971-67993 GTGTGTGACACACGGGTGAGCGG - Intergenic
924965012 2:68076-68098 GTGTGTGACACACGGGTGAGCGG - Intergenic
924965021 2:68182-68204 GTGTGTGACACATGGGTGAGCGG - Intergenic
924965038 2:68396-68418 GTGTGTGACACAGGGGTGAGTGG - Intergenic
924965057 2:68610-68632 GTGTGTGACACAGGGGTGAGTGG - Intergenic
924965069 2:68716-68738 GTGTGTGACACACGGGTGAGTGG - Intergenic
924965083 2:68874-68896 GTGTGTGACACACGGGTGAGTGG - Intergenic
925098947 2:1229698-1229720 GTGGGAGGCTCAGGCGTGGCGGG + Intronic
935170953 2:100611240-100611262 CTGTGGGACACATGGGTGGCTGG + Intergenic
935356519 2:102206788-102206810 GGGAGGGACACAGGCCTGGCTGG - Intronic
935602233 2:104934381-104934403 GTGTGTGATACAGGCTTCCCAGG + Intergenic
939053187 2:137331707-137331729 GTGGGAGACTCAGGCATGGCGGG + Intronic
940425474 2:153526140-153526162 GTGAAGGACACAGGCCTGGCTGG + Intergenic
943947843 2:194090491-194090513 GGGTGGGGCTCAGGCGTGGCAGG + Intergenic
1170709181 20:18774931-18774953 GTGAGGGACACAAGCCTGGCTGG - Intergenic
1172034356 20:32000968-32000990 CTGTGGGACACAGGTGTAGCAGG - Exonic
1173124432 20:40323664-40323686 GTGTGTGACTCATGTGTGGAGGG + Intergenic
1173901474 20:46592794-46592816 GTGAGTGAAACAGGCCAGGCTGG + Intronic
1176020988 20:62962377-62962399 GACTGGGACACATGCGTGGCTGG + Intronic
1176273497 20:64248687-64248709 GTGGCTGAGACAGGAGTGGCTGG - Intergenic
1177625008 21:23647352-23647374 GTCTGTGACACAGGCAAGGATGG + Intergenic
1179546193 21:42113724-42113746 GAGTGTGACACTGTCGGGGCTGG + Exonic
1179660029 21:42868471-42868493 GTGTGTGCCGTAGGCCTGGCTGG - Intronic
1184288146 22:43483521-43483543 GCGTGAGACACAGGCGGGCCCGG + Intronic
1185343880 22:50303068-50303090 CTGTGTGACTCAGACGTGGTAGG - Intronic
949259003 3:2083888-2083910 GTGTGAGGCTCAGGCATGGCGGG - Intergenic
949617464 3:5769947-5769969 GCGTGTGACAAGGGTGTGGCTGG + Intergenic
950044920 3:9943391-9943413 GTGTGAGACAGAGGTGTGTCCGG + Exonic
950600350 3:14029594-14029616 GTGGGAGACTCAGGCATGGCGGG + Intronic
952821700 3:37491608-37491630 GTGTGTGACCCAGGCTTGTTGGG + Intronic
953864557 3:46573021-46573043 GTGTCTGTCACAGATGTGGCTGG + Intronic
954915348 3:54144525-54144547 GTGTCTGACACAGGCTTGCCTGG + Intronic
961602361 3:128071763-128071785 GTGTGTGTCAAAGGCTTGGTTGG + Intronic
964393755 3:156224021-156224043 ATGTGAGACTCAGGCATGGCGGG + Intronic
969937293 4:10695010-10695032 GTGATTGACAGAGGCCTGGCAGG + Intergenic
970544421 4:17112618-17112640 GTGTGTGAAATAGGAGTGGGAGG + Intergenic
978030624 4:103937039-103937061 GTGTGAGACTCAGGCATGGCAGG - Intergenic
978091894 4:104727367-104727389 GTGGGTTACACAGGAGTTGCTGG + Intergenic
978929768 4:114296250-114296272 GTGGGTGGCTCAGGCATGGCAGG + Intergenic
980595407 4:134948250-134948272 GAGTGGGGCTCAGGCGTGGCAGG + Intergenic
981575712 4:146202938-146202960 CTGTGTGAGAAAGGTGTGGCGGG - Intergenic
985879359 5:2627100-2627122 GTGTGGCACCCAGGCGGGGCGGG - Intergenic
987005764 5:13707607-13707629 GCGTGTGACAGGGGTGTGGCTGG - Intronic
988149342 5:27356046-27356068 GTGTGTTACACAGGAGTAACAGG - Intergenic
993813606 5:92513320-92513342 GTGTGAGTCACAGGTGTGGGTGG + Intergenic
994208523 5:97062264-97062286 GGGGGTGACACAGACCTGGCAGG + Intergenic
994251484 5:97541978-97542000 GTGTGGGGCTCAGGCATGGCGGG + Intergenic
999348465 5:150845251-150845273 GTGTGTGAAACAGACCTGCCAGG + Intergenic
1000084815 5:157879664-157879686 GCGTGTGGCACAGGACTGGCGGG + Intergenic
1001408580 5:171494781-171494803 GGTGGTGACACAGGCGGGGCAGG + Intergenic
1001689656 5:173623645-173623667 GGGTGTGGCTCAGGTGTGGCTGG + Intergenic
1002643129 5:180640068-180640090 GCGTCAGCCACAGGCGTGGCGGG + Intronic
1002789348 6:426299-426321 GTGGGAGACTCAGGCATGGCGGG + Intergenic
1004220647 6:13743467-13743489 GGGAGAGACTCAGGCGTGGCGGG - Intergenic
1005925740 6:30444148-30444170 GTCCGTGACTCACGCGTGGCAGG - Intergenic
1007107136 6:39291355-39291377 GTTTGTGACATAGGCTTGGGTGG + Intergenic
1007255347 6:40524394-40524416 GTGTGTGTTAGAGGTGTGGCGGG - Intronic
1009471432 6:64031376-64031398 GGGTGTGGCTCAGGCATGGCAGG - Intronic
1013099856 6:106976938-106976960 GTTTGTGACTCAGGAGTGCCGGG + Intergenic
1014852758 6:126361911-126361933 CTGTGTGCCACAGCCCTGGCAGG + Intergenic
1015903752 6:138095351-138095373 GTGGGCAACACAGGCGAGGCAGG - Intronic
1016981885 6:149862024-149862046 GTGTGTGCAACAGCCGTGGTGGG + Intronic
1019062523 6:169266438-169266460 GAGTGAGAAACAGGCCTGGCTGG + Intergenic
1019880887 7:3859758-3859780 GTGAGTGACACAGGTGTGGTGGG - Intronic
1019887365 7:3917327-3917349 GAGTGTGATGCAGGGGTGGCTGG + Intronic
1021761244 7:23904809-23904831 TGGTGAGACCCAGGCGTGGCGGG + Intergenic
1023540022 7:41254912-41254934 GTGTATGACAGAGACCTGGCAGG - Intergenic
1023988338 7:45111572-45111594 GTGCACAACACAGGCGTGGCTGG - Intronic
1026477791 7:70751673-70751695 GTCTGTGACACAGGTGTAGGAGG - Intronic
1027867514 7:83666462-83666484 GTGGGTGTCACAGGGGTGTCGGG - Intergenic
1029217628 7:98962691-98962713 TAGTGTGACACTGGGGTGGCAGG - Intronic
1031727370 7:125257969-125257991 GCCTGTGACACAGGCTTAGCAGG + Intergenic
1035165769 7:156988898-156988920 GTGTGTCCCACAGGCCAGGCGGG + Intergenic
1035708256 8:1694239-1694261 GTGCCTGAGACAGGCCTGGCAGG + Intronic
1036915002 8:12796525-12796547 GTGGGAGGCACAGGCATGGCGGG - Intergenic
1037754585 8:21702776-21702798 GTGTGTGGCTGAGGCGTGGGGGG - Intronic
1042119723 8:65473425-65473447 GTGAGTGACTCTGGCGGGGCCGG - Intergenic
1042420728 8:68585655-68585677 GTGGGTCAGCCAGGCGTGGCAGG + Intronic
1042809450 8:72807713-72807735 TTGTGTGACACAGAAGTAGCTGG - Intronic
1043366923 8:79543448-79543470 GTGAGAGACACAGGCCTGGCTGG + Intergenic
1044395139 8:91702665-91702687 GGGAGAGACACAGGCCTGGCTGG - Intergenic
1049784131 8:144442534-144442556 GTGTGTGGCACAGGTGTGAGAGG + Intronic
1050072638 9:1832450-1832472 GTGTGTGACAGAGGCTGGGTGGG + Intergenic
1051094990 9:13456407-13456429 GTGTGTGACAGATGTGTGGTAGG - Intergenic
1053292749 9:36892562-36892584 GTGTGTGAGGCAGGAGTGACTGG - Intronic
1057647478 9:96890250-96890272 CTGGGTGGCACAGGCCTGGCTGG - Intergenic
1059819076 9:117951499-117951521 GTGTCTCACACAGGCCTAGCAGG + Intergenic
1060018441 9:120107597-120107619 GTGTGGGACACAGGAATGGTTGG - Intergenic
1061086923 9:128404916-128404938 GTGTGAGACACTGGGGTGGGAGG - Intergenic
1061091882 9:128431148-128431170 CTGAGGGACACAGGTGTGGCGGG - Intronic
1061448474 9:130655644-130655666 GTGTGTTACACTGGCCTGGAAGG - Intergenic
1061948047 9:133919831-133919853 GTGGGTGAGGCAGGGGTGGCCGG - Intronic
1062180570 9:135189130-135189152 GTGTGTGACACGGGGGTGTGGGG - Intergenic
1192538583 X:71949535-71949557 GTGTGTGAGCCAGGCGGGTCTGG - Intergenic
1193040178 X:76996758-76996780 GTGGGAGACTCAGGCATGGCAGG + Intergenic
1194438023 X:93893845-93893867 GTGAAGGACACAGGCCTGGCTGG - Intergenic
1195199986 X:102539437-102539459 GGGTAGGACACAGGCCTGGCTGG - Intergenic
1196523064 X:116696175-116696197 GTGTGTGATGGAGGTGTGGCTGG - Intergenic
1197013327 X:121593830-121593852 ATGTGTGACAGGGGTGTGGCTGG + Intergenic
1197565305 X:128076988-128077010 GTCTGTGACACAGCCTTGGAAGG + Intergenic
1197649669 X:129051029-129051051 GTGAGTGAAACAGGCATGGATGG - Intergenic
1198664287 X:139004125-139004147 GTGGGAGACTCAGGCATGGCGGG + Intronic
1199640805 X:149859007-149859029 GGGTGGGACACAGGCGGGCCTGG - Intergenic