ID: 1166891188

View in Genome Browser
Species Human (GRCh38)
Location 19:45994813-45994835
Sequence CCGATCAGTCATGAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166891188_1166891192 -10 Left 1166891188 19:45994813-45994835 CCTTCCAGTTCATGACTGATCGG No data
Right 1166891192 19:45994826-45994848 GACTGATCGGTTTAAAATATGGG No data
1166891188_1166891193 15 Left 1166891188 19:45994813-45994835 CCTTCCAGTTCATGACTGATCGG No data
Right 1166891193 19:45994851-45994873 GTTCAAAAGCCGTGTGAACCCGG No data
1166891188_1166891194 16 Left 1166891188 19:45994813-45994835 CCTTCCAGTTCATGACTGATCGG No data
Right 1166891194 19:45994852-45994874 TTCAAAAGCCGTGTGAACCCGGG No data
1166891188_1166891195 23 Left 1166891188 19:45994813-45994835 CCTTCCAGTTCATGACTGATCGG No data
Right 1166891195 19:45994859-45994881 GCCGTGTGAACCCGGGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166891188 Original CRISPR CCGATCAGTCATGAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr