ID: 1166891560

View in Genome Browser
Species Human (GRCh38)
Location 19:45997119-45997141
Sequence GCGAACACATTGCCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166891558_1166891560 -4 Left 1166891558 19:45997100-45997122 CCGCTGTCATTTGAACATAGCGA 0: 1
1: 0
2: 0
3: 18
4: 315
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891550_1166891560 30 Left 1166891550 19:45997066-45997088 CCTGGCTCACTCTGCTGCAGCCA 0: 2
1: 9
2: 40
3: 213
4: 740
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891555_1166891560 1 Left 1166891555 19:45997095-45997117 CCTCCCCGCTGTCATTTGAACAT No data
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891552_1166891560 10 Left 1166891552 19:45997086-45997108 CCACCCTGGCCTCCCCGCTGTCA 0: 1
1: 0
2: 4
3: 60
4: 556
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891553_1166891560 7 Left 1166891553 19:45997089-45997111 CCCTGGCCTCCCCGCTGTCATTT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891556_1166891560 -2 Left 1166891556 19:45997098-45997120 CCCCGCTGTCATTTGAACATAGC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891554_1166891560 6 Left 1166891554 19:45997090-45997112 CCTGGCCTCCCCGCTGTCATTTG 0: 1
1: 0
2: 1
3: 32
4: 238
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1166891557_1166891560 -3 Left 1166891557 19:45997099-45997121 CCCGCTGTCATTTGAACATAGCG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166891560 Original CRISPR GCGAACACATTGCCATCTCA GGG Intronic
916488669 1:165281895-165281917 GAAAACTCATTGCCATCTCTGGG - Intronic
924833260 1:247620537-247620559 GGGACCACACTGCCTTCTCAGGG - Intergenic
1062787344 10:276270-276292 GTGAAATTATTGCCATCTCAAGG - Exonic
1066003624 10:31127635-31127657 GTGAACACAGTGCCATATAAAGG + Intergenic
1068433210 10:56959346-56959368 GCCAACACATTGCCAGTTAATGG + Intergenic
1068579298 10:58720980-58721002 GCCAACAGCTTTCCATCTCAAGG + Intronic
1070520987 10:77253430-77253452 GCGAAATCATTGCCATTGCAGGG - Intronic
1072528481 10:96296027-96296049 GCACACAAATTCCCATCTCAGGG - Intergenic
1076174220 10:128354574-128354596 CCCAGCACATTCCCATCTCAGGG + Intergenic
1080100602 11:28455355-28455377 GGGAACCAATTGCTATCTCATGG - Intergenic
1083019714 11:59494545-59494567 GTGGACACATCCCCATCTCAGGG - Intergenic
1084356303 11:68641088-68641110 GAGAACACAGTGCCATATGAAGG - Intergenic
1100862759 12:98823960-98823982 GCAAACACTTTGCCATGTCTGGG - Intronic
1101742431 12:107511055-107511077 GCAAACACATTTTCATCTCAGGG - Intronic
1104108845 12:125687713-125687735 ACGAGGACATTGCCATCACAGGG - Intergenic
1105532593 13:21233227-21233249 GGGAACACAGTGACATCCCAGGG + Intergenic
1107591116 13:41907655-41907677 TCGAATACATTGCCCTGTCAAGG - Exonic
1110515529 13:76408069-76408091 GTGAACACATTACCATGGCAAGG + Intergenic
1110876448 13:80516763-80516785 GCAAACACATTCCCTGCTCATGG - Intergenic
1111707191 13:91764962-91764984 GCCAAAACATTACCATCACATGG - Intronic
1111995516 13:95162520-95162542 GCGATAACATTGTGATCTCAAGG + Intronic
1113582955 13:111441443-111441465 GCTCAAACATTGCCTTCTCAAGG + Intergenic
1115920837 14:38371547-38371569 CCAAGCACATTGCCACCTCATGG - Intergenic
1119892176 14:78191249-78191271 GTTAACTCATTGCCTTCTCATGG + Intergenic
1120612283 14:86657288-86657310 GGGAAGGCATTGCCACCTCAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1130885588 15:88090005-88090027 GCCAGCACAGTTCCATCTCAGGG + Intronic
1131048130 15:89329057-89329079 GCATGCACATGGCCATCTCAGGG - Exonic
1135346679 16:21694683-21694705 CCGAGCTCATTCCCATCTCAGGG - Intronic
1138209246 16:55149292-55149314 GGGGACACATTGACATCCCAGGG - Intergenic
1153641660 18:7162894-7162916 CCGAACTCAGTGCCATCTCTCGG - Intergenic
1157223898 18:45845961-45845983 GCCAACTCATTTCCATCTCAAGG - Intergenic
1160369323 18:78358465-78358487 GCAAACAGCTTCCCATCTCAAGG + Intergenic
1163798342 19:19349830-19349852 GCCAACACAGTGTCCTCTCAGGG + Intronic
1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG + Intronic
1167583271 19:50358881-50358903 GCCAACAAACTGCCATCACAGGG + Intronic
926482291 2:13414190-13414212 GAGACAACATCGCCATCTCAAGG + Intergenic
931775854 2:65539753-65539775 GCTAACACACTGCCCTCCCAGGG - Intergenic
934771675 2:96911582-96911604 GCGAACACATGAGCATCTGAAGG + Intronic
944425750 2:199581294-199581316 TCCAACACATTTCCCTCTCATGG + Intergenic
945628012 2:212235595-212235617 GCAAACACATTCCATTCTCATGG - Intronic
945732666 2:213559307-213559329 GACATCACATTGCCATCACAAGG - Intronic
947042289 2:225936938-225936960 TCAAGCACATTCCCATCTCAAGG + Intergenic
948084183 2:235232682-235232704 GTGACAACATTGTCATCTCATGG - Intergenic
948963457 2:241357290-241357312 GCTAACCCACTGCCACCTCAGGG - Intronic
1169791663 20:9416247-9416269 GGGATCACAATGACATCTCAGGG - Intronic
1170418290 20:16167850-16167872 AGGAACACATTGCTACCTCATGG - Intergenic
1175668414 20:60880047-60880069 GAGAACACATTCCCATGCCATGG + Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
959737202 3:109673133-109673155 GCAAGCACATTTCCAGCTCAGGG + Intergenic
964999452 3:162934681-162934703 GCGATCACATTGCTATCTCATGG - Intergenic
968808470 4:2789541-2789563 GCAGACACATTCCCACCTCAGGG - Intergenic
971131201 4:23812956-23812978 GAGAACATCTTGTCATCTCAAGG + Intronic
980801932 4:137762913-137762935 GCAGCCACATTGCCCTCTCATGG - Intergenic
981065988 4:140486281-140486303 GCTAAGACATTACCACCTCAGGG + Intronic
985475352 5:75727-75749 GAGAACACTTTGCCATGCCAGGG - Intergenic
987204320 5:15609565-15609587 GAGAGCAGATTGCCATGTCAGGG - Intronic
992037569 5:72795681-72795703 GCCATCACATTGCTATGTCAAGG - Intergenic
995816426 5:116174239-116174261 GCAAGCACACTTCCATCTCAGGG - Intronic
997186003 5:131882811-131882833 CCAAGCACATTCCCATCTCATGG + Intronic
1001044142 5:168358449-168358471 GCCATCACTTTGTCATCTCATGG + Intronic
1003389673 6:5702893-5702915 GTGAACACAGTGACATCCCAGGG - Intronic
1008019452 6:46559351-46559373 ACAAACACATTGCCATGTAAAGG + Intronic
1010064577 6:71667032-71667054 TCAAGCACATTCCCATCTCAGGG + Intergenic
1010983564 6:82396828-82396850 GCAAGCACTTTGCCATCTCTGGG + Intergenic
1014450252 6:121573570-121573592 CCAAACACATTCTCATCTCAGGG - Intergenic
1018225582 6:161625731-161625753 GTGCACAAATTGCCAGCTCAGGG + Intronic
1022313584 7:29221651-29221673 GAGAACACATTGCCATATGTGGG - Intronic
1026390173 7:69893109-69893131 GCATACACATTGCCATCTGTTGG - Intronic
1030068342 7:105677615-105677637 GCTACCACAGTGCCAACTCATGG + Intronic
1038897636 8:31803873-31803895 GAAGACACATTTCCATCTCAGGG + Intronic
1039112178 8:34052150-34052172 GCGACCACACTGCATTCTCATGG - Intergenic
1050207235 9:3210028-3210050 TGGAACACTTTGCGATCTCAGGG + Intergenic
1052455426 9:28690871-28690893 ACAAACACACTGCCATCCCATGG + Intergenic
1185699247 X:2217942-2217964 CTGAACACACAGCCATCTCATGG + Intergenic
1188097228 X:26039759-26039781 AGGAACACTTTGACATCTCAGGG - Intergenic
1192252554 X:69424809-69424831 GTGAACACATTCCCTTTTCAAGG + Intergenic
1196754667 X:119147680-119147702 GCTAACACATTGCCATCTTGTGG - Intronic