ID: 1166893071

View in Genome Browser
Species Human (GRCh38)
Location 19:46006501-46006523
Sequence TGCCCTCCGTGTGGCAGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166893067_1166893071 -6 Left 1166893067 19:46006484-46006506 CCCAGGTGTGTGCTAGGTGCCCT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
1166893058_1166893071 27 Left 1166893058 19:46006451-46006473 CCTAGCCCGCCTAGAGAACGGGA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
1166893061_1166893071 22 Left 1166893061 19:46006456-46006478 CCCGCCTAGAGAACGGGAAGGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
1166893068_1166893071 -7 Left 1166893068 19:46006485-46006507 CCAGGTGTGTGCTAGGTGCCCTC 0: 1
1: 0
2: 3
3: 19
4: 184
Right 1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
1166893062_1166893071 21 Left 1166893062 19:46006457-46006479 CCGCCTAGAGAACGGGAAGGGCT 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 182
1166893063_1166893071 18 Left 1166893063 19:46006460-46006482 CCTAGAGAACGGGAAGGGCTGTG 0: 1
1: 0
2: 2
3: 19
4: 189
Right 1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166893071 Original CRISPR TGCCCTCCGTGTGGCAGTGG CGG Intronic
900124030 1:1061729-1061751 TGCCCTTTGTGGGGCAGAGGGGG + Intergenic
900321211 1:2085097-2085119 TGCCCTCCCTGTGGCTCTGCGGG + Intronic
900675126 1:3880673-3880695 TGCCTTCAGTGTGGCTCTGGTGG + Intronic
901811902 1:11772145-11772167 TGTCCTCTGTGTGGCCCTGGTGG - Exonic
901834752 1:11916840-11916862 GGCCCTCAGTGTGGCAGTGTTGG - Intergenic
905655693 1:39684677-39684699 CGCCCTGTGTGTGGCAGGGGAGG - Intronic
908768333 1:67573615-67573637 TGCTCTCAATCTGGCAGTGGAGG + Intergenic
912692248 1:111813132-111813154 TGCCCTCCATGTGGGAGTGGGGG + Intronic
915751142 1:158212490-158212512 TGCCCTCCCCGCAGCAGTGGTGG - Intergenic
915902470 1:159856405-159856427 TGCCATCCATTTGCCAGTGGGGG - Intronic
918857896 1:189782029-189782051 TACCCCCAGTCTGGCAGTGGTGG - Intergenic
920255037 1:204648928-204648950 CTCCCTCCATGTGCCAGTGGAGG - Intronic
920349918 1:205331194-205331216 TGCCCTCTGTGCGGCGATGGTGG + Intergenic
920389896 1:205592934-205592956 TGCCTGCCTTGTGGCTGTGGTGG + Intronic
922287398 1:224182318-224182340 TGCACTCTGTGAGGCAGAGGCGG - Intronic
924365100 1:243284593-243284615 TGCATTCCGTGTGGGAGAGGGGG - Intronic
1063093665 10:2890373-2890395 TGCCCTCCGTGCTGCTGTGGGGG - Intergenic
1065322156 10:24519983-24520005 TGCCTTTCGTGTGGTGGTGGTGG - Intronic
1066053531 10:31659766-31659788 TTCCATCCATGAGGCAGTGGAGG + Intergenic
1067039113 10:42939705-42939727 GGCCCTCTGGGTGGCCGTGGTGG - Intergenic
1067758703 10:49026638-49026660 TGCCCTCCGTGTGGAAAAAGAGG + Intronic
1067822725 10:49544119-49544141 TGTACTCCGTGTGGGAGTGCAGG - Intergenic
1068335385 10:55627954-55627976 GGCGCGCAGTGTGGCAGTGGCGG - Intergenic
1071288654 10:84172458-84172480 TTCCCTCAGTTTGGGAGTGGAGG + Intergenic
1073242143 10:102065849-102065871 AGCCCGCGTTGTGGCAGTGGCGG + Exonic
1073748052 10:106492774-106492796 TGGCCTCCCTCCGGCAGTGGTGG - Intergenic
1075446095 10:122514174-122514196 TTCCCTTTGTGTTGCAGTGGTGG + Exonic
1076719364 10:132386535-132386557 TGCCTCCCGGATGGCAGTGGCGG + Intergenic
1076722598 10:132399210-132399232 TCCCCTGCATGTGACAGTGGAGG + Intronic
1077294749 11:1820942-1820964 TTCCCTCCATGTGGCCCTGGGGG + Intergenic
1077330391 11:1981610-1981632 CGCCCTCCGTGTGGCAAATGAGG + Intronic
1083621246 11:64050413-64050435 AGCCCTCAGTGTGACAGTGGTGG + Intronic
1085017553 11:73185376-73185398 TCGCCTCCGTGTGGCAGCAGGGG - Intergenic
1085182013 11:74543964-74543986 TGCTCTCCGTGTGGTTGTTGTGG + Intronic
1090228491 11:125085517-125085539 TGCCCTCCGGTGGGCAGGGGAGG + Intronic
1202813370 11_KI270721v1_random:36789-36811 CGCCCTCCGTGTGGCAAATGAGG + Intergenic
1092218381 12:6697658-6697680 CGCCCCCCGTGTGCCAGGGGAGG - Exonic
1099259093 12:80354039-80354061 GATCCTCCGTGTGGCAGTGCTGG + Intronic
1100980835 12:100161071-100161093 TGCCCTGCAAGTGGCTGTGGGGG + Intergenic
1101446044 12:104737642-104737664 TGCCTTCCTCGGGGCAGTGGAGG + Intronic
1101510867 12:105391186-105391208 TGGCCTATGTGTGGGAGTGGGGG + Intronic
1104613698 12:130251290-130251312 TGGCCTCCTTGTGCCAGTGCAGG - Intergenic
1104841757 12:131829034-131829056 TGCGTTCCGGGTGGGAGTGGCGG + Intronic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1106246570 13:27954657-27954679 TGCGCTCCGAGTGGCCTTGGAGG + Intergenic
1113607470 13:111620697-111620719 TGTCCTCCGTGGGGCTGTGAAGG + Intronic
1113821259 13:113215130-113215152 CGCGTTCCGTGTGGCTGTGGAGG + Intronic
1113821365 13:113215862-113215884 TCTCGTCCGTGTGGCTGTGGAGG + Intronic
1117338865 14:54777208-54777230 TGCCTGCCTTGGGGCAGTGGGGG - Intronic
1122234714 14:100325139-100325161 TGACTTCCCTGTGGCAGTGCTGG + Intronic
1122314537 14:100817981-100818003 TGCTCTCCTTGGGGCAGCGGGGG + Intergenic
1122596874 14:102899750-102899772 TGGCCTGGCTGTGGCAGTGGGGG + Intronic
1122624220 14:103075840-103075862 TGCCCTCCTAGTGGGAGTTGCGG - Intergenic
1122984469 14:105205843-105205865 TGCTCCCTGTGTGGCAGAGGGGG - Intergenic
1124193583 15:27600986-27601008 TGCCCTCCTGTTGGGAGTGGGGG + Intergenic
1129283672 15:74506253-74506275 TGCCCTTCCTGTGGCTGAGGTGG - Intergenic
1129373212 15:75110732-75110754 TGCCCTCCCTGTGTGGGTGGGGG - Intronic
1129741372 15:77991243-77991265 TGCCCTGCCTCTGGCAGGGGTGG + Intronic
1130015642 15:80184305-80184327 TGCCCTGCGTCTCTCAGTGGTGG + Intronic
1131290400 15:91101739-91101761 TGCCCACCCAGTGGCAGTGATGG - Intronic
1134655216 16:15942955-15942977 TGCTCTCAGTCTGGCAGGGGAGG + Intergenic
1136567106 16:31077095-31077117 TGCCCAGCGTGTGGCTCTGGCGG - Exonic
1138317021 16:56078913-56078935 TGCCCTTCGGGTTGCGGTGGTGG - Intergenic
1138391813 16:56675867-56675889 GGCCCTCAGGGTGGCAGGGGCGG + Intronic
1139493750 16:67301431-67301453 TGCCCTGCTTGTGAAAGTGGTGG - Intronic
1141446140 16:84059710-84059732 AGCCTTGCGTGTGTCAGTGGTGG - Intronic
1142131770 16:88434475-88434497 GGCCCTCCCTGTGGCCGAGGCGG - Exonic
1142151095 16:88512859-88512881 ACCCCTGCGTGTGACAGTGGTGG - Intronic
1142297184 16:89232090-89232112 GACCCTCAGTGTGGCAGTGCTGG + Exonic
1143020639 17:3915710-3915732 TGGCCTCTGTGTGTCAGTGGCGG + Intronic
1143078847 17:4366624-4366646 TGCGCGCAGTGAGGCAGTGGCGG - Intronic
1143515166 17:7415925-7415947 GGCCCTCCGCCTGGCAGTGGTGG - Exonic
1143519483 17:7437425-7437447 GGCCCTCCGTGCCGCGGTGGAGG + Exonic
1145192145 17:20852176-20852198 GGCGCGCAGTGTGGCAGTGGCGG - Intronic
1145207229 17:20991068-20991090 TGACCTCCTTGTGGCAGAGCTGG - Intergenic
1145402369 17:22552220-22552242 GGCGCGCAGTGTGGCAGTGGTGG - Intergenic
1145758177 17:27408114-27408136 TGCACTCCGACTGGAAGTGGTGG + Intergenic
1147311187 17:39596937-39596959 GGCCCGCGGCGTGGCAGTGGCGG + Intergenic
1148072472 17:44916315-44916337 TGGCCTCTATGTGGCAGTGGAGG + Intronic
1150317147 17:64178544-64178566 TGTCCTGTGTGTGGCGGTGGGGG + Intronic
1150650721 17:67008391-67008413 GGCACTCGGTGTGGAAGTGGAGG + Intronic
1150864734 17:68837721-68837743 AGCCCTCCGTGTGCCAGGGCAGG + Intergenic
1152685222 17:81690589-81690611 TGCCTTCTGTGGGGCAGGGGAGG + Intronic
1152749769 17:82057257-82057279 TGCCCTCCCTGGGGCTGAGGAGG + Exonic
1152797715 17:82316254-82316276 TGCCCTCCCTGCGGCCCTGGCGG - Exonic
1153981495 18:10314568-10314590 GCACCTCCGTGTGGCTGTGGAGG + Intergenic
1157589824 18:48829607-48829629 TGCCCTCCATCTAGCAGTTGGGG + Intronic
1158530474 18:58256026-58256048 GGCCCTCGTGGTGGCAGTGGCGG - Intronic
1158888307 18:61849481-61849503 TCCCCTTCGTGTGGCTGTTGGGG - Intronic
1160390457 18:78527527-78527549 GGCCCTCAGTGGGGCAGTGCAGG + Intergenic
1164706808 19:30325861-30325883 TATCCTCCATGTGGCTGTGGGGG + Intronic
1164932653 19:32187221-32187243 TTACCTCCTTGGGGCAGTGGGGG - Intergenic
1165762067 19:38327244-38327266 TGAGCTCCGTGAGGCCGTGGAGG - Exonic
1166198403 19:41220888-41220910 TGCCCTCTGTGTGACGGAGGTGG - Intronic
1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG + Intronic
925305283 2:2844034-2844056 TGCCCTGAGTGTGGAAGTGTTGG - Intergenic
925430049 2:3783675-3783697 TGACCAGTGTGTGGCAGTGGAGG + Intronic
925507133 2:4579713-4579735 TTGCCTCAGTGTGGCAGTGTTGG - Intergenic
925800338 2:7592597-7592619 TGCCCTGTGTGTGGGAGTTGAGG - Intergenic
926675877 2:15619290-15619312 TGCCCTCCCCGCAGCAGTGGCGG + Intronic
927140195 2:20124960-20124982 AGCCCTCAGCGTGGCAGTGGTGG - Intergenic
927911918 2:26905706-26905728 TGTCCTCCAGGTGGCAGGGGAGG - Intronic
930003118 2:46874590-46874612 TGCCCTCCGTGGGGAAATAGAGG - Intergenic
931567470 2:63629572-63629594 CTCCCTCCTGGTGGCAGTGGAGG + Intronic
932436286 2:71704169-71704191 TCCCCGCCGTGTGGCTGTGCGGG - Intergenic
932811488 2:74830013-74830035 TGCCCTCCATGTGGATGGGGAGG - Intergenic
933613617 2:84461828-84461850 TGCCCTCCTTATGGATGTGGAGG - Intergenic
935232663 2:101112569-101112591 TGTCCTGCGTTTGGCAGCGGAGG - Intronic
935656668 2:105429142-105429164 TTTCCCCCTTGTGGCAGTGGAGG - Intronic
935686589 2:105689096-105689118 GTCCCTCCGTGTGGCACTGCGGG + Intergenic
938068072 2:128292558-128292580 CGCCCTCCCTGAGGCAGGGGTGG - Intronic
945357599 2:208857724-208857746 TGCCCTACGAGTTGCAGTGGAGG + Intergenic
947713334 2:232328122-232328144 TGCCCTCTGGGTGGCAGTAACGG - Intronic
947715211 2:232335790-232335812 TGCCCACCTTCTGGAAGTGGTGG - Exonic
948157968 2:235799936-235799958 TGCCCTCGGGGTGGAGGTGGGGG + Intronic
948241739 2:236443401-236443423 TCCCCTCCATGTGTCTGTGGGGG + Intronic
949064427 2:241981105-241981127 TGCCCTTTGTGTGGAAGTGACGG + Intergenic
1171120091 20:22560879-22560901 TGCCCTCTCGGTGGCTGTGGGGG + Intergenic
1174487543 20:50870861-50870883 AGCACTCCCTGTGGCAGAGGCGG + Intronic
1174599518 20:51713032-51713054 TGTCATCCGTGAGGCGGTGGAGG - Exonic
1174672754 20:52323316-52323338 TGACCTATGTGAGGCAGTGGTGG + Intergenic
1175488493 20:59362922-59362944 TTCCCTCTGGGTGGCAGTGGTGG + Intergenic
1175743111 20:61434702-61434724 TGGCCTCTGTGTGACAGCGGAGG - Intronic
1175928490 20:62482253-62482275 TGCCCTCCGTGGGGCAGGGAGGG + Intergenic
1176197598 20:63844579-63844601 CGCCCAGCCTGTGGCAGTGGGGG - Intergenic
1177613756 21:23489789-23489811 TTTCCTCTGTGTGGCAGTGCTGG - Intergenic
1178615976 21:34133080-34133102 TCCACTCCGTGTGGCAATTGAGG - Intronic
1178961774 21:37072796-37072818 TGGCCTCCCTGTGGGAGGGGAGG + Exonic
1179646114 21:42777330-42777352 TGGGCTGCATGTGGCAGTGGAGG + Intergenic
1181163873 22:20973413-20973435 GCTCCTCCGTGTGGAAGTGGCGG - Exonic
1181522508 22:23457718-23457740 TGCCCTCCAGGTGGGGGTGGGGG - Intergenic
1182093724 22:27612678-27612700 TCCCCTCCGTGTGGCAGAAACGG - Intergenic
1182964351 22:34507307-34507329 TGTACTTCATGTGGCAGTGGTGG - Intergenic
1183704736 22:39469619-39469641 TGTGCCCCGGGTGGCAGTGGAGG - Intronic
1184474691 22:44714186-44714208 TGAACTCCGGGTGGCCGTGGAGG + Intronic
1184826571 22:46956707-46956729 TCCCCTCAGCGTGGCAGTGGTGG + Intronic
1185301928 22:50085748-50085770 TTCCCACCGTGTGGCTGTGGGGG - Exonic
1185319169 22:50192702-50192724 TGCCCGCCGTGCCGCAGTGAGGG + Intronic
949155763 3:826193-826215 TGCCCTTCCTCTGGAAGTGGTGG + Intergenic
952076369 3:29701924-29701946 GGCCCTCGGTGTGGGACTGGTGG + Intronic
953724685 3:45387988-45388010 TGCCGGGTGTGTGGCAGTGGGGG + Intergenic
960672320 3:120165621-120165643 TGCTCTCCCTGTGGCTCTGGTGG + Exonic
962345786 3:134618256-134618278 TGGCCTCAGTGTTGCAGAGGCGG - Intronic
962820556 3:139044398-139044420 TGCCCTGCGTGTGCCCCTGGAGG - Exonic
964037053 3:152211719-152211741 TGCCCTCATTCTGGAAGTGGGGG + Intergenic
964476792 3:157104814-157104836 TGACCTTCTTGTTGCAGTGGAGG - Intergenic
968703805 4:2069121-2069143 TGCCCACTGTGTGGCAGGGCTGG + Intergenic
968807729 4:2786583-2786605 TGCCCTCAGTGAGCCTGTGGAGG - Intergenic
968808088 4:2788009-2788031 TGCCCTCAGTGAGCCTGTGGAGG - Intergenic
972097942 4:35371969-35371991 TGCACTCAGTGTAGCAGTGATGG - Intergenic
980242969 4:130201719-130201741 TGCCCTCCCTGCAGCAGTGGTGG - Intergenic
982413284 4:155103714-155103736 AGCCCTCCTAGTGGCAGAGGTGG + Intergenic
982615893 4:157637090-157637112 TGCCGTCCGGGAGGAAGTGGGGG - Intergenic
984950983 4:185007646-185007668 TGCCCTGCAGGGGGCAGTGGTGG - Intergenic
986965768 5:13268569-13268591 TTCCCTCCGTGTGTCCGTTGTGG - Intergenic
992136191 5:73748770-73748792 TGCCCAGCCTGTGGGAGTGGCGG - Intronic
992490929 5:77244063-77244085 TGCCCTTCTTGTTGCAGTGGTGG - Intronic
992609215 5:78492887-78492909 AGGGCTCCGTGGGGCAGTGGAGG + Intronic
997837085 5:137203923-137203945 TCCCCTCCCTTTGGAAGTGGTGG - Intronic
998447623 5:142210912-142210934 TGCCCTGTGTGGAGCAGTGGTGG - Intergenic
1002350792 5:178582416-178582438 GTCCCTCCCTGGGGCAGTGGCGG - Intronic
1002442200 5:179270317-179270339 TGCCCTGGGTGTCCCAGTGGGGG - Intronic
1002855632 6:1035669-1035691 AGCCCTCCGTGTGGGGGTGCAGG + Intergenic
1005450620 6:25968147-25968169 TGTCCTCCATGAGGCAGAGGTGG + Intronic
1007109187 6:39303352-39303374 TGCCCAGCAGGTGGCAGTGGAGG - Intronic
1008087534 6:47260305-47260327 TGCCCTGCATGTGGCAGAGGCGG - Intronic
1018104992 6:160477194-160477216 TGTCCTTCCTGTGACAGTGGTGG + Intergenic
1018113105 6:160556090-160556112 TGTCCTTCCTGTGACAGTGGTGG + Exonic
1018147445 6:160905834-160905856 TGTCCTTCCTGTGACAGTGGTGG - Intergenic
1019193651 6:170268599-170268621 TGGTCACCGTGGGGCAGTGGGGG - Intergenic
1019569775 7:1705497-1705519 TGCCCTCGGGCAGGCAGTGGCGG - Intronic
1019588825 7:1818849-1818871 TGCCCTCCAGGTGGGGGTGGGGG + Intronic
1019712927 7:2525590-2525612 TGCGCTCCGCGTGGGCGTGGGGG - Intronic
1023004188 7:35845176-35845198 AGCCCTCTGTGAGGCAGGGGTGG - Intronic
1029424376 7:100486998-100487020 TGCCCACCGAGTGGCAGGAGAGG - Exonic
1035046905 7:155973774-155973796 TGCCCTCACTGTGGCCGTGCCGG - Intergenic
1036634308 8:10538467-10538489 TGCCCACAGGGTGACAGTGGGGG + Exonic
1037717867 8:21414967-21414989 TGCCCTCCCTGAGGCAGGAGGGG + Intergenic
1037865185 8:22437672-22437694 GGCCCTCCCTGTAGCAGAGGCGG - Intergenic
1037947006 8:22995997-22996019 TGCTCTCCCTGTGGCTGTGAAGG - Intronic
1038335002 8:26638936-26638958 TGCCTTCCATGTGTGAGTGGTGG + Intronic
1040879677 8:52191537-52191559 TGCCCTGCATGTGGTAGTTGAGG - Intronic
1042688019 8:71462680-71462702 TGCCCTCCAGGCAGCAGTGGTGG + Intronic
1042975590 8:74465445-74465467 TGAACTCTGTGGGGCAGTGGAGG - Intronic
1044409269 8:91867056-91867078 GGCCCTCCCTGCAGCAGTGGTGG - Intergenic
1048282632 8:133116422-133116444 TCCCATCAATGTGGCAGTGGAGG + Intronic
1049245799 8:141561821-141561843 TGCACTGCATGTGGCTGTGGAGG - Intergenic
1049254307 8:141605650-141605672 TGCCCACCTTGAGGCAGTGGCGG - Intergenic
1049786371 8:144452820-144452842 TCTCCTCTGTTTGGCAGTGGTGG + Intronic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1057478574 9:95426392-95426414 AGACCTCCCCGTGGCAGTGGGGG - Intergenic
1058280005 9:103102947-103102969 TGTCCTCTTTATGGCAGTGGCGG + Intergenic
1061540163 9:131273996-131274018 TGCCCTCCCTGTCGCAGTCCTGG - Intronic
1061949094 9:133926286-133926308 GGGCCTCTGGGTGGCAGTGGTGG - Intronic
1062501130 9:136852518-136852540 TACCATCTGTGTGGCAGTGACGG + Intronic
1062656622 9:137606990-137607012 TGGCCTCCGGGTGGACGTGGTGG + Intronic
1187166193 X:16806340-16806362 TGCCCTGGGAGGGGCAGTGGAGG - Intronic
1189254726 X:39629108-39629130 TGACCACTGTGTGGCAGAGGGGG + Intergenic
1190310098 X:49111122-49111144 TGGCCTCAGTGTGGGAGTAGAGG + Intergenic
1191130462 X:57002912-57002934 TGCAGTCAGTGTGGCACTGGGGG - Intergenic