ID: 1166893750

View in Genome Browser
Species Human (GRCh38)
Location 19:46010317-46010339
Sequence ACCTGTCTGGTTCACTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166893750_1166893756 3 Left 1166893750 19:46010317-46010339 CCTGTGCAGTGAACCAGACAGGT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1166893756 19:46010343-46010365 GGCTCTGCCCCCAGAAAGGTGGG 0: 1
1: 0
2: 3
3: 24
4: 220
1166893750_1166893754 -1 Left 1166893750 19:46010317-46010339 CCTGTGCAGTGAACCAGACAGGT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1166893754 19:46010339-46010361 TGGAGGCTCTGCCCCCAGAAAGG 0: 1
1: 0
2: 0
3: 32
4: 277
1166893750_1166893763 20 Left 1166893750 19:46010317-46010339 CCTGTGCAGTGAACCAGACAGGT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1166893763 19:46010360-46010382 GGTGGGATCCACATGGGAAACGG 0: 1
1: 0
2: 1
3: 16
4: 184
1166893750_1166893755 2 Left 1166893750 19:46010317-46010339 CCTGTGCAGTGAACCAGACAGGT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1166893755 19:46010342-46010364 AGGCTCTGCCCCCAGAAAGGTGG 0: 1
1: 0
2: 9
3: 36
4: 267
1166893750_1166893762 14 Left 1166893750 19:46010317-46010339 CCTGTGCAGTGAACCAGACAGGT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1166893762 19:46010354-46010376 CAGAAAGGTGGGATCCACATGGG 0: 1
1: 0
2: 0
3: 8
4: 182
1166893750_1166893761 13 Left 1166893750 19:46010317-46010339 CCTGTGCAGTGAACCAGACAGGT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1166893761 19:46010353-46010375 CCAGAAAGGTGGGATCCACATGG 0: 1
1: 0
2: 0
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166893750 Original CRISPR ACCTGTCTGGTTCACTGCAC AGG (reversed) Intronic
900778081 1:4599648-4599670 ATCTGCCTGGTTCTCTTCACAGG - Intergenic
902992741 1:20200628-20200650 ACCTCTCTGCCTCCCTGCACTGG - Intergenic
914937328 1:151992959-151992981 GTCTGTCTGTTTCACTGCACCGG + Intronic
918041816 1:180918234-180918256 ATCTGTCTGGTTCACTTCACAGG + Intronic
920201740 1:204263680-204263702 ACGTGTCTGTGTCTCTGCACAGG + Intronic
921215940 1:212936822-212936844 ACCTGCCTGGTTCCCTGGGCTGG - Intergenic
921557098 1:216612052-216612074 ACCTGTCTTTTTTACTGCATAGG - Intronic
1072073129 10:91940045-91940067 CCTTGTCTGGTTCTCGGCACTGG - Exonic
1075187148 10:120273358-120273380 ACCTCTCTGCTTCACTGCTCTGG + Intergenic
1083982759 11:66186914-66186936 ACCTGCCTTGGTCACTGTACTGG + Intronic
1084442752 11:69184578-69184600 TCCAGACTGTTTCACTGCACTGG - Intergenic
1085750201 11:79154898-79154920 ACCTATTTTGTTCACTGCTCTGG + Intronic
1093922280 12:24872283-24872305 TCATTTCTGGTTCACTCCACAGG - Intronic
1102228657 12:111247455-111247477 ACTTGTCAGGATCACTGCAAAGG + Intronic
1104760541 12:131295343-131295365 CCCGGCCTGGGTCACTGCACAGG + Intergenic
1104819234 12:131665442-131665464 CCCGGCCTGGGTCACTGCACAGG - Intergenic
1110860374 13:80340381-80340403 GCCTGTCGGGGACACTGCACGGG + Intronic
1111696366 13:91629867-91629889 GCTTATCTGGTTCACTGCACAGG - Intronic
1119666535 14:76489073-76489095 ACCTGCAGGATTCACTGCACAGG + Intronic
1120372605 14:83655744-83655766 ACCTGCCTGGTACATTGCAGAGG - Intergenic
1122125732 14:99577528-99577550 ACAGGTCTTGTTCACTGCAGGGG - Intronic
1127789976 15:62390927-62390949 ACATGTATGTTTCACTGCACCGG + Intronic
1128727121 15:69996462-69996484 CCCTGACTGGTTCACTCCACTGG - Intergenic
1128914227 15:71545284-71545306 ACCTGTCTGCTCTACTGCAAGGG - Intronic
1131577892 15:93610527-93610549 ATCTGTCTGCTTCACTAGACTGG - Intergenic
1131676650 15:94676837-94676859 TCCTGTGTGATTCACAGCACTGG - Intergenic
1132515946 16:366166-366188 ACCTGCCTGGTTCAGAGCCCTGG - Intergenic
1132830618 16:1926325-1926347 GCCTGTCTGGTCCACTGCGGGGG - Intergenic
1142229543 16:88893395-88893417 ACCTGTCTGGGACATTGCTCAGG - Intronic
1148347909 17:46915971-46915993 ACCTGTGTGGGTCAATGCCCTGG + Intergenic
1151101811 17:71564251-71564273 ACCTGTCTTGTTCATTCCAAGGG + Intergenic
1151564549 17:74890485-74890507 ACCTGCCTGGTGGACTGCAGTGG - Intronic
1155343800 18:24838810-24838832 AGCTTTCTGGTTCACTGGAGTGG - Intergenic
1158808001 18:60998466-60998488 CCCTGTCTGGAACACTGCAATGG - Intergenic
1159289942 18:66404206-66404228 ACCTGTCTGGAGCTCTGCAGAGG + Intergenic
1160995593 19:1880732-1880754 GCCTGTCTGCTTCCCAGCACGGG + Intronic
1162378476 19:10318387-10318409 AATTGTCTGCTTCACTCCACCGG - Intronic
1162765447 19:12916644-12916666 ACGTGATTGCTTCACTGCACTGG - Intronic
1162766644 19:12923987-12924009 AGCTGTCATGTTCACAGCACGGG + Intronic
1163819602 19:19488435-19488457 ACCTTTGTGGTTCTCTGAACAGG - Intronic
1164973993 19:32557729-32557751 ACTTGAATGGTTCACTACACAGG - Intergenic
1165900740 19:39168123-39168145 GGCTGTCTGGGTCACTGCAGTGG + Intronic
1166893750 19:46010317-46010339 ACCTGTCTGGTTCACTGCACAGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
929962104 2:46504571-46504593 AACTGTCTTGTTCATTGCAAGGG + Intronic
933686262 2:85143896-85143918 ACCCCTCTGGGGCACTGCACTGG - Intronic
933813702 2:86049242-86049264 GCTTGTCTGTTTCACTTCACAGG - Exonic
936394386 2:112110276-112110298 ACTTTTCTGCATCACTGCACTGG + Intronic
943056652 2:182990167-182990189 ACCTGTCTTGTCTACTACACAGG - Intronic
943331184 2:186561150-186561172 ACCTTTGTGGTTCCTTGCACTGG - Intergenic
946381105 2:219349629-219349651 ACCTGCCTGGTCTGCTGCACAGG + Intergenic
948410854 2:237759400-237759422 AGCTGGCTGGCTCACTGCTCTGG - Intronic
948563326 2:238868096-238868118 ACCTTTGTGGGGCACTGCACTGG - Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1171371337 20:24664245-24664267 GCCTTTCTGGTCCACTGCAGAGG + Intronic
1172318825 20:33980014-33980036 AACTGTCTCATGCACTGCACGGG - Intergenic
1172564982 20:35922826-35922848 ACCTGTATGGTTGGCTGCAGTGG + Intronic
1173402687 20:42739213-42739235 ACCTGTCTTGTCCACTGCCATGG - Intronic
1174387748 20:50197352-50197374 TTCTGTCTGGTTGACTGCTCTGG + Intergenic
1178791912 21:35708475-35708497 ACCTGTCTTGATCACTGCTACGG + Intronic
1179315843 21:40243863-40243885 GCCTGTGTGGATCACTGCCCCGG - Intronic
1181359263 22:22322532-22322554 ACCCTTCTCATTCACTGCACAGG + Intergenic
1181369364 22:22404284-22404306 ACCCTTCTCATTCACTGCACAGG + Intergenic
1182064188 22:27418729-27418751 ACCTGTCTGAATCCCAGCACTGG - Intergenic
1184405522 22:44298523-44298545 CACTGTCTGGGTCACTGCCCAGG + Intronic
949986795 3:9547473-9547495 ACCTGTTTGTATCACTGAACTGG - Intronic
950889679 3:16392481-16392503 AGCTGACTGGTTTACAGCACAGG - Intronic
951734714 3:25851493-25851515 ATCTATCTGGATCACTGCAATGG - Intergenic
952274746 3:31866383-31866405 ACTTGTGTGGTTGAGTGCACAGG - Intronic
953492367 3:43362782-43362804 ACCTGACTGGTTCCCTTCCCAGG + Intronic
953666884 3:44931725-44931747 CCCTGTCTGGTTGACTCCAGTGG - Intronic
956011741 3:64839056-64839078 ACTTGTCTGTTTCCCTCCACTGG - Intergenic
961722104 3:128903638-128903660 ACCTGCTTTGGTCACTGCACGGG + Intronic
962354134 3:134679221-134679243 ACCTGTCTTGAGCACTGCACAGG - Intronic
962919185 3:139935639-139935661 ACCTCTCTGGTCCGCTGCGCAGG - Intronic
963307500 3:143669377-143669399 ACCTCTCTGGCTCACTGCTTTGG - Intronic
969883565 4:10195739-10195761 ACCTATCTTGTTGGCTGCACTGG - Intergenic
971179654 4:24317347-24317369 ACCTGTGGGTTTCACTGGACTGG - Intergenic
975764081 4:77648993-77649015 ATCTGTCTTGTCCACTTCACAGG - Intergenic
978405422 4:108373437-108373459 ACCTGGCTGCTTCAGTCCACAGG - Intergenic
982057775 4:151570058-151570080 ATCTGTCTGGTTCATTCCTCTGG + Intronic
985950379 5:3218119-3218141 AGGTGTCTGGGACACTGCACTGG + Intergenic
985957322 5:3275271-3275293 ACCTTTCTGGGTCTCTTCACCGG + Intergenic
987701478 5:21405346-21405368 ACCTGCCAGGTGCACTCCACTGG + Intergenic
989262832 5:39437636-39437658 TCCTGTCTGTTTCACACCACGGG + Intronic
999260506 5:150235667-150235689 GCCCCTCTGGCTCACTGCACAGG - Intronic
1000281601 5:159787139-159787161 ACCTGTGCGGTACCCTGCACTGG + Intergenic
1003676034 6:8205176-8205198 ACGTGACTGGTTTAGTGCACAGG - Intergenic
1004554371 6:16681250-16681272 ACCTGCCTGGTTTACTTCAGGGG - Intronic
1007166820 6:39834350-39834372 AACTGTTTGGGTGACTGCACTGG + Intronic
1014611500 6:123553400-123553422 ATCTGTCTGATCCACTCCACAGG + Intronic
1015263916 6:131269722-131269744 ACCTGTCTGATACACTGAAGGGG + Intronic
1019796214 7:3050657-3050679 ACCTGTGTCCTTCAGTGCACCGG - Intergenic
1022424333 7:30253666-30253688 ACCTGCCTGGTACACAGCAGGGG + Intergenic
1024632812 7:51263196-51263218 ACCTGTCATCTACACTGCACTGG + Intronic
1034830533 7:154304385-154304407 CCCTGCCTGGCTCCCTGCACCGG - Intronic
1042162295 8:65909310-65909332 TCCTGACAAGTTCACTGCACAGG - Intergenic
1042497970 8:69476829-69476851 TCCTCTCTGGTTCGTTGCACTGG - Intronic
1042872305 8:73410134-73410156 ACCTGTGACATTCACTGCACTGG + Intergenic
1043669970 8:82871957-82871979 AGCTGTGTTGTTCACTGCAGTGG - Intergenic
1047441276 8:124880605-124880627 GCCCGTCTCTTTCACTGCACTGG - Intergenic
1050297634 9:4221983-4222005 CCCTTTCTGGTTCTGTGCACAGG - Intronic
1059447530 9:114348099-114348121 TTCTGTTTTGTTCACTGCACAGG - Intronic
1198268635 X:135033227-135033249 AGCTGTCTGGATCACTGTCCAGG - Exonic
1198270344 X:135051244-135051266 AGCTGTCTGGATCACTGTCCAGG + Exonic
1199568206 X:149239937-149239959 AGCTGGCTGGGTCACTGCTCTGG + Intergenic
1201411628 Y:13704261-13704283 ACCTGTCCGGGTCTCTGTACTGG - Exonic