ID: 1166894379

View in Genome Browser
Species Human (GRCh38)
Location 19:46014983-46015005
Sequence CCATTCCCACTACTCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166894379_1166894389 21 Left 1166894379 19:46014983-46015005 CCCCCATGGAGTAGTGGGAATGG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1166894389 19:46015027-46015049 GCTCTCTCCGCGTCTTCCCCAGG 0: 1
1: 0
2: 0
3: 31
4: 204
1166894379_1166894390 22 Left 1166894379 19:46014983-46015005 CCCCCATGGAGTAGTGGGAATGG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1166894390 19:46015028-46015050 CTCTCTCCGCGTCTTCCCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166894379 Original CRISPR CCATTCCCACTACTCCATGG GGG (reversed) Intronic
900611606 1:3546762-3546784 CCATTGCCACCCCGCCATGGTGG - Intronic
900668065 1:3829083-3829105 CCAATTCCACCTCTCCATGGAGG + Intronic
900899408 1:5506693-5506715 CCATTCCCAAGGCTCCTTGGAGG - Intergenic
901773502 1:11543300-11543322 CCAATCCCACCACTCGATGAAGG - Intergenic
901815032 1:11789008-11789030 CCACTCACACTAGCCCATGGAGG + Exonic
904479551 1:30785406-30785428 CCATTCCCACATCTCCAGGGTGG - Intergenic
905262252 1:36728163-36728185 CCACCCCCACCACTCCCTGGAGG + Intergenic
907680109 1:56555195-56555217 CCATTTCCACTCCTCCATCATGG + Intronic
910330696 1:86069326-86069348 CCACCACCACTAGTCCATGGGGG - Intronic
912718830 1:112002854-112002876 CCAGCCCCACTACCCCATGTGGG + Intergenic
915840901 1:159212192-159212214 CCTTTCACACTCCTCCAGGGTGG + Intergenic
920261930 1:204694107-204694129 AAAATCCCACTCCTCCATGGCGG - Intergenic
922592354 1:226786869-226786891 CCTTTCCCCCTCCTCCAGGGAGG - Intergenic
924083232 1:240420962-240420984 TCCTTCCCTCTCCTCCATGGAGG - Intronic
924701868 1:246462410-246462432 CCTCTCCCACGACTCCATGGGGG + Intronic
1063461293 10:6216376-6216398 CCAGTCCCACACCTCCAGGGCGG + Intronic
1063963468 10:11326482-11326504 TCATTCCCACTCCCCGATGGTGG - Intronic
1068010354 10:51441530-51441552 TCACTCCCACCTCTCCATGGTGG - Intronic
1070718954 10:78743327-78743349 CCATTTCCCCTACTCCAGAGCGG + Intergenic
1072496572 10:95967019-95967041 ACATTCCCAATACTCAATGATGG - Intronic
1073767743 10:106701833-106701855 TCATCCTCACCACTCCATGGGGG - Intronic
1075330007 10:121567003-121567025 CCATTCACACTTCTCACTGGAGG - Intronic
1075991823 10:126844637-126844659 CAACAGCCACTACTCCATGGTGG - Intergenic
1078307397 11:10203922-10203944 CCATTCCCTCCATTCCATGCTGG - Intronic
1078360801 11:10666140-10666162 CCATCCCCACCTCTCCATGGTGG - Intronic
1080842387 11:35996921-35996943 CCATTCCCAAAGCTGCATGGAGG - Intronic
1081164122 11:39786712-39786734 CCACTCCCACTTCTCCCTGCAGG + Intergenic
1081841179 11:46202480-46202502 TCATTCCCTCTCCTCCATGCTGG + Intergenic
1083120442 11:60507299-60507321 ACATTACCACTACTACATGCTGG + Exonic
1084473377 11:69375807-69375829 CCACACCCACTCCTCCCTGGGGG - Intergenic
1084704838 11:70810165-70810187 CCTTTCCCTCTGCTCCCTGGTGG - Intronic
1084883639 11:72189541-72189563 CCCCTCCCACTACCCCATGGAGG + Intronic
1085108746 11:73868707-73868729 CCATTCCCAGGATTCCATGGTGG - Intergenic
1085224494 11:74907325-74907347 CCATTCCCAGGAAGCCATGGAGG + Intronic
1085739227 11:79064900-79064922 CCACTGCGGCTACTCCATGGGGG - Exonic
1086414036 11:86570863-86570885 CCCTTCCCACTCCCCCATGCTGG - Intronic
1091333834 11:134752191-134752213 GCAGTCCCACCTCTCCATGGGGG + Intergenic
1091952540 12:4606961-4606983 CCCTTTCCAGTGCTCCATGGTGG + Intronic
1092243815 12:6851935-6851957 CCAATCCCACTCCTCCAGGGCGG - Exonic
1093774969 12:23063217-23063239 CCATTTCTAGTGCTCCATGGTGG + Intergenic
1093821902 12:23630224-23630246 CAATTCCCATTTTTCCATGGAGG - Intronic
1096668858 12:53185806-53185828 CCATCTCCTGTACTCCATGGAGG - Intronic
1096862215 12:54537972-54537994 CCATTCTAAATCCTCCATGGAGG + Intronic
1100169714 12:91960201-91960223 ACATCCCCACTTCTCCTTGGAGG + Intergenic
1102108427 12:110345544-110345566 GCACTCCCACTACTTCCTGGAGG - Intronic
1102245382 12:111352672-111352694 CCACTCCCACCACTCCATGATGG - Intergenic
1102401229 12:112631356-112631378 CCATTCCTTCTTCTCCAAGGAGG - Intronic
1103240927 12:119412776-119412798 CCATTACCATTCCTGCATGGGGG - Intronic
1106072286 13:26424397-26424419 CCATTCCTCCTACTTCATGAGGG - Intergenic
1106295860 13:28413095-28413117 CCACTCCCCCTTCTCCATTGAGG - Intronic
1107008134 13:35638097-35638119 CCACTCCCTCTAGTCCCTGGGGG - Intronic
1108449678 13:50548741-50548763 CCATTCAGAATTCTCCATGGAGG - Intronic
1114053563 14:18944511-18944533 CCACTCCCACTACTCACTGTAGG - Intergenic
1114108993 14:19457414-19457436 CCACTCCCACTACTCACTGTAGG + Intergenic
1118404896 14:65413116-65413138 CCCTTCCCACTCCCCCATCGTGG + Intronic
1119027496 14:71165762-71165784 ACATTCCCATTACTCCAGGAAGG + Intergenic
1124620709 15:31272390-31272412 CCTTTCCCCCTGCTCCATGCTGG - Intergenic
1129965174 15:79728686-79728708 CCTTTCCCACCACTTAATGGAGG + Intergenic
1130354130 15:83114522-83114544 CCTTCCCCACGCCTCCATGGGGG - Intronic
1130597655 15:85258264-85258286 CCACTCCCTCTACTCACTGGAGG + Intergenic
1131437491 15:92434978-92435000 CCATTGCCACTACCCGATGATGG - Intronic
1134530482 16:14979018-14979040 CAATTCCCTCTACCCCTTGGGGG - Intronic
1136022108 16:27446869-27446891 CCACTCCCACTGCTGCAGGGTGG - Intronic
1136679266 16:31946054-31946076 CCACCACCACTGCTCCATGGAGG - Intergenic
1138131609 16:54484696-54484718 ACATTCCCACTACCACACGGAGG + Intergenic
1138329693 16:56203819-56203841 GCCTGCCCACTACTCCCTGGTGG - Intronic
1138475887 16:57270432-57270454 CTATTCCCACTGCTCCATCCAGG + Intronic
1139572632 16:67822789-67822811 CCAGCCCCACTACGCCATAGTGG - Intronic
1139865863 16:70061949-70061971 CAATTCCCTCTACCCCTTGGGGG + Intergenic
1141403550 16:83771892-83771914 CCATTCACACTGCTGCATGATGG + Intronic
1142218756 16:88842581-88842603 CTATTCCTACTACTGCAGGGAGG - Intronic
1144710770 17:17400059-17400081 CCATTCCCACTCCGACAAGGAGG + Intergenic
1147456497 17:40541547-40541569 CCATTGCCACTGCTTCCTGGGGG - Intergenic
1151424677 17:74023297-74023319 CCAGTCCCACTGATCCTTGGAGG - Intergenic
1154369544 18:13747172-13747194 CCATTCTGCCTACTTCATGGAGG - Intronic
1156544933 18:37955215-37955237 CCATCCCCACCATTCCATGCTGG + Intergenic
1157482008 18:48060988-48061010 CCAGCCCCAGCACTCCATGGCGG - Intronic
1157927143 18:51779000-51779022 CCATTATTACTTCTCCATGGTGG - Intergenic
1159115892 18:64112889-64112911 CCATCCCCCATACTCCAGGGAGG + Intergenic
1160974303 19:1785131-1785153 CCCGTCCCACTTCCCCATGGGGG + Intronic
1163427498 19:17247165-17247187 TCTTTCCCCCTACTCCAGGGAGG - Intronic
1166894379 19:46014983-46015005 CCATTCCCACTACTCCATGGGGG - Intronic
925045653 2:771305-771327 CCCTTCCCAGGACTCCAGGGCGG + Intergenic
926740570 2:16107230-16107252 ACATTCCCACTAATCCTAGGAGG - Intergenic
926960778 2:18356358-18356380 CCAATCCCACTACACCTTTGGGG + Intronic
930052659 2:47228623-47228645 TTAGTCCCACAACTCCATGGTGG - Intergenic
931459884 2:62441467-62441489 CCATTCCCCCTACTCTTTTGAGG + Intergenic
932656932 2:73618464-73618486 CCAGTACCTCCACTCCATGGTGG - Intergenic
932761014 2:74439462-74439484 CCATTCCTGCTACAGCATGGTGG - Intronic
932786210 2:74606118-74606140 TCCTTCCCACCACTCCATAGTGG - Intronic
935500304 2:103830918-103830940 CCACTCCCACTCCTCCTAGGTGG - Intergenic
938047927 2:128139924-128139946 CCAGTCACTCTTCTCCATGGTGG - Intronic
938471525 2:131567011-131567033 CCACTCCCACTACTCACTGTAGG - Intergenic
938601787 2:132849913-132849935 CCCTTTCTACTACGCCATGGGGG - Intronic
938920036 2:135986445-135986467 GTCTTCTCACTACTCCATGGGGG - Intergenic
941334128 2:164220181-164220203 CCACTCCCCCTACTCCATCATGG + Intergenic
945984463 2:216342581-216342603 CCATTCCCACTTCTCCATGCAGG - Intronic
946469094 2:219939897-219939919 CCATTCCCACAACTCCACTAGGG - Intergenic
948311089 2:236987446-236987468 CCATTGGCACTACCCCATGCAGG + Intergenic
1170928326 20:20745719-20745741 CCATCCCCACTCCTCCCGGGAGG + Intergenic
1175125422 20:56747815-56747837 CCATTCCCAGGTCTCCTTGGAGG - Intergenic
1175313269 20:58026479-58026501 CCAAACCCGCCACTCCATGGGGG + Intergenic
1179560776 21:42214868-42214890 CCATTCCCACTGCTGCCTGATGG - Intronic
1180472033 22:15666892-15666914 CCACTCCCACTACTCACTGTAGG - Intergenic
950491913 3:13310727-13310749 CCATGCCTACTACTCAATGTAGG - Intergenic
953927583 3:46990208-46990230 CCAGGCCCACAGCTCCATGGGGG - Intronic
954034045 3:47840986-47841008 CCATGCCCCCTACTTCCTGGCGG + Exonic
954390183 3:50264605-50264627 CCATACCCAGTACTCCTGGGAGG + Intergenic
960190674 3:114701421-114701443 CCAATCCCTCTACATCATGGTGG - Intronic
961575594 3:127833452-127833474 CCATTCCCACCACACCCTGTTGG - Intergenic
961782744 3:129330512-129330534 CCATCCCTCCTACTCCATTGAGG + Intergenic
970379220 4:15489916-15489938 ACATCCCGACTACTCCATGTTGG + Intronic
974156253 4:58077194-58077216 CCACTCCCACTCCTCCAATGCGG - Intergenic
975395956 4:73873415-73873437 CCTTTCCCACACCTCAATGGAGG - Intergenic
976004925 4:80418637-80418659 CCATTCCCCCCATTCCATGGTGG + Intronic
981185790 4:141801325-141801347 CCCTTCCCACTATTGCATTGGGG + Intergenic
981791525 4:148542384-148542406 CCATTCCCACTCCTGCTTGCTGG - Intergenic
982842087 4:160201994-160202016 CAATTCCCACTCCTCCATCTTGG + Intergenic
987154364 5:15073545-15073567 TCATTCCTCCTTCTCCATGGAGG - Intergenic
997045882 5:130317053-130317075 TAATTCTCACTACACCATGGTGG + Intergenic
998264291 5:140655982-140656004 CCATTCACTCACCTCCATGGTGG - Exonic
999153844 5:149444015-149444037 CCATGCCCACCACTGCTTGGGGG + Intergenic
999719729 5:154390713-154390735 CCATTCACTGTTCTCCATGGTGG - Intronic
1004735218 6:18399230-18399252 CCATTCCCACCCCACCATAGTGG + Intronic
1005859886 6:29892194-29892216 CCTTTCCCAAAACTCCATGAAGG - Intergenic
1006982230 6:38155701-38155723 CCATTCTCGCAACTACATGGGGG + Intergenic
1010910936 6:81555353-81555375 CCAATCCCATAATTCCATGGGGG - Intronic
1013433405 6:110076867-110076889 GCATTCCCCCTTATCCATGGGGG + Intergenic
1013608335 6:111771731-111771753 CCATTCCGACTTTTCAATGGCGG - Intronic
1015865850 6:137725530-137725552 GCATTCTCACTATTTCATGGTGG - Intergenic
1018433673 6:163742945-163742967 CCATTCCAATTGCCCCATGGGGG + Intergenic
1024500900 7:50104609-50104631 CCATTCCCACAATACCATGGGGG + Intronic
1026427786 7:70313837-70313859 CCATTCCCACGTCTCCACGGGGG - Intronic
1028645593 7:93093214-93093236 CCATGGCCACTACTGCCTGGCGG + Intergenic
1030326982 7:108230133-108230155 CCATTCCCAGAAACCCATGGCGG - Intronic
1040837818 8:51750876-51750898 CCATCCCCCCTTCTCCATGGGGG - Intronic
1043142436 8:76606758-76606780 CCAGTCACACTACTCCAAGATGG - Intergenic
1044843921 8:96361493-96361515 CCTTTCCCGCCACTCCAGGGAGG - Intergenic
1045387954 8:101689462-101689484 CCCTTCCCACTACTGCGTGCTGG + Intronic
1047806599 8:128367559-128367581 GCATTCACACTACTACAAGGGGG - Intergenic
1049843593 8:144789139-144789161 GCATTCCCACCCCGCCATGGTGG - Intergenic
1051374078 9:16386618-16386640 CCATTCCCGGTAGACCATGGAGG - Intergenic
1058671850 9:107366787-107366809 CCTTTCCCACTCCCCCAGGGTGG - Intergenic
1058702273 9:107611137-107611159 CCACTCCCCCTACTCCCAGGAGG - Intergenic
1058772558 9:108250215-108250237 CCATTACCACTGCTCCATATTGG - Intergenic
1187450159 X:19388977-19388999 CCATACACACCACTGCATGGAGG + Intronic
1189462340 X:41253019-41253041 CTATGCCCACTGCTCCCTGGTGG + Intergenic
1190712378 X:53080060-53080082 CCAGTCCCCATTCTCCATGGTGG - Exonic
1192135100 X:68589535-68589557 CCACCACCACTGCTCCATGGGGG - Intergenic
1195672862 X:107484061-107484083 CCACCCCCACCACCCCATGGGGG - Intergenic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic
1199172156 X:144744742-144744764 CCATTCCCAATCCTCCAGGTTGG + Intergenic
1199212047 X:145223999-145224021 CCATTCCCCATCCTCCAGGGAGG - Intergenic
1199589279 X:149451237-149451259 CCAATCCCACTCCTCCTTGCGGG - Intergenic