ID: 1166894955

View in Genome Browser
Species Human (GRCh38)
Location 19:46017224-46017246
Sequence CTGAGAAAAAGGAGTAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166894955_1166894970 26 Left 1166894955 19:46017224-46017246 CCTTGGTTACTCCTTTTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1166894970 19:46017273-46017295 CCAGCCCAACGCCCTGGAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 171
1166894955_1166894960 -5 Left 1166894955 19:46017224-46017246 CCTTGGTTACTCCTTTTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1166894960 19:46017242-46017264 CTCAGGGGTCACCGCCGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 90
1166894955_1166894968 25 Left 1166894955 19:46017224-46017246 CCTTGGTTACTCCTTTTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1166894968 19:46017272-46017294 CCCAGCCCAACGCCCTGGAGTGG 0: 1
1: 0
2: 2
3: 18
4: 290
1166894955_1166894965 20 Left 1166894955 19:46017224-46017246 CCTTGGTTACTCCTTTTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1166894965 19:46017267-46017289 AGCCTCCCAGCCCAACGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 293
1166894955_1166894961 -4 Left 1166894955 19:46017224-46017246 CCTTGGTTACTCCTTTTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1166894961 19:46017243-46017265 TCAGGGGTCACCGCCGCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166894955 Original CRISPR CTGAGAAAAAGGAGTAACCA AGG (reversed) Intronic
900897796 1:5495959-5495981 CAGAGACAAAGGAGAATCCAAGG - Intergenic
901568267 1:10137237-10137259 CTGAGAAAAAGTGGTAACTCAGG - Intronic
901836379 1:11926383-11926405 CCGAGAAGAAGGAGGAAGCAGGG - Exonic
902231090 1:15028123-15028145 CTGAGACCAGGGTGTAACCAGGG - Intronic
902567132 1:17319147-17319169 CTAAGAAAAAGGAAGAAGCAAGG - Intronic
903920489 1:26796668-26796690 CTGAGATACAGGAATAAGCACGG + Intronic
906056660 1:42923413-42923435 CTGAGAGAAATGAGGAACCCAGG + Intergenic
906212948 1:44022270-44022292 CAGAGAAGAAAGAGCAACCAGGG + Intronic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
906885235 1:49638197-49638219 CTGAGGTAAAAGAGTAACTAAGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
908686314 1:66723907-66723929 CCCAGAGAAAGGAGAAACCAAGG + Intronic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
909754436 1:79205818-79205840 CAGAGAACAAGGAGAAAACAAGG + Intergenic
914350495 1:146835733-146835755 CTGAAAATAAGGAGTAAGCCTGG + Intergenic
916370535 1:164089409-164089431 CTGAGAACCAGGAGTACCTAGGG - Intergenic
916399977 1:164436974-164436996 CTAAGAAAAAGGAGTGCCAATGG + Intergenic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
920742546 1:208595326-208595348 CTGAGCAAAAGGGGAACCCAAGG + Intergenic
923889092 1:238191454-238191476 CTGAAAAATAGCAGTAAACACGG - Intergenic
924268504 1:242307230-242307252 CTTAGAAAAAGGTGAAATCAAGG + Intronic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
1063384439 10:5607194-5607216 CTTTGAAAAAGGAGAAACGATGG - Intergenic
1066348630 10:34615387-34615409 CTGAGGAAACAGTGTAACCATGG + Intronic
1066716398 10:38291526-38291548 CTTAGAAAAAGGTGAAATCAAGG - Intergenic
1067265996 10:44745730-44745752 CTGAGACAGATGAGTGACCAAGG + Intergenic
1068289411 10:54983541-54983563 CTGAGAAGAAATAGTAACCCAGG + Intronic
1068315656 10:55338305-55338327 CTGAAAAAAAGGAATCAACATGG + Intronic
1070367823 10:75753252-75753274 CTGAGAATAAGTAGTACCTAAGG + Intronic
1072066284 10:91874714-91874736 CTGGGAAAAAGGAGTAGGTAGGG - Intergenic
1072813021 10:98478211-98478233 CTGAGAAAGGTGAGAAACCAGGG + Intronic
1073600336 10:104840198-104840220 CTGAGAGGAAGGAGAAACTAAGG + Intronic
1075109539 10:119567026-119567048 TTGTGAAAAATGTGTAACCATGG + Intergenic
1075513663 10:123092532-123092554 TTGAGAAAAGTAAGTAACCATGG - Intergenic
1076565580 10:131396724-131396746 ATGGGAAAAAGGAGAATCCATGG - Intergenic
1076669871 10:132114037-132114059 CAGAGGTAAAGGAGTAAGCAAGG - Intronic
1077660432 11:4063786-4063808 CTGAGAAAAGTGACTACCCAAGG - Intronic
1078756442 11:14215312-14215334 CTGAGAAGAAGAAATAACCCAGG - Intronic
1079066173 11:17295301-17295323 CTGAAATAAAGGAGTAATTATGG - Intronic
1079095004 11:17504404-17504426 CTGAGAAACAGCAGTATCCCTGG - Intronic
1081382800 11:42436355-42436377 CTGAGATAAAGTAGTTACTATGG - Intergenic
1082302174 11:50520633-50520655 TGGAGAAAAAGGAGTATCCCAGG - Intergenic
1084032115 11:66487224-66487246 ATGAGAAAGAGGAGTTGCCAAGG - Intronic
1085374106 11:76042442-76042464 TTGAGAAACAGGAATGACCATGG - Intronic
1085577930 11:77623920-77623942 CTGAGAAAAAGAAATGACCTTGG + Intronic
1085667323 11:78426306-78426328 CTCAGAAAGAGTAGCAACCAGGG + Intergenic
1085821303 11:79796490-79796512 TCAAGAAAAAGGAGTAAGCAAGG - Intergenic
1085944097 11:81245400-81245422 CAGAGAAAAAGGAATATTCATGG + Intergenic
1089904944 11:122029009-122029031 CTAAGCAAAAGGAGTAACATTGG + Intergenic
1090794676 11:130124499-130124521 ACGAGAAAAAGGAGTAGCCATGG - Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1092083281 12:5735719-5735741 CTGTGCAACAGGAATAACCAGGG + Intronic
1092228214 12:6762694-6762716 CTGCAGAAAAGGAGTACCCACGG + Intronic
1092816894 12:12320285-12320307 CTGAGAAAAACAAGTATCCAGGG - Intergenic
1093136769 12:15461437-15461459 CTGAGCCAAATGAGTGACCATGG - Intronic
1093151605 12:15627666-15627688 CTAGGAAAAAGGAGTAGCTAGGG - Intronic
1094417869 12:30236347-30236369 TTGAGGCAAAGCAGTAACCACGG + Intergenic
1095921833 12:47539529-47539551 CTGAGGAAAGGGAGGTACCAAGG + Intergenic
1097164060 12:57073050-57073072 CTGAGAAGAAGGAAGAACTAAGG + Intronic
1097442477 12:59627736-59627758 CTGAAAAAAATGAGTAAGAAAGG - Intronic
1098222141 12:68281431-68281453 ATGAGAAAATTGAGGAACCAAGG - Intronic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1099004884 12:77224393-77224415 CAGAGAAAAAGGAGGAACCAGGG - Intergenic
1099054144 12:77816693-77816715 ATGATAAAAAAGAGTAAACATGG - Intergenic
1099543734 12:83949824-83949846 CTGAGATAAAGGATTAGTCAAGG - Intergenic
1099771277 12:87060975-87060997 CTGACAAAATGGTGTCACCAAGG - Intergenic
1100037387 12:90269521-90269543 CTGATTAAAAGGATGAACCAAGG - Intergenic
1100978813 12:100148357-100148379 CTGAGCGAAATGAGTGACCATGG - Intergenic
1102029198 12:109730316-109730338 CTGCTAAAATGGAATAACCAAGG + Intronic
1104326073 12:127799969-127799991 CTGTGCAGAAGGAGTAAACAAGG + Intergenic
1106069720 13:26398063-26398085 CGAAGAAAAAGGAGAAACAAAGG - Intronic
1107972468 13:45656605-45656627 CTGACAAAAAGGAAAAACAATGG + Intergenic
1108905099 13:55460243-55460265 GGGACAAAAAGGAGTAAGCAAGG - Intergenic
1108981300 13:56519048-56519070 GTCAGAAAAAGAAGTTACCATGG + Intergenic
1109736739 13:66495926-66495948 CTGTGAAACAGGAGTAATAATGG + Intronic
1110127798 13:71968900-71968922 CTGAAAAAAAGGAGTAATTATGG + Intergenic
1110375476 13:74788672-74788694 CAGAAAAAAAGGAGTAAGGATGG + Intergenic
1111090853 13:83445186-83445208 CAGAGAGAAAGGAGCAACCCAGG + Intergenic
1111191990 13:84820600-84820622 CTGAGAATCAGGAATAATCAGGG + Intergenic
1111442480 13:88298085-88298107 CTGAGCAAAAGCAGTACCCCAGG + Intergenic
1112925571 13:104670603-104670625 CTGAGGAAGAGGAGAAGCCACGG + Intergenic
1113234033 13:108249369-108249391 CTGAAATAAAGGTGTAAACAGGG - Intergenic
1117603497 14:57399586-57399608 CTGAGAAAAAGGAGTATATTGGG + Intronic
1118482545 14:66181575-66181597 CTGAGAAGAAGATGTAGCCAAGG + Intergenic
1118688344 14:68313880-68313902 CAGAGAAAAAGGAGGAAGCTAGG - Intronic
1119616048 14:76099774-76099796 CTGTGAAACAGGAGTAGTCATGG - Intergenic
1120835819 14:89037544-89037566 AGGAGAAAAAGGGGAAACCAGGG + Intergenic
1121892210 14:97604837-97604859 CTGAGAAACAGGAGGTAGCAGGG + Intergenic
1122224858 14:100269157-100269179 CTGAGAAACTGGAGAAAGCATGG - Intronic
1123120820 14:105915928-105915950 CTGAGTAATTGGAGTAACAAAGG - Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1123403531 15:20007491-20007513 CTGAGTAATTGGAGTAACAAAGG - Intergenic
1123512870 15:21014145-21014167 CTGAGTAATTGGAGTAACAAAGG - Intergenic
1124412644 15:29449275-29449297 CTCAGAGAAAGAAGCAACCAGGG + Intronic
1124825490 15:33090528-33090550 CTGAGAAAAATGAGAGTCCAGGG + Intronic
1124872311 15:33555297-33555319 GTGAGAAAACGGAGCAAGCAAGG - Intronic
1126238291 15:46410830-46410852 CTGAGAAAAATGAGGCAACATGG - Intergenic
1126851489 15:52799570-52799592 CTGAAAAAAAGGAGAAAGAAAGG + Intergenic
1127525499 15:59788446-59788468 CTGAAAAAAAGGATTTAACAAGG - Intergenic
1129508100 15:76099739-76099761 CTGTGAAAATGGACTAACCCAGG - Intronic
1130056655 15:80532135-80532157 GTGTGAAATAGGAATAACCATGG - Intronic
1130632602 15:85583735-85583757 ATGAGAAAAAGTAAAAACCAGGG + Intronic
1132992783 16:2805688-2805710 ATGAGAAAGTGGAGAAACCAAGG + Intergenic
1133856441 16:9553765-9553787 AAAAGAAAAAGAAGTAACCAAGG - Intergenic
1134422959 16:14111759-14111781 CCGAGAAAAAGGGGGAACCAGGG - Intronic
1134558221 16:15184611-15184633 CTGAGCTAAAGGGGCAACCAGGG - Intergenic
1134811553 16:17171532-17171554 CTGAGATAAACAAGTAACCTTGG - Intronic
1134918753 16:18096213-18096235 CTGAGCTAAAGGGGCAACCAGGG - Intergenic
1135225304 16:20650695-20650717 CTAAGAATAAGGAGTAAACAAGG + Intronic
1136626930 16:31466970-31466992 CTGAGCAGAAGGAGTCATCATGG + Exonic
1137351402 16:47716965-47716987 CTGACCAATAGGAGTGACCACGG - Intergenic
1137449221 16:48555250-48555272 GTTAGAAAAAGGAGTCACTAGGG + Intronic
1138869044 16:60858615-60858637 CTGGGAATAAAGAGTAAGCAAGG + Intergenic
1138992841 16:62412439-62412461 CTGAGCAAAATGAGTAAACTTGG - Intergenic
1139983543 16:70879806-70879828 CTGAAAATAAGGAGTAAGCCTGG - Intronic
1140363371 16:74363183-74363205 CTGAGGAAAAGGAGCAAAAACGG - Intergenic
1140825772 16:78704757-78704779 CTGAAAGAAAGGAGTCAACAGGG - Intronic
1141464600 16:84197382-84197404 CTGGAAAACAGGAGGAACCAGGG - Intergenic
1143274104 17:5697131-5697153 CTGAGAAAAAGTCATACCCAAGG + Intergenic
1143437903 17:6942854-6942876 CTGAGTGAAATGAGTGACCAAGG - Intronic
1144414025 17:15029336-15029358 GTGAGAAAAAGGAGCAGGCAAGG + Intergenic
1146621059 17:34398343-34398365 CTGAAAACCAGGAGGAACCATGG + Intergenic
1149818952 17:59755688-59755710 CTGTCAAAAAGCAGTAACCGGGG - Intronic
1149910779 17:60564952-60564974 CTGAAAAAAAGCTGTGACCAAGG - Intronic
1151998532 17:77629419-77629441 CTGAAAAAAAGGAATAAAGAGGG - Intergenic
1153584611 18:6608282-6608304 CTGAGAACCAGGAGTACCGAGGG + Intergenic
1154110643 18:11565875-11565897 TTGAGAAAAGGAAGTCACCAGGG + Intergenic
1154391191 18:13937587-13937609 CTGAGAACGAGGCTTAACCATGG + Intergenic
1155544213 18:26898796-26898818 CTGAGAAAAAGCAGTGACCTTGG + Intergenic
1155780966 18:29835467-29835489 CTGAGAATCTGGAGTCACCAAGG - Intergenic
1157646913 18:49283547-49283569 CTGAGAAACTGAAGCAACCAAGG + Intronic
1157808972 18:50679705-50679727 ATGAGAAGAGGGAGTAATCATGG + Intronic
1158083964 18:53627595-53627617 CAGAGAAAGAGAAGTAACGAAGG - Intergenic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1160040818 18:75344169-75344191 CTGAGACAGAGGAGAAAACAAGG + Intergenic
1160090998 18:75826406-75826428 CTGAGATCAAGGTGTCACCAGGG + Intergenic
1163901575 19:20106086-20106108 CTGAGAAAAAAAATTAACCATGG - Intronic
1164575248 19:29401982-29402004 CTGAGACAAAGGAGCCTCCAGGG + Intergenic
1165971236 19:39632352-39632374 TTGAGAAAAAGTATTAAACATGG - Intergenic
1166443705 19:42839687-42839709 CTGAGAAAAAGATGCAACCATGG - Intronic
1166466475 19:43036276-43036298 CTGAGAAAAAGATGCAACCATGG - Intronic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
1167771180 19:51519914-51519936 CTGAGAACAAGGTGTTATCAGGG - Exonic
1168479077 19:56702350-56702372 CTAAAATCAAGGAGTAACCAGGG - Intergenic
925247489 2:2397248-2397270 CAGAGAGAAAGGCGTGACCAAGG - Intergenic
927351779 2:22124931-22124953 CTAAGGAAAAGGAGAAACCCAGG + Intergenic
927446126 2:23163019-23163041 CTGAGAAAGTGCAGAAACCAAGG + Intergenic
928598368 2:32878949-32878971 CTGAGAAATAGAACTACCCATGG + Intergenic
928691170 2:33800677-33800699 CTGAAAAAGAAGAGTAACGAGGG - Intergenic
929732993 2:44515577-44515599 TTGAAAAATGGGAGTAACCATGG + Intronic
929846249 2:45531651-45531673 ATGAAACAAAGAAGTAACCAGGG + Intronic
929897135 2:45971165-45971187 CTGGGAGAAAGGAGGAATCAGGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930098115 2:47582494-47582516 CTAAGAAAAAGGGGAAGCCATGG + Intergenic
930158187 2:48126864-48126886 ATGAGAATAAGGAATAAGCAAGG - Intergenic
930550548 2:52829626-52829648 TTGAGAAAAAGGAGGAATAAGGG - Intergenic
931303969 2:61010195-61010217 CTGAAAAAAATGTGTAAGCAGGG + Intronic
932074178 2:68647624-68647646 CTGAAAAAAGGGGGTTACCAAGG + Intronic
932510106 2:72277919-72277941 CTGAGCAAAATTAGTAACCTTGG - Intronic
933284815 2:80374569-80374591 CTGAGATGAAGGAGTCAACAGGG + Intronic
933503900 2:83153046-83153068 TTGAGGAAAAGAAGTAACTAAGG - Intergenic
935088831 2:99874919-99874941 CGGAGAAAAAGAAGTAAATATGG + Intronic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
937015533 2:118602035-118602057 CTGAGAAGAAGATGTAACAAAGG + Intergenic
939490279 2:142868486-142868508 CTCAGAAAAACAAGCAACCACGG + Intergenic
940042402 2:149374247-149374269 CTGAGAAAAAAGAAAAACAAAGG + Intronic
941254495 2:163211555-163211577 CTGAGACAAAGGTGTCAGCAGGG + Intergenic
941848048 2:170151020-170151042 AAGATAAAAAGGAGTAACAAAGG + Intergenic
942066097 2:172273135-172273157 CTAAGAAAAAGGAGTAAAGCTGG - Intergenic
942143064 2:172997308-172997330 CTTATAAAAAGGGGTAACCTTGG - Intronic
942461815 2:176173704-176173726 ATAAGAAACAGGAGTAAACAAGG - Intergenic
943798494 2:192028438-192028460 CTGAGAAATACGAATGACCAAGG + Intronic
943987024 2:194636039-194636061 CTGAGAAAATTTAGTAATCAAGG - Intergenic
945133044 2:206595446-206595468 CTGAGAAAAGAGGGTTACCAAGG + Intronic
1169971928 20:11277902-11277924 CAGAGACAGAGGAGTAACCAGGG - Intergenic
1170069571 20:12350954-12350976 CAAAGAGAAAGGAGCAACCAAGG - Intergenic
1170985345 20:21252926-21252948 CTGGGAAACAGGACTAGCCATGG - Intergenic
1171285232 20:23931412-23931434 CTGAGGAACAGGATGAACCATGG - Intergenic
1172563315 20:35908247-35908269 CTGAGGAACAGGAGTAGACAAGG - Intronic
1173220344 20:41127239-41127261 CTGACAAAAATCAGTAAACAAGG + Intergenic
1173800951 20:45894141-45894163 CGGAGAACAAGGAGTCCCCAAGG - Intronic
1175568289 20:59998358-59998380 CTGGGAAAGAAGGGTAACCAGGG - Intronic
1176934499 21:14850349-14850371 CTGAGAAAAGGAAGGAATCAAGG - Intergenic
1177106422 21:16961602-16961624 CTTAGAAAAATGAGCAACAAAGG - Intergenic
1177296346 21:19181185-19181207 ATGAGGAAAAGGATTAATCAAGG + Intergenic
1177722420 21:24925485-24925507 CTGTCATAAAGCAGTAACCATGG + Intergenic
1178340195 21:31779443-31779465 CTGAGAGAATGGAGGAGCCAGGG - Intergenic
1179343839 21:40537786-40537808 CTGAGATCAAGGAGTCAGCAGGG - Intronic
1179861278 21:44190634-44190656 CTGAGAAGAAGTAGTTACCCAGG + Intergenic
1181614760 22:24046052-24046074 GTGACAAAAAGGAGAAATCAAGG - Intronic
1183759803 22:39805744-39805766 CTAAGAAAACAGAATAACCAAGG + Intronic
1184925176 22:47631549-47631571 CTGAGAACCAGGAGTACCAACGG + Intergenic
949700290 3:6748798-6748820 CTCAGTAAAAGCAGTAAACATGG - Intergenic
950883818 3:16345609-16345631 CTGAGAACCAGGAGCAACAAGGG - Intronic
951617623 3:24566119-24566141 CTGAGTAAAAAGAGTAGCCCAGG - Intergenic
952562037 3:34605926-34605948 CTGAGAACCAGGAGTACCAAGGG - Intergenic
954252206 3:49376705-49376727 CTGATGAAAGGGAGTACCCAAGG + Intronic
954276674 3:49546656-49546678 CTGATGAAAGGGAGTACCCAAGG - Intergenic
954347660 3:50013748-50013770 CTGAGAAGCAGCAGCAACCATGG + Intronic
955841818 3:63120638-63120660 AGGAGAAAAAGGAGTATCCCAGG + Intergenic
956036252 3:65095347-65095369 ATGAGGATAAAGAGTAACCAAGG + Intergenic
956769897 3:72516318-72516340 ATGGGAAATAGGAGTAACAAGGG - Intergenic
956945562 3:74218530-74218552 CAGAGAAAAAGGAAGAAACAAGG - Intergenic
957920706 3:86744716-86744738 ATGAGAAACAGGGGTTACCAAGG - Intergenic
958820898 3:98972826-98972848 ATGAGAAGATGGAGTAACAAAGG - Intergenic
959067373 3:101671897-101671919 TTGAGAAAAATAAGTCACCAAGG + Intronic
960451402 3:117813347-117813369 ATGAGAAAATGTAGTAACTAGGG - Intergenic
960820931 3:121730572-121730594 CTGTGGAAAAGGAATAGCCAAGG + Intronic
960827491 3:121806015-121806037 CAGAGAAAAAGGAATAAACAAGG - Intronic
961671406 3:128534312-128534334 CTGAGAGAGAGGAGGAACCAGGG + Intergenic
962044620 3:131742341-131742363 CTTAGAAAAAGGAGAGCCCACGG - Intronic
962540946 3:136381169-136381191 CTAAGAGAAAGAAGTAAACAAGG + Intronic
964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG + Intronic
965425730 3:168520375-168520397 CTCAGAAACAGCAGTACCCAGGG + Intergenic
966103110 3:176299799-176299821 CTGAGATAAAGGAGGAATTATGG + Intergenic
966518025 3:180841211-180841233 CAGAAATAAAGGAGTAACAAAGG + Intronic
967925413 3:194641866-194641888 CTGACAAAAAGGAGTCATCTGGG - Exonic
968294397 3:197562785-197562807 CTGAGAATGAGGAGAAAACAAGG + Intronic
970471369 4:16382484-16382506 CTCAGAAAAAAGAAGAACCAGGG + Intergenic
972475868 4:39448782-39448804 CTGAGATACAGCTGTAACCAAGG + Exonic
973589213 4:52423886-52423908 CTAAGATAAAGGAGTCCCCAGGG - Intergenic
973831252 4:54761872-54761894 CAGAAAAAAGGAAGTAACCAAGG - Intergenic
974346388 4:60687145-60687167 CTAAGAAAAGGGAGTTAGCAAGG - Intergenic
974580819 4:63798919-63798941 CTGAGAAATAGGGGTAAACTGGG + Intergenic
974688355 4:65262710-65262732 ATGAGAAAAGGGAGAAATCAAGG + Intergenic
974833883 4:67223001-67223023 CTGAGAACCAGGAGTACCAAGGG + Intergenic
975637801 4:76467695-76467717 GTGAGGAAAAGGAGGAAGCATGG + Intronic
975795440 4:78001927-78001949 TTGAGAAAAAGTATTAAACATGG + Intergenic
976536361 4:86222409-86222431 CTGGGGAAGAGGAGTAACCTTGG - Intronic
976621048 4:87127620-87127642 CTGAAAAAGAGGAAAAACCAGGG - Intronic
976798970 4:88966494-88966516 CAGGCAAAAAGGATTAACCATGG - Intronic
976827996 4:89281665-89281687 CTGAGAACAAGGTGTCAGCAGGG - Intronic
977497193 4:97792360-97792382 CTGAGAAAAGGGAGAAGTCAAGG - Intronic
978316207 4:107440274-107440296 CTGATAAAATAGAGTTACCATGG - Intergenic
978974881 4:114857536-114857558 CTGACAAAGAGGAGAAACCCAGG + Intronic
979681581 4:123466095-123466117 GGGAGAAAAAGGAGAAAGCAAGG + Intergenic
980382697 4:132045158-132045180 CTGAGAAACAGGAGAACCAATGG + Intergenic
980401062 4:132286548-132286570 GTGAGAAAAAAGAGAAACCCTGG + Intergenic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
981189705 4:141847763-141847785 CAGAAAAATATGAGTAACCAAGG - Intergenic
981455467 4:144948205-144948227 CTGAGAAGAAGGAGTGGCCTGGG - Intergenic
981526096 4:145708173-145708195 CTAAGGAAAAGGAGAAACAAAGG - Intronic
981909518 4:149962593-149962615 CTGAGAACCAGGAGTACCAATGG - Intergenic
983658721 4:170110176-170110198 CTCAGAAAAATGACTTACCAGGG + Intergenic
984821766 4:183888641-183888663 GTCAGAATAAGAAGTAACCACGG - Intronic
984863112 4:184257299-184257321 TTGAGAAAAAGGAGGAAGGAAGG + Intergenic
985290767 4:188384683-188384705 CTAAGAAAAGGGAGGAACTAGGG - Intergenic
985516377 5:347190-347212 ATGAGCAAAAGGCGTAAACACGG - Intronic
985964138 5:3326726-3326748 CTGAGAAAAATCAGTAACTTTGG - Intergenic
986033363 5:3914369-3914391 CTGAGATAAAGGTGTCCCCAAGG - Intergenic
986142758 5:5047340-5047362 CTGAGAAGAATTACTAACCAGGG + Intergenic
986651886 5:9972147-9972169 CTGAGAACCAGGAGAGACCACGG + Intergenic
987712219 5:21515539-21515561 CTGAGAAATACGTTTAACCAAGG + Intergenic
988286364 5:29222819-29222841 CTGATAAAACGGAGTGAACAAGG - Intergenic
988512354 5:31875913-31875935 CTGTGAAAAAGGAGTATGAAAGG - Intronic
989424132 5:41276281-41276303 CTGAGAAAAGGAAGTAACCTTGG - Intergenic
990744613 5:58946905-58946927 CTTAGAAAAAGACGGAACCATGG - Intergenic
991632060 5:68666062-68666084 CTGACTAGAAGGATTAACCATGG - Intergenic
991762579 5:69934685-69934707 CTGAGAAATACGTTTAACCAAGG + Intergenic
991784746 5:70183441-70183463 CTGAGAAATACGTTTAACCAAGG - Intergenic
991841807 5:70809725-70809747 CTGAGAAATACGTTTAACCAAGG + Intergenic
991877194 5:71183816-71183838 CTGAGAAATACGTTTAACCAAGG - Intergenic
993376792 5:87157905-87157927 CTCAGAAAATGGAGTAACAACGG + Intergenic
993668173 5:90727078-90727100 CTAATAAAAAGGAGTAATCAAGG - Intronic
994075016 5:95640920-95640942 ATGAGAAGGAGGAGTGACCAAGG + Intergenic
996529436 5:124512270-124512292 CTCAGAAAAAGCAGGAACCCTGG + Intergenic
997203340 5:132026190-132026212 CTGCCAACAAGGAGTTACCAAGG - Intergenic
998249339 5:140540674-140540696 CAGAGAAAGAGTAGTAACTAGGG + Intronic
998949161 5:147374412-147374434 GTGAGAGAAAGGAGAAAGCAGGG + Intronic
1000992120 5:167922185-167922207 ATGAGGAAAAGGAAGAACCAAGG - Intronic
1001804974 5:174576257-174576279 CTCAGAAAAAGGGAGAACCAAGG - Intergenic
1003250971 6:4428952-4428974 CTGAAAAAAAGGAGAAATCAGGG + Intergenic
1003514554 6:6807089-6807111 ATGAGAAAGAGAAGTAAACAGGG + Intergenic
1003559903 6:7171837-7171859 CTGAGCAGAAAGGGTAACCAAGG + Intronic
1003622380 6:7712294-7712316 TTGAGGAAGAGGAGGAACCAAGG - Intergenic
1004391276 6:15211662-15211684 CCGAGAAAAAGGAGGAATGAAGG + Intergenic
1006173075 6:32106559-32106581 CAGAGAAAAAGGAGTAATTGGGG + Intronic
1006566425 6:34961785-34961807 CTGAGAAAGAGGAAACACCAAGG - Intronic
1006627300 6:35406397-35406419 CTGAGAACAGGGAGCAACCTTGG + Intronic
1006708983 6:36048645-36048667 CTGAGGAAAGGGAGAAATCAAGG + Intronic
1007302898 6:40881751-40881773 TTAAGAAAAATGAGGAACCAGGG + Intergenic
1008879497 6:56366429-56366451 CTGAGAATCAGGAGTAAGAATGG + Intronic
1009371631 6:62911043-62911065 CTGAGCAAAAGGAGTAAAACTGG + Intergenic
1009864670 6:69382103-69382125 GAGAGAAAAGGGTGTAACCAGGG + Intronic
1009982212 6:70740604-70740626 CTGAGAAAAAGAAAAAACCTGGG - Intronic
1010183687 6:73118274-73118296 GTGAGAAAAAGAAGACACCAAGG - Intronic
1011939700 6:92827473-92827495 CTAAGAATAAGGAGAAAACAAGG + Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014192380 6:118512235-118512257 CTGAGAATCTGGAGAAACCAAGG + Intronic
1014336554 6:120144198-120144220 CTGATAAAAAGTACTAACAATGG + Intergenic
1014578514 6:123105130-123105152 CTAAGCAAAAGGAGTAAACCTGG - Intergenic
1015453994 6:133404176-133404198 CTGAGAAAAATAAGTGAACAGGG - Intronic
1015461167 6:133493146-133493168 CTGAGCAAAAGGAGTAAAACTGG + Intronic
1016654913 6:146507736-146507758 CTGAGAAAAAGAAACAACAAGGG + Intergenic
1017667994 6:156740012-156740034 CTGAGAACAAGGAGTGTCAAGGG + Intergenic
1018457506 6:163964908-163964930 ACGAGAAAAGAGAGTAACCAGGG + Intergenic
1020828224 7:13058818-13058840 CTGGGAAAAAGCAGAAACTACGG - Intergenic
1022311581 7:29201186-29201208 CTGAGAGCAAGGAGGAACCTTGG + Intronic
1022421450 7:30227104-30227126 CAGAGAAGAAGGAGAAAACATGG - Intergenic
1023020770 7:36010089-36010111 CTGTGAAATGGGAATAACCATGG + Intergenic
1023718400 7:43067754-43067776 CTGAGAAACAGAAATTACCAAGG + Intergenic
1024876392 7:54028883-54028905 CTGAGCAAATGGAGAAACAAAGG - Intergenic
1027309278 7:76937284-76937306 CTGAGGCAAAGGAGCATCCAGGG - Intergenic
1034204135 7:149301041-149301063 CTGAGAAACACAAGCAACCAAGG - Intergenic
1035183109 7:157105181-157105203 CTGAGACAAATGAGTGACCATGG + Intergenic
1035466954 7:159085694-159085716 CTGAAACAAAAGAGTAACCCTGG - Intronic
1035671872 8:1424349-1424371 ATGAGAAAAATGTGTAACAAGGG - Intergenic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1039644172 8:39262486-39262508 CTGAGAAAAAAGAGTAAAGCTGG - Intronic
1040004025 8:42602851-42602873 CTGAAAAAAAAGAGTAATTAAGG - Intergenic
1042621802 8:70714900-70714922 CTGAGGAAAAGGCATAACAAAGG + Intronic
1044311400 8:90696979-90697001 CTGAGGCAAAGGAATAATCAAGG - Intronic
1044958095 8:97502910-97502932 CTAAGAAAAAGTAGTTACTAAGG + Intergenic
1047215554 8:122873186-122873208 TTAAGAAAAAGGAGTGACCGTGG + Intronic
1047729631 8:127716226-127716248 CTGAGAAAACAGAGTAAGCAAGG - Intergenic
1048502015 8:134986840-134986862 CTGAGAAAAGGAAGAAACCCAGG - Intergenic
1049435615 8:142584880-142584902 GGGAGAAAAAGATGTAACCAAGG + Intergenic
1049723168 8:144130727-144130749 CAGAAAAAAAGGACTCACCATGG - Intergenic
1050015888 9:1234043-1234065 CTGAGGAAAAGTAATATCCATGG - Intergenic
1050292974 9:4175952-4175974 CTCAGAAAAAGGAGAAGCCCTGG - Intronic
1050657357 9:7843736-7843758 CACAGAAAAAGGATAAACCATGG + Intronic
1050929336 9:11303821-11303843 CTCAGAGAAAGGAAAAACCAAGG - Intergenic
1051404423 9:16720086-16720108 ATGATAAAAACGTGTAACCAGGG - Intronic
1051828691 9:21251489-21251511 CTCAGAAAATGGAGTAGCAATGG - Intergenic
1052156966 9:25204020-25204042 CTGAGAAAAATGTGCAACCATGG + Intergenic
1052844228 9:33320893-33320915 TTGAGAAAAAGGATTAAGTAGGG - Intronic
1054932926 9:70654635-70654657 CTAAGAATGAGGAGTAAACAAGG + Intronic
1055788832 9:79899682-79899704 CTGAGAACAAGGTGTCAGCAGGG - Intergenic
1055900309 9:81226916-81226938 CTAAGAAAAAGGAACAACCAAGG - Intergenic
1055994967 9:82147327-82147349 CTAAGAAAAAGGAGGAAACGTGG + Intergenic
1056958746 9:91103352-91103374 CTGAGATAAAGGTGTCAACAGGG - Intergenic
1058395964 9:104554778-104554800 CTTAGAAATAAGTGTAACCAAGG + Intergenic
1058610400 9:106769846-106769868 CTGAGAAAGGTGAGTAAACAAGG + Intergenic
1060633012 9:125176721-125176743 TTGGGACAAAGGAGTAAGCAGGG + Intronic
1185830522 X:3298060-3298082 CTCAGAATAAGAAGTAACTATGG + Intergenic
1186150114 X:6665744-6665766 CTGAGAAAAAGGTGTGATGATGG - Intergenic
1186313708 X:8346535-8346557 CTGAGAACCAGGAGCACCCAGGG - Intergenic
1187590347 X:20710896-20710918 CTGAGAAAAATGACTTCCCAGGG - Intergenic
1188717718 X:33480869-33480891 CTTAGAAACAGAGGTAACCAGGG + Intergenic
1189196624 X:39159108-39159130 CTGAGAAAATGGACTACCGATGG - Intergenic
1189624897 X:42886459-42886481 TTAAGAAAAAGGAGGAATCAAGG + Intergenic
1189691574 X:43622964-43622986 CTGAGAATGAGGAGAAAACAAGG - Intergenic
1190480571 X:50872721-50872743 CTGAGAAAGGGGAATGACCAAGG - Intergenic
1191189571 X:57651921-57651943 CTCAGAAAAAGGACTATTCAAGG - Intergenic
1192260140 X:69501204-69501226 CTGAGAAGAAGGACTGGCCAGGG + Intergenic
1193433832 X:81447098-81447120 CTCAGAAAAATGAGAAACAAAGG - Intergenic
1194502143 X:94694625-94694647 CTGAGAAAAAAGAGAAAGTAAGG - Intergenic
1196606651 X:117664714-117664736 CTGAGCAAAAGGACTTACCCAGG + Intergenic
1197026977 X:121763724-121763746 CTTAGAAAAATAACTAACCAAGG + Intergenic
1197324819 X:125079953-125079975 ATGAGAAGCAGGAGTAATCACGG + Intergenic
1197334741 X:125199309-125199331 CAGAGAAAAAGTATTAACCTTGG + Intergenic
1197972031 X:132124751-132124773 GACAGAAAAAGGAATAACCAAGG + Intronic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198321761 X:135524483-135524505 CTGTGAAAAAAGAGAAACAATGG - Intronic
1198428059 X:136539574-136539596 CTGAGAAGAAATAGTAACCAGGG - Intronic
1198882538 X:141296444-141296466 CTGAGAAAAAAGAGTAAAACTGG + Intergenic
1200134029 X:153866012-153866034 CTTATACAAAGGAGAAACCATGG + Intronic
1200226112 X:154418811-154418833 CTGAGAAGAAGGGGTCAGCAGGG + Intronic
1201453866 Y:14146932-14146954 GTTAGAAAAAGGACCAACCAAGG - Intergenic