ID: 1166895836

View in Genome Browser
Species Human (GRCh38)
Location 19:46021568-46021590
Sequence CATTCTAAGGAGGAGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166895826_1166895836 12 Left 1166895826 19:46021533-46021555 CCTCCCTGTGGAAACCGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 177
1166895829_1166895836 8 Left 1166895829 19:46021537-46021559 CCTGTGGAAACCGTCAGGCTGGA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 177
1166895830_1166895836 -2 Left 1166895830 19:46021547-46021569 CCGTCAGGCTGGACTGCAGCCCA 0: 1
1: 0
2: 3
3: 32
4: 327
Right 1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 177
1166895827_1166895836 9 Left 1166895827 19:46021536-46021558 CCCTGTGGAAACCGTCAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 177
1166895824_1166895836 13 Left 1166895824 19:46021532-46021554 CCCTCCCTGTGGAAACCGTCAGG 0: 1
1: 0
2: 2
3: 6
4: 114
Right 1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166895836 Original CRISPR CATTCTAAGGAGGAGGTAGC TGG Intronic
900974909 1:6010933-6010955 AATTCTAAGGAGGAAAGAGCTGG - Intronic
904766894 1:32856572-32856594 CATTATAAGTAGGATGGAGCAGG + Exonic
905211569 1:36377972-36377994 CATTTTACAGAGGAGGAAGCTGG + Intronic
906578083 1:46908957-46908979 CATTCAGAGGCGGAGGTGGCAGG + Intergenic
910872894 1:91851208-91851230 CCTTCCAAGGAGTAGGCAGCAGG - Intronic
918134341 1:181658435-181658457 CATTTTACAGAGGAGGAAGCAGG - Intronic
918642587 1:186861284-186861306 CGTTCTAAGGATAAGGTCGCTGG - Intronic
918725455 1:187916265-187916287 CATTCTAAGTACTAGGTATCAGG - Intergenic
921604311 1:217137271-217137293 CGGTCTTAGGAGGAGGTAACTGG - Intronic
921884178 1:220287861-220287883 CCTTCTGAGGAAGAGGTAGTGGG - Intergenic
922385801 1:225080998-225081020 CATACTCAGGGTGAGGTAGCTGG - Intronic
922506292 1:226127909-226127931 CAGACTTAGGAGGAGGTACCGGG - Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
923967281 1:239155983-239156005 GAATCTAAGGAGGAGGTCGTGGG - Intergenic
1063564696 10:7162584-7162606 CCTTCTAAGGGGGACGTAGCTGG + Exonic
1063604028 10:7507392-7507414 CAGACTAAGAAGGATGTAGCAGG + Intergenic
1065280860 10:24136103-24136125 CACTCTAAGGAGGAGATAAAAGG + Intronic
1069844253 10:71359703-71359725 CATTTTACAGAGGAGGAAGCAGG + Intronic
1070420227 10:76229086-76229108 AATTCTAAGGAGAATGGAGCTGG + Intronic
1072385162 10:94917512-94917534 CATTTTAGGGATGAGGAAGCTGG - Intergenic
1072674089 10:97452634-97452656 CATCCTAAGGATGAGGTGTCAGG - Intronic
1073367974 10:102959740-102959762 CATTTTAAAGATGAGGAAGCTGG - Intronic
1074060117 10:109957608-109957630 ACTTCTAAAGAGGAGGCAGCAGG - Intergenic
1075979949 10:126729492-126729514 CACTCTATGGAGAAGATAGCTGG + Intergenic
1076399749 10:130174216-130174238 CTTGCTAAGGTGGAGGGAGCTGG + Intronic
1076504884 10:130965072-130965094 CCTTCAAAGGGGCAGGTAGCTGG - Intergenic
1077011443 11:380991-381013 CATTCAGAGGAGGAGGACGCAGG - Intronic
1077385653 11:2268408-2268430 CACCCTACGGAGGAGGCAGCAGG + Intergenic
1077933545 11:6758721-6758743 CCTTATAAGAGGGAGGTAGCAGG - Intergenic
1079281411 11:19090185-19090207 CATTAAAAGTAGGAGGTAGAAGG + Intergenic
1080864039 11:36177710-36177732 CCTGCTCAGGTGGAGGTAGCAGG + Intronic
1080885635 11:36365151-36365173 CCTTCTGTGAAGGAGGTAGCTGG + Intronic
1082135539 11:48545056-48545078 CATTCAAAGCAGTAGGTAGAGGG - Intergenic
1083113795 11:60438263-60438285 CATTCAAAGCAGGATGTAGAGGG + Intronic
1085680280 11:78567335-78567357 CATTCTAGGCAGGATGGAGCAGG + Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087686430 11:101270947-101270969 CATTCTAGGGAGGGTGTTGCAGG - Intergenic
1088807897 11:113368510-113368532 CATCCTAAAGAGGATGTGGCCGG + Intronic
1089303437 11:117512426-117512448 CATTCTAATGAGGTGGGAGAGGG + Intronic
1090354853 11:126133456-126133478 AAGACTAAGGAGGAAGTAGCAGG - Intergenic
1091060556 11:132457518-132457540 CCTTCTATGGAGGAGGCAGGTGG + Intronic
1092901377 12:13062676-13062698 CTTACTGAGGAGGAGGAAGCAGG - Intronic
1092910838 12:13143716-13143738 CATTCTAAGCAGGAGAAAGAAGG + Intergenic
1095876077 12:47080484-47080506 GTTTCTAGGGAGGAGGTCGCGGG + Intronic
1096331639 12:50718361-50718383 CACTCTGAGGAGGTGATAGCTGG - Intronic
1096694189 12:53338445-53338467 GATTCTAAAGAAGAGATAGCAGG + Intronic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1103236995 12:119381691-119381713 CATTCTAAGGACGAGGAAGCTGG + Intronic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104822432 12:131684991-131685013 CATTCTACGGAGCAGGAAACGGG - Intergenic
1107557393 13:41528672-41528694 CATTCTGAGGATGAGGCAGATGG + Intergenic
1109031835 13:57200168-57200190 CAGTCTAAAGAGGAGGGAGGAGG - Intergenic
1117274494 14:54179042-54179064 CATTCTAAGATGGAGCTAGCAGG - Intergenic
1117333547 14:54737258-54737280 CATTCCAAGAAGAAGGTAGTGGG + Exonic
1120562501 14:86013052-86013074 CATTCGATGCAGGAGGAAGCAGG - Intergenic
1121545142 14:94757742-94757764 CATTTTACTGAGGAGGAAGCTGG - Intergenic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1122049142 14:99043277-99043299 CATGCTAAGGAGCTTGTAGCAGG - Intergenic
1122926364 14:104904710-104904732 CCTTCAAAGGAGGAGGGAGGAGG - Intergenic
1122978443 14:105180748-105180770 CACTTGAAGGAGGAGATAGCTGG - Intronic
1125382267 15:39099397-39099419 CATTCTAGTGAGGAGGTTTCTGG + Intergenic
1126274145 15:46856448-46856470 CATTCTAGGGAGGTGGGAACAGG + Intergenic
1127390466 15:58501113-58501135 CATTTTAAGGTGGAGTCAGCAGG - Intronic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128099306 15:64985380-64985402 CATTCTAAGGAGAATGAAGGGGG + Intronic
1128220979 15:65968401-65968423 CCTGCTAAGCAGGAGGGAGCAGG - Intronic
1129704162 15:77785077-77785099 CATTCTAAGGAGCTGGAAACTGG - Intronic
1130897733 15:88183854-88183876 CATCCAAGGGTGGAGGTAGCTGG + Intronic
1131593640 15:93774598-93774620 CATTCTAGGGAAGAGACAGCGGG - Intergenic
1133479919 16:6160208-6160230 CATTTTAGGGAGGAAGTAGGAGG + Intronic
1134325035 16:13199768-13199790 CATTATAAGAAGGAGGTATTGGG + Intronic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1140422992 16:74836052-74836074 CCTTCTAAGAAGGAGGCAGGAGG - Intergenic
1142905343 17:3037375-3037397 CATGCTAAGGAGCAGGAAGCGGG - Exonic
1144295253 17:13868766-13868788 CATTCAAAGGAGGAGGAAACAGG - Intergenic
1147364109 17:39949176-39949198 CATTCTCAGAAGCAGGGAGCTGG + Intergenic
1149420689 17:56508179-56508201 CATGCTGAGGAAGAGATAGCAGG - Intronic
1151542741 17:74773036-74773058 CACTCTGAGGAGGAGGTGACAGG + Exonic
1152183418 17:78839932-78839954 CTTTAGAAGGAGGAGGGAGCGGG - Intronic
1153534046 18:6081231-6081253 GATTCTAAGGAGGAGCTAGCAGG + Intronic
1153616163 18:6936270-6936292 CAGTCAAGGGAGGAGGTAGGAGG - Intergenic
1153842413 18:9018670-9018692 CCTTCTAAGGGGGAGGCAGAAGG + Intergenic
1154362115 18:13672329-13672351 CATTCTAAGGAAGTGGTATTTGG - Intronic
1158203615 18:54966668-54966690 CATCCTAAAGAGGAGAAAGCAGG - Intergenic
1158750653 18:60255709-60255731 CATTCTAAGGAGGAGTATGTTGG + Intergenic
1160265276 18:77336446-77336468 CCTTCTAAGAGGGAGGCAGCAGG + Intergenic
1163765278 19:19160393-19160415 CATTTTATGGGGGAGGAAGCAGG - Intronic
1165152431 19:33768910-33768932 CTTTCAAAGGAGGAAGTTGCAGG + Intronic
1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG + Intronic
1167079322 19:47268510-47268532 CTTCCTAAGGAGGAGGCAGCTGG + Intronic
925749866 2:7078384-7078406 CATTGTTAGGAAGAGGTGGCTGG + Intergenic
926165347 2:10519349-10519371 CCTTCTAGGGAGGAAGGAGCAGG + Intergenic
926521460 2:13920881-13920903 TATTCTAAAGAAGAGGAAGCAGG - Intergenic
928624082 2:33121631-33121653 CATTCCATGGAGGAGCTGGCTGG + Intronic
929418131 2:41764650-41764672 GAGTCTAAGGAGGAGGCACCAGG + Intergenic
930695892 2:54411412-54411434 TCTTCTAAGGAGGGGGTATCTGG - Intergenic
933150462 2:78909110-78909132 CATTTTAAAGATGAGGTAACTGG + Intergenic
935037269 2:99390669-99390691 CCTTCATAGGAGGAGGTAACAGG - Exonic
935617614 2:105102435-105102457 CACTCTGAGGAGGAGGTGGTGGG + Intergenic
935689974 2:105722276-105722298 CATTTTAAGAGGGAGGTAGAAGG - Intergenic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
937084233 2:119159900-119159922 CCATCTCAGGAGGAGGAAGCTGG - Intergenic
937431391 2:121841662-121841684 CATTCTACAGAGGAGGAAACTGG + Intergenic
938403762 2:131015830-131015852 CATTCTACAGATGAGGAAGCTGG - Intronic
942416776 2:175767680-175767702 CATTTTAAGGTGGAGCTAGGTGG - Intergenic
947454693 2:230243248-230243270 TATTCTAAGTAGGATTTAGCTGG - Intronic
947578496 2:231295557-231295579 CATTCTACAGAGGAGGAAGCCGG + Intronic
948414439 2:237792083-237792105 GATGCTCAGGAGGAGATAGCTGG + Intronic
948604387 2:239125769-239125791 CATTTTCAGGAGGAGGTAGTAGG - Intronic
1169883107 20:10368603-10368625 CCTTCTAAGTAGGAGGTAAATGG - Intergenic
1170063539 20:12286100-12286122 CATTCTACGGAGGAGAAAACAGG - Intergenic
1170120151 20:12902578-12902600 CATTGAAAGGTGGAGGAAGCAGG - Intergenic
1170449931 20:16472373-16472395 CATTTTAAGGAGGAGGAAACAGG + Intronic
1172994413 20:39059440-39059462 CATTCTAAGCTGGAGGGAGGAGG - Intergenic
1175130746 20:56787698-56787720 CGTTCTAGGGAGGAGGCAGGAGG - Intergenic
1179174939 21:39001315-39001337 CTTTATAAGGAGCAGGTAACTGG - Intergenic
1183344544 22:37300020-37300042 CATTCTACGGATGAGGAAACTGG - Intronic
1184969452 22:48004840-48004862 CATTCTTAGTAGGAGCTGGCAGG + Intergenic
949749380 3:7333256-7333278 CCTGCTCAGGTGGAGGTAGCAGG - Intronic
950015125 3:9749887-9749909 CAATCCGAGGAGGAGGTAGGAGG - Intergenic
951538998 3:23764792-23764814 CATTCCATGGAGGAGGAAGTCGG - Intergenic
952753300 3:36843239-36843261 TATTGAAAGGAGGAGGTAGAGGG + Intronic
953105571 3:39875492-39875514 CATTCAAAGCAGGATGTAGAGGG - Intronic
955236377 3:57143449-57143471 CACTCTAGGGAGGCAGTAGCAGG - Intronic
958176205 3:89998949-89998971 CATTCAAAGGAGTATGTAGAGGG + Intergenic
958612885 3:96450031-96450053 CCCTCTAAGGAGGAGGCAGCAGG - Intergenic
960403168 3:117228771-117228793 CATTCTAATGAGGAGGGAGTTGG + Intergenic
961565373 3:127759947-127759969 GACTCTGAGGAGGAGGCAGCTGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966093729 3:176172775-176172797 CAGCCTAGGGAGGTGGTAGCGGG + Intergenic
968887024 4:3340530-3340552 CAGCCTAAGCAGGAGGGAGCGGG + Intronic
968947691 4:3674286-3674308 CATTCTAGGGAGGAGATAGCCGG - Intergenic
969925704 4:10583920-10583942 TATTCTAAGGGGGTGGTACCTGG - Intronic
970372138 4:15418554-15418576 CACTCTAAGGATGAGATACCTGG - Intronic
972706339 4:41547312-41547334 GAGGCTAAGGAGGAGGTAACAGG - Intronic
975280202 4:72553351-72553373 CATTCTTAAGAGCAGGAAGCAGG + Intronic
980278957 4:130693251-130693273 CATTCTAAGGAATAGGTACTAGG - Intergenic
982324849 4:154119742-154119764 CATTGTATGGAGGAGAAAGCTGG + Intergenic
985285690 4:188334492-188334514 CATTCCAAGGAGAAAGTAGGAGG - Intergenic
988803502 5:34718746-34718768 CATTTTAAAGACGAGGAAGCTGG - Intronic
991153298 5:63398231-63398253 CATTCTATGGAGGAGGAGACTGG - Intergenic
992618322 5:78567661-78567683 CATTTTAAGGATGAGGAAGCAGG + Intronic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
995626069 5:114077560-114077582 CATTCTAATCAGGTGGTAGATGG + Intergenic
995633537 5:114160155-114160177 CATTCTAAGCAGTATGTAGAGGG - Intergenic
996380903 5:122861788-122861810 CATTCTAAGGAAGAGCCAGTAGG + Intronic
999455024 5:151708097-151708119 CATTCTAAGAAGGAGAAAACTGG - Intergenic
1000116107 5:158154822-158154844 TATTCAAAGGAGCAGATAGCTGG + Intergenic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1001867318 5:175116842-175116864 CATTTGAGGGAGGAGGTAGGTGG + Intergenic
1001933336 5:175688125-175688147 CTTTCTAACAAGGAGGTAGAGGG - Intergenic
1004100029 6:12600050-12600072 CATTCTAAGGCTGAGGTGTCTGG + Intergenic
1006997305 6:38273435-38273457 CATTCCAGGGAGGATGGAGCAGG + Intronic
1008459534 6:51752126-51752148 CATTCTAAGGTTGAGGAAGATGG - Intronic
1009644396 6:66378580-66378602 CATGCTCTGGTGGAGGTAGCAGG - Intergenic
1010047962 6:71469660-71469682 TATTCTAAGGAACAGGTAGCAGG - Intergenic
1013901180 6:115157560-115157582 CATTCTAAGGAAGAAATAGGAGG - Intergenic
1015798882 6:137041131-137041153 TATTCTAAGGAAGAGGTAACTGG + Intronic
1017064978 6:150520084-150520106 CACTCTAAGCAGGAGGAAGGAGG + Intergenic
1018940564 6:168307021-168307043 CATTTTAAAGAGGCGGTTGCAGG - Exonic
1019820738 7:3240961-3240983 CGTTCAAAGGAGGAAGGAGCGGG - Intergenic
1020362741 7:7347242-7347264 CATTCAAAGGAGGCTGTAACAGG - Intergenic
1021304044 7:19009842-19009864 TGTTCTGAGAAGGAGGTAGCTGG - Intergenic
1021629337 7:22629115-22629137 CCTTCTAAGAAGGAGGTAAAAGG + Intronic
1021998376 7:26201731-26201753 CATCCGAAGGGGGAGGGAGCCGG - Intronic
1023299923 7:38759085-38759107 AAATCTAAGGAGGTGGTAGTGGG + Intronic
1024367251 7:48535394-48535416 CCTGCTCAGGTGGAGGTAGCAGG + Intronic
1024866769 7:53912133-53912155 CCTTCTAAGAAGGAGGTAAAGGG - Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1025007665 7:55366576-55366598 ACTTCTGAGGAGCAGGTAGCCGG - Intronic
1028347192 7:89797915-89797937 CATTCTAAGGGGCAGGTATCAGG + Intergenic
1032472442 7:132188419-132188441 TTCTTTAAGGAGGAGGTAGCTGG - Intronic
1035100500 7:156392333-156392355 CATTCCAGGGAGGAGGAAGCTGG + Intergenic
1035459892 7:159032134-159032156 CCTTCTCAGGAGGGGGCAGCTGG + Intronic
1037993172 8:23335162-23335184 CATTGTAAGGAGGCCGTGGCAGG + Intronic
1040854300 8:51932802-51932824 CTTTCTAGGGAGGAGGTAAGAGG - Intergenic
1041111437 8:54486585-54486607 CATGCAAAGATGGAGGTAGCAGG + Intergenic
1043476704 8:80612036-80612058 CCTTCTAGGGTGGAGGTAGGGGG + Intergenic
1044502999 8:92983390-92983412 CATTCTACTGAGGAGTCAGCAGG - Intronic
1045060729 8:98408656-98408678 CATTTTAAGGAGGATGTGTCAGG - Intronic
1048525121 8:135195633-135195655 CCTTCTATGTGGGAGGTAGCAGG - Intergenic
1049399833 8:142420069-142420091 CATTCTGTGGGGGAGGAAGCTGG - Intergenic
1052003833 9:23322406-23322428 CATTCTATGGAGGATGAAGCAGG - Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1055862182 9:80764977-80764999 CAGGTTAAGGAGTAGGTAGCAGG - Intergenic
1057796660 9:98162563-98162585 CATACAAAGGGAGAGGTAGCTGG - Intronic
1059912966 9:119066569-119066591 CATTCAAAGGAGTGGGTAGAGGG - Intergenic
1061506740 9:131035929-131035951 CATTCTATGGGGGTGGTAACAGG + Intronic
1061998580 9:134204095-134204117 CAGTCTATGGAGGAGGCAGGTGG - Intergenic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1190746981 X:53329933-53329955 CAGTCTAATGAGGAGGCAGGAGG - Intergenic
1194039424 X:88921444-88921466 CATTCTGAGCAGGATGGAGCAGG + Intergenic
1195293337 X:103450151-103450173 CATTCTACAGAGGGGGAAGCTGG - Intergenic
1196948480 X:120851887-120851909 CATTCTAAGGAAAAGGAAACAGG + Intergenic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1197184456 X:123570775-123570797 CGTACTATGGTGGAGGTAGCAGG - Intergenic
1198641762 X:138763910-138763932 CTTTCTAAGGAGCAGCCAGCTGG - Intronic
1198653312 X:138887569-138887591 CATTCTAGTGGGGAAGTAGCGGG - Intronic