ID: 1166898174

View in Genome Browser
Species Human (GRCh38)
Location 19:46036940-46036962
Sequence CAGGATGAACAGCTGCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166898167_1166898174 25 Left 1166898167 19:46036892-46036914 CCAGCTGAGAAGAGGAGCCACCC No data
Right 1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG No data
1166898172_1166898174 4 Left 1166898172 19:46036913-46036935 CCTCTCTGCTGAGAGCTGGGAAG No data
Right 1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG No data
1166898171_1166898174 5 Left 1166898171 19:46036912-46036934 CCCTCTCTGCTGAGAGCTGGGAA No data
Right 1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG No data
1166898168_1166898174 8 Left 1166898168 19:46036909-46036931 CCACCCTCTCTGCTGAGAGCTGG No data
Right 1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166898174 Original CRISPR CAGGATGAACAGCTGCAGAT AGG Intergenic
No off target data available for this crispr