ID: 1166898768

View in Genome Browser
Species Human (GRCh38)
Location 19:46041716-46041738
Sequence CTGTGTCACAGTGAGAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 346}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166898761_1166898768 2 Left 1166898761 19:46041691-46041713 CCTCCATTTTCCACTGGTTTCTT 0: 1
1: 1
2: 5
3: 36
4: 408
Right 1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 346
1166898759_1166898768 4 Left 1166898759 19:46041689-46041711 CCCCTCCATTTTCCACTGGTTTC 0: 1
1: 0
2: 3
3: 22
4: 331
Right 1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 346
1166898760_1166898768 3 Left 1166898760 19:46041690-46041712 CCCTCCATTTTCCACTGGTTTCT 0: 1
1: 0
2: 4
3: 37
4: 434
Right 1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 346
1166898762_1166898768 -1 Left 1166898762 19:46041694-46041716 CCATTTTCCACTGGTTTCTTCCC 0: 1
1: 6
2: 85
3: 183
4: 991
Right 1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 346
1166898763_1166898768 -8 Left 1166898763 19:46041701-46041723 CCACTGGTTTCTTCCCTGTGTCA 0: 1
1: 0
2: 0
3: 32
4: 341
Right 1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166898768 Original CRISPR CTGTGTCACAGTGAGAAGGG TGG Intronic
900331279 1:2135915-2135937 CTGTTTCACAGTGGAAGGGGAGG + Intronic
900667406 1:3824834-3824856 CAGTGGCACCGTGGGAAGGGAGG + Intronic
900667413 1:3824857-3824879 CAGTGGCACCGTGGGAAGGGCGG + Intronic
900667430 1:3824902-3824924 CAGTGGCACTGTGGGAAGGGGGG + Intronic
900667466 1:3825014-3825036 CAGTGGCACTGTGGGAAGGGGGG + Intronic
900667486 1:3825081-3825103 CAGTGGCACTGTGGGAAGGGGGG + Intronic
901872609 1:12146870-12146892 CTGTGGCAGAGTGGGAGGGGAGG + Intergenic
903561112 1:24228602-24228624 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
903967197 1:27098373-27098395 CTGGGTCAGAGTGACAGGGGAGG - Intergenic
904361518 1:29975985-29976007 CTGTGTCCCAGGGTGGAGGGTGG - Intergenic
905446631 1:38031830-38031852 CTGTGTGAATGTGAGAAGTGAGG + Intergenic
905518928 1:38582589-38582611 CTGTAGCACAGTGAGTGGGGAGG - Intergenic
905852196 1:41282751-41282773 CACTGTCACCTTGAGAAGGGCGG - Intergenic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
907317069 1:53579302-53579324 CTGTGTCAGAGAGAGAAGCATGG - Intronic
907766123 1:57412236-57412258 CTGTGTCTCAGTGAATTGGGAGG - Intronic
910105152 1:83624234-83624256 CCATGTCACACTGTGAAGGGTGG - Intergenic
910180727 1:84479615-84479637 CTGTGGCTCCGTGGGAAGGGTGG + Intronic
910200443 1:84692835-84692857 CTGTGTCTTAGGGAGTAGGGAGG - Intergenic
911017920 1:93354604-93354626 CTGTTTCAAAAAGAGAAGGGAGG + Intronic
911105641 1:94129353-94129375 ATGTGTCTGGGTGAGAAGGGAGG - Intergenic
911712694 1:101093521-101093543 CTGTGTCTCAGGGAAAAGGGAGG + Intergenic
912879691 1:113397985-113398007 CTGGCTTCCAGTGAGAAGGGTGG + Intronic
913297235 1:117334041-117334063 GTGTGTCAGAGTGAGAAAGAGGG + Intergenic
914343596 1:146779870-146779892 CAGTGCCACAGGGAGCAGGGAGG - Intergenic
914776295 1:150738853-150738875 TTGTGTCTCAGGGAAAAGGGAGG - Intronic
915527103 1:156482741-156482763 CTGTGTCACACTGAGAATGGGGG - Intronic
915720001 1:157978052-157978074 CTGTGACAAAATGAAAAGGGTGG - Intergenic
915950928 1:160189635-160189657 CTGGGGCACAGTGGGAAGGGAGG - Intergenic
916375366 1:164147950-164147972 CTGTGCCACAGGGAGAAGGCAGG + Intergenic
921054136 1:211531408-211531430 CTGTGCCTCATTGAGATGGGAGG + Intergenic
922020703 1:221701258-221701280 CTGTTTCACAGTGAGAAAACTGG + Intergenic
922153252 1:223022635-223022657 CTGTGGCACTGTGAGGAGGCTGG - Intergenic
922568682 1:226618835-226618857 CTGTCTCGCAGTCAGAGGGGTGG + Intergenic
922874059 1:228926181-228926203 CTGTGTGTGAGTGAGAAGGTAGG + Intergenic
923017430 1:230137510-230137532 GGCTGTCACAGTGACAAGGGAGG + Intronic
1062903411 10:1162924-1162946 CAATGACACAGTGAGAAGGGAGG - Intergenic
1063590927 10:7394850-7394872 CTGTGTAACAGAGGGAGGGGAGG - Intronic
1066215820 10:33286322-33286344 CTGTGTCACAGAGGGAAGGATGG + Intronic
1067350873 10:45474454-45474476 CTGTGTGGTAGAGAGAAGGGAGG - Intronic
1067455984 10:46419565-46419587 TTGTGTCACAGGCAGCAGGGGGG - Intergenic
1067631216 10:47965074-47965096 TTGTGTCACAGGCAGCAGGGGGG + Intergenic
1070073615 10:73113811-73113833 CTCAGACACAGTGAAAAGGGTGG + Intronic
1070331045 10:75417574-75417596 CTGGCTCAGAGTGAGGAGGGAGG - Intergenic
1071854242 10:89607256-89607278 CTGTGTCTCAGGGAATAGGGAGG + Intronic
1073468709 10:103709436-103709458 CTGTGTCCCAGTGAGAGGCAAGG - Intronic
1074231849 10:111545443-111545465 ATGTGTGACAGTGAGAAGGCAGG + Intergenic
1074267324 10:111917573-111917595 TTGTTCCACAGAGAGAAGGGAGG - Intergenic
1074279445 10:112037123-112037145 CTCTGACACAGTGAGGAGAGTGG - Intergenic
1074687056 10:115971167-115971189 CTGGGTCTGAGTGAGAAGTGAGG + Intergenic
1074691466 10:116008744-116008766 TTGTGTCACAGGGAATAGGGAGG - Intergenic
1075046176 10:119148248-119148270 CTTTTTCTAAGTGAGAAGGGTGG - Intronic
1075410110 10:122221477-122221499 CTCTGTCAGAGTGGGAAGGAGGG - Intronic
1075561968 10:123474537-123474559 CTCTGTCCAAGTGTGAAGGGAGG - Intergenic
1076719396 10:132386668-132386690 CTGAGTCACAGGGTGGAGGGTGG - Intergenic
1077101748 11:825587-825609 CTGTGTCACCGTGTGAGGGGAGG - Intergenic
1078605978 11:12775999-12776021 CAGGGTCACAGTGGGCAGGGAGG + Intronic
1078895479 11:15593632-15593654 GTGTGTGAGGGTGAGAAGGGTGG - Intergenic
1079146511 11:17857112-17857134 CTAGGTCACAGTGACAAAGGTGG + Intronic
1081091630 11:38875968-38875990 ACGCTTCACAGTGAGAAGGGTGG - Intergenic
1083293311 11:61701666-61701688 CTGTGTCACAGGGAAGGGGGTGG + Intronic
1084549780 11:69834425-69834447 CTCTGTCAGAGAGGGAAGGGTGG - Intergenic
1085203689 11:74717610-74717632 CAGTGTCAAAGTCAGGAGGGGGG + Intronic
1085235689 11:75013527-75013549 CTGGGGCACAGTCAGAAGGTTGG - Intronic
1086067833 11:82765176-82765198 CTCTGTCCCAGGGAGATGGGAGG + Intergenic
1086561804 11:88177007-88177029 CTGTGTGAAAGGGAGAAAGGAGG + Intergenic
1087678973 11:101196949-101196971 CTGTGTCACAGTGAACTGAGGGG - Intergenic
1088439661 11:109855706-109855728 CTGTGTCTCAGGAAGTAGGGAGG - Intergenic
1089415257 11:118283797-118283819 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
1090218211 11:124990174-124990196 TTGTGTCTCAGTGAATAGGGAGG + Intronic
1095284754 12:40395672-40395694 TTGTGTCTCAGGGAAAAGGGAGG + Intronic
1096984440 12:55746782-55746804 CTGTATCACACTGAGAAGTTTGG + Intronic
1097435526 12:59549006-59549028 CTCTGTCCCAGTGAGATGAGGGG + Intergenic
1098470931 12:70843127-70843149 CTTTGTCACACTGAGAACAGAGG + Intronic
1100927295 12:99563432-99563454 TTGTGTCTCAGGGAGTAGGGAGG + Intronic
1104304522 12:127597369-127597391 ATTTCTCACTGTGAGAAGGGAGG + Intergenic
1106413488 13:29526931-29526953 CAGGGTCACAGTCAGCAGGGAGG - Intronic
1107758886 13:43655022-43655044 CTGTGTCACAGAGTGAAGAAAGG - Intronic
1108538569 13:51413099-51413121 CTGTCCCACAGTGACAAGGAAGG - Intronic
1108558715 13:51622004-51622026 GTGTGTGAGAGAGAGAAGGGAGG + Intronic
1109478988 13:62923150-62923172 TAGTGTCACAGTGATAATGGTGG + Intergenic
1109815628 13:67579436-67579458 CTGTGTCTCAGAGAATAGGGAGG + Intergenic
1112407507 13:99134349-99134371 CTGTGTCTCAGCCAGAGGGGTGG - Intergenic
1112619186 13:101037073-101037095 CGGTGTCACAGAGGCAAGGGCGG + Intergenic
1112897847 13:104323182-104323204 CTGTGCCACTGTTAGAAGGTAGG - Intergenic
1113304435 13:109061500-109061522 CTGTGTTTCAGTGAATAGGGAGG + Intronic
1113808423 13:113123203-113123225 CGGAGACACAGTGAGATGGGAGG + Intronic
1114038445 14:18652736-18652758 CCTAGTCACAGTGAGAGGGGTGG - Intergenic
1114120174 14:19662308-19662330 CCTAGTCACAGTGAGAAGGGTGG + Intergenic
1114227889 14:20755414-20755436 CTGTGACAGGGAGAGAAGGGAGG - Intergenic
1115308238 14:31953845-31953867 TTGTGTCACAGGGAATAGGGAGG - Intergenic
1115709536 14:36035679-36035701 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
1116433591 14:44873431-44873453 CTCTGTCCCAGGGAGATGGGAGG + Intergenic
1116994070 14:51304031-51304053 ATTTTTCACAGTGAGAAGGAAGG - Intergenic
1117620074 14:57576676-57576698 GTGTGTGACAGGGGGAAGGGGGG + Intronic
1118009156 14:61591990-61592012 CTGTTTCACAGGGAGATGTGGGG - Intronic
1118560436 14:67074499-67074521 CTGTGTCTCAGAGAATAGGGAGG - Intronic
1119890568 14:78179175-78179197 CTGTGTCACAGGATAAAGGGTGG + Intergenic
1120179459 14:81328805-81328827 CTGTGAGAGAGTGAGAGGGGAGG - Intronic
1120656961 14:87201916-87201938 CTGTGTCTCAGAGAGAAGTAGGG - Intergenic
1121018738 14:90565806-90565828 CTGTGTCTCAGGGAATAGGGAGG + Intronic
1121607435 14:95251719-95251741 CAGTGTCACAGGGAGAATTGTGG + Intronic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1122170403 14:99869460-99869482 TTGTGTCTCAGGGAAAAGGGAGG - Intronic
1123141184 14:106080761-106080783 GTGTGACAGAGAGAGAAGGGAGG + Intergenic
1123170287 14:106366832-106366854 CTGTGTGAGAGAGAGAAGGAGGG + Intergenic
1123221818 14:106864732-106864754 CTGTGTGAGAGAGAGAAGGCAGG + Intergenic
1123488871 15:20764440-20764462 CTGTGTGACCCTGAGATGGGTGG - Intergenic
1124950342 15:34313029-34313051 TTGTGTCTCAGTGAATAGGGAGG - Intronic
1125368551 15:38945583-38945605 CTGTGTCTCAGTGAGTACAGTGG - Intergenic
1127855284 15:62948919-62948941 CTATGTCACAGTCTGGAGGGAGG + Intergenic
1129148990 15:73675480-73675502 CAGTGTCCCAGTGAGAGGGAAGG + Intergenic
1129371439 15:75098410-75098432 CTGTGTCACAGAGAAAGCGGTGG - Intronic
1129795603 15:78374014-78374036 CTGTGTCAACATGAGGAGGGAGG - Intergenic
1130966438 15:88700984-88701006 CTGTGCCTCAGGGAGATGGGGGG + Intergenic
1132690314 16:1179091-1179113 CTGAGTAACAGTGTGCAGGGAGG - Intronic
1132703751 16:1232377-1232399 CAGTGTCCCCGAGAGAAGGGTGG + Intergenic
1132707767 16:1254018-1254040 CAGTGTCCCCGAGAGAAGGGTGG - Intergenic
1132872757 16:2123070-2123092 CTGGTTCACAGTGGGATGGGCGG - Intronic
1133093075 16:3420165-3420187 TTGTGTCTCAGGGAAAAGGGAGG + Intronic
1133328142 16:4954821-4954843 CAGTGTGACATTGAGAATGGGGG - Intronic
1133956948 16:10452714-10452736 CTCTGTCCCAGGGAGATGGGGGG + Intronic
1134151664 16:11810167-11810189 CTGTGTCACACTGTTACGGGTGG + Intergenic
1134551844 16:15142249-15142271 CTGGTTCACAGTGGGATGGGTGG - Intergenic
1135552320 16:23408053-23408075 CTGTGGCACAGTGGGAAGGGAGG + Intronic
1136012768 16:27374883-27374905 CTGGTTCAAAGTGAGAAGTGAGG + Intergenic
1137488756 16:48913387-48913409 CTGTGTTGCAGTGTGAGGGGAGG - Intergenic
1138018729 16:53456905-53456927 CTGTCTGACAGTAAGTAGGGAGG + Intronic
1139516968 16:67458006-67458028 CTGGGTCACAGGGAGATGTGGGG - Intronic
1139587254 16:67911910-67911932 CTCTGTCACAGGCACAAGGGAGG + Intronic
1139990395 16:70935464-70935486 CAGTGCCACAGGGAGCAGGGAGG + Intronic
1140327466 16:74018773-74018795 CTGTGTGACAGTGAGAATACAGG - Intergenic
1140693633 16:77509681-77509703 CTTTGTCACAGTAAGAGGGCTGG + Intergenic
1140964843 16:79955560-79955582 GGGTGTCAGAGTGAGAAGAGTGG + Intergenic
1141946293 16:87312110-87312132 CAGGGTCACAGTGCCAAGGGTGG - Intronic
1141986771 16:87585380-87585402 CTGAGGCTCAGGGAGAAGGGTGG + Intergenic
1142960287 17:3548235-3548257 CTGTGTCACATTCAGGAGGGAGG + Intronic
1146933334 17:36793491-36793513 CTGGGTCACGGTGAAATGGGAGG + Intergenic
1147638166 17:41976578-41976600 CTGTGTCTCTGTGAGTGGGGTGG - Exonic
1148227389 17:45908463-45908485 AAGGGTCACAGTGAGAGGGGAGG + Intronic
1148810154 17:50285218-50285240 CTGCCACGCAGTGAGAAGGGAGG - Intergenic
1148839889 17:50488214-50488236 CTGTGACAAAGTGGGAAGGGGGG + Intergenic
1149445168 17:56707794-56707816 CTCTGTCACAGTCAGGAAGGGGG + Intergenic
1149583346 17:57767135-57767157 CTGTTTCTCAGTGAGATGAGTGG - Intergenic
1149698264 17:58634040-58634062 ATGGGTCACAGTGACAAGGAAGG + Intronic
1149940913 17:60864869-60864891 CTGTGTCTCAGTGATGAAGGAGG + Intronic
1151537037 17:74744942-74744964 CTGTGGGACAGGGTGAAGGGTGG + Intronic
1152262012 17:79272471-79272493 CTGTGTAACACTGAGAAGAGGGG - Intronic
1152880777 17:82813539-82813561 CTGTGGCACGGTGGCAAGGGTGG - Intronic
1153566411 18:6422703-6422725 TTGTGTCTCAGAGAGTAGGGAGG + Intergenic
1153753491 18:8257350-8257372 CTGTGTCACACTGAGAGGTTTGG + Intronic
1153784482 18:8522648-8522670 ATGTCTCACAGAGAGAAGGGGGG - Intergenic
1153784532 18:8522932-8522954 CCGTGCCACAGTGAGTAGGTGGG - Intergenic
1155194578 18:23461405-23461427 CTGTGTTACAGTGTGAAGAATGG + Intronic
1156181794 18:34613287-34613309 CTGTGTCTCAGAGAATAGGGAGG - Intronic
1157012262 18:43664835-43664857 CTGGGACAGAGTGAGATGGGGGG + Intergenic
1157446205 18:47748538-47748560 CTGTGTTCCTGTGAGAGGGGAGG + Intergenic
1157687897 18:49657467-49657489 CTTTGGGACAGTGAGGAGGGAGG + Intergenic
1157983587 18:52411252-52411274 CTCTTTCACAGTGTGAAGGCAGG - Intronic
1160582994 18:79898379-79898401 GTGTGGCACACTGAGAAGGCAGG - Intronic
1161998513 19:7729397-7729419 CCGTGTGACAGCGAGAAGGACGG - Exonic
1162786334 19:13037190-13037212 CTGTGTGTCAGGGAGAAGAGGGG + Intronic
1164407694 19:27968228-27968250 AAGTGTCACAGTGAGAAAGCAGG + Intergenic
1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG + Intronic
1167449773 19:49560301-49560323 CTTGGTCACAGTCAGAAGGGTGG - Intronic
1167592514 19:50411891-50411913 CTTTGTGACACTGAGGAGGGAGG + Intronic
1167698163 19:51026790-51026812 CTGAGACACAGGGAGAAGAGGGG - Intronic
1168016668 19:53579357-53579379 GTGTCTCACAGGGAGGAGGGCGG - Exonic
925736148 2:6965579-6965601 CTCTGTCTCAGTGGCAAGGGTGG + Intronic
926608423 2:14921154-14921176 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
927199008 2:20567068-20567090 CTGTGTGATGGTGAGCAGGGTGG - Intronic
927314569 2:21666963-21666985 TGGTGTCACACTGAGAAGTGAGG + Intergenic
927321868 2:21756497-21756519 TTTTTTCACAGTGAGCAGGGAGG - Intergenic
928088461 2:28359986-28360008 CTGGGTCACAGTTAGCAGGTGGG - Intergenic
929872913 2:45773596-45773618 CAATTACACAGTGAGAAGGGAGG - Intronic
930872088 2:56180875-56180897 CTGAGTAACAGTGAGCTGGGGGG + Intergenic
932388077 2:71357078-71357100 CTGTGTCATAGAGTGAGGGGTGG - Intronic
932818240 2:74878677-74878699 CTGTTTCCCAGGGAGAAGGATGG + Exonic
934571335 2:95374943-95374965 CTGTGTCCCAGTGTGGAGGGAGG + Intronic
934871206 2:97867765-97867787 CAGTTTCACCCTGAGAAGGGAGG - Intronic
936065135 2:109325526-109325548 CTGTGTCACTGGGGGAAGCGGGG - Intronic
936095199 2:109525971-109525993 CTGTGGCCCAGTGAGTGGGGAGG + Intergenic
937767697 2:125680521-125680543 CTGTGTAACAGTGCCAACGGTGG - Intergenic
937819168 2:126288360-126288382 CTGTGTCACTGTGGCAAGGAGGG + Intergenic
937830331 2:126413601-126413623 CTGTGTTTCAGGGAGTAGGGAGG + Intergenic
937967817 2:127527171-127527193 CTGAGTCACATGGAGACGGGTGG - Intergenic
938170549 2:129071738-129071760 CTGGGTAACTGTGAGAAGGTTGG - Intergenic
939147616 2:138434892-138434914 CTGTGTCACTGAGAGAAGCTGGG + Intergenic
940134683 2:150423012-150423034 CTGGGTCAGAGTGAGAACAGGGG + Intergenic
940184809 2:150972177-150972199 CTGTGTCTCAGGGAAGAGGGAGG + Intergenic
940723694 2:157309953-157309975 CTGTGCCAAAGTCAGGAGGGAGG + Intronic
941110257 2:161414001-161414023 CTCTGTCCCACTGAGAACGGAGG + Intergenic
941585585 2:167354280-167354302 CTGTATCACTGTGAGAGGGAAGG - Intergenic
942218301 2:173744350-173744372 CTATGTTGCAGAGAGAAGGGAGG - Intergenic
942238133 2:173932511-173932533 TTGTGTCTCAGGGAGGAGGGAGG + Intronic
942431257 2:175913921-175913943 CTCTGTCCCAGGGAGATGGGAGG + Intergenic
942716367 2:178896988-178897010 GGGTGCCACAGAGAGAAGGGTGG - Intronic
943025351 2:182621243-182621265 CTGAGTCACAGAGAGAAGGATGG - Intergenic
943703019 2:191006531-191006553 CTGTGTGACAGTGGAGAGGGAGG - Intronic
944010647 2:194970271-194970293 TTGTGTCACAGTGAATAGGGAGG - Intergenic
944490856 2:200256436-200256458 CTGTGTCACATGGAGGAGGTGGG - Intergenic
945442813 2:209900534-209900556 CTGTGTCTCAGGGAATAGGGAGG - Intronic
945805147 2:214481132-214481154 CAGAGTCACATTGAAAAGGGAGG - Intronic
946209645 2:218137348-218137370 CTGTGTCATAGAGAAAAGGATGG + Intergenic
946709974 2:222495655-222495677 CTGAGCCACAGGGAGAAGGTGGG - Intronic
948493639 2:238330730-238330752 GTGGGTCACAGTGGGATGGGGGG + Intronic
948585294 2:239015411-239015433 CTGTGTCACCGTGACAACCGTGG + Intergenic
948730499 2:239960863-239960885 CTGTTTTCCAGTGAGAATGGTGG + Exonic
948809436 2:240467187-240467209 CTGTGTCACCGTGAACAGGGAGG - Exonic
1169677119 20:8166672-8166694 CTGTGCCACTCTGTGAAGGGTGG - Intronic
1169696012 20:8387343-8387365 TTGTGTCTCAGAGAAAAGGGTGG + Intronic
1170538928 20:17368994-17369016 CTTTGTGACAGTGAGATGGATGG - Intronic
1171106189 20:22434950-22434972 CTGTGGCACAGAGAGAACTGAGG + Intergenic
1172202757 20:33138472-33138494 CTTGGTCAGAGTGAGATGGGCGG + Intergenic
1173084746 20:39904872-39904894 CTGTTGCACACTGAGATGGGAGG - Intergenic
1173882531 20:46427220-46427242 CTGTGTCTCAGGGAATAGGGAGG - Intronic
1175178821 20:57130617-57130639 CTGTGTCTCAGGGAGATGTGGGG - Intergenic
1176182074 20:63754328-63754350 CGCTGTCAGGGTGAGAAGGGTGG - Intronic
1176988843 21:15469843-15469865 CTATGTAGCACTGAGAAGGGGGG - Intergenic
1178027789 21:28487978-28488000 TGGTGCTACAGTGAGAAGGGTGG - Intergenic
1179814222 21:43893695-43893717 CTGTGTAACAGGGAATAGGGAGG + Intronic
1179913044 21:44460305-44460327 CTGAGTCACAGGGAGAGGCGGGG - Exonic
1180046531 21:45308848-45308870 CTGTGGCACCGTGGGCAGGGTGG + Intergenic
1180462570 22:15579777-15579799 CCTAGTCACAGTGAGAGGGGTGG - Intergenic
1184443933 22:44536150-44536172 CTTTGCCACAGTGACAAGGTTGG + Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184703851 22:46196667-46196689 CTGTGTCCCAGTTACAAGGGAGG + Intronic
1185196077 22:49470298-49470320 CTGTGTCCCTGTGAGAATGTGGG + Intronic
950479690 3:13236722-13236744 CTGGGACACAGAGGGAAGGGTGG + Intergenic
950553657 3:13682469-13682491 CTGCCCCACAGGGAGAAGGGTGG + Intergenic
951056348 3:18150394-18150416 CTATGTCACAGAGAGCAGGGTGG + Intronic
951096793 3:18641701-18641723 TTGTGTCTCAGTGAATAGGGAGG + Intergenic
951773261 3:26282132-26282154 TTGTGTCACCATGTGAAGGGAGG + Intergenic
954333726 3:49904134-49904156 CTGGTTCGCAGCGAGAAGGGGGG + Intronic
955633452 3:61000109-61000131 CTGAGTGAGGGTGAGAAGGGAGG + Intronic
957679238 3:83410295-83410317 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
958859070 3:99423474-99423496 CTGTGTCACATTGATAAAAGGGG + Intergenic
958963495 3:100533636-100533658 GTGTGTCTCAGTGTGAAGGGTGG - Intronic
959511189 3:107214253-107214275 TTGTGTCTCAGGGAAAAGGGAGG - Intergenic
961119413 3:124360777-124360799 CTGTGACACCGTGAGCAGGGTGG + Intronic
961153664 3:124660929-124660951 CTGAGATACAGTGAGAAGGCTGG + Intronic
961396332 3:126594125-126594147 CTGTGTCTCAGGGAATAGGGAGG + Intronic
961969640 3:130947082-130947104 CTGTGTCACAGTGACAAAACAGG - Intronic
962386375 3:134935908-134935930 CAGGGTCCCAGTGAGAAGTGAGG - Intronic
964025261 3:152065689-152065711 CTGTGGTGCAGTGAGCAGGGAGG - Intergenic
964433346 3:156627383-156627405 CTCTGTCACACTCAGCAGGGAGG + Intergenic
966106107 3:176335807-176335829 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
966219625 3:177537796-177537818 CAGTGTCACTTTGAGGAGGGTGG + Intergenic
966247182 3:177822366-177822388 CCGTATCACAGTGGAAAGGGAGG + Intergenic
967751317 3:193119326-193119348 CTGAGTTACAGAGAGAATGGGGG - Intergenic
967784529 3:193476744-193476766 TTGGGTCACAGGGAGTAGGGAGG + Intronic
971423609 4:26495431-26495453 GTGTGTCTCAGAGAGAGGGGAGG - Intergenic
971975635 4:33682729-33682751 CTGTGTTACAGGGAGGAGTGTGG + Intergenic
972768958 4:42178195-42178217 CTGTGTCTCAGGGAGTAGGGAGG + Intergenic
974722623 4:65761814-65761836 CTGTCTCACGGGGAGAAGAGTGG + Intergenic
974980402 4:68949326-68949348 CTGTGTCTCAGGGAATAGGGAGG + Intronic
975178826 4:71319803-71319825 CTGAGTCAGAGGGAGAAGGAGGG + Intronic
977672437 4:99711663-99711685 CTGAGGGACAGTGAGTAGGGTGG + Intergenic
978018713 4:103781929-103781951 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
978260530 4:106752208-106752230 TTGTGTCACAGAGAGCAGGGAGG + Intergenic
978414416 4:108460179-108460201 CCAAGTCACAGGGAGAAGGGCGG - Intergenic
979648638 4:123104394-123104416 TTGTGTCTCAGGGAGTAGGGAGG - Intronic
979846240 4:125516188-125516210 TTGTGTCACAGGGAATAGGGAGG + Intergenic
979851403 4:125574610-125574632 CAGTGGCACGGTGAGAAGAGTGG - Intergenic
979895647 4:126153154-126153176 TTGTGTCACAGGGAATAGGGAGG - Intergenic
980298990 4:130963868-130963890 CTGTGTCTCAGAGAACAGGGAGG - Intergenic
980654943 4:135769514-135769536 CTGTGTCTCAGGGAGTAGGAAGG + Intergenic
980733996 4:136859072-136859094 CTGTGGCAAAGTGAAATGGGAGG - Intergenic
981289863 4:143062037-143062059 CTGTGTCAGGGAGAGAAGGTGGG + Intergenic
982300429 4:153873074-153873096 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
982948182 4:161653327-161653349 CTCTGTCACAGGAAGAATGGTGG + Intronic
983464732 4:168073253-168073275 TTGTGTCTCAGTGAATAGGGAGG + Intergenic
983875828 4:172873503-172873525 CTGTTTCCCATTGAGAAGTGGGG - Intronic
983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG + Intergenic
985330480 4:188826404-188826426 CTGTGTCACAGTGAATTGGGAGG - Intergenic
986008460 5:3688068-3688090 CTGTGTGACAGTGAGAGTTGGGG + Intergenic
986222047 5:5776635-5776657 CTGTCTCACCCTGAGCAGGGAGG + Intergenic
986399156 5:7362688-7362710 CTGTGTCACAGTGAAGTAGGTGG - Intergenic
990003024 5:50917220-50917242 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
993279034 5:85901203-85901225 GTGTGTCATAGTCAGAAGAGTGG - Intergenic
995431249 5:112080339-112080361 CTGTGTCTCAGAGAATAGGGAGG - Intergenic
995834007 5:116382568-116382590 CTGTGTGTAAGAGAGAAGGGAGG - Intronic
996067321 5:119093527-119093549 TTGTGTCTCAGTGAATAGGGAGG - Intronic
997807949 5:136938280-136938302 CTGAGTCATATTGGGAAGGGTGG + Intergenic
997887516 5:137643834-137643856 CTGTGTTACAGTTAGAGAGGAGG - Intronic
998097087 5:139402114-139402136 GTGTGTCCCTCTGAGAAGGGGGG - Intronic
999327991 5:150655336-150655358 CAGTGTCACCCTGAGCAGGGAGG - Intronic
1001910555 5:175513932-175513954 CTGGGGCACAGTGGGAGGGGTGG + Intronic
1003936136 6:10976957-10976979 CTCTGTCACAGGAAGAAGGTTGG - Intronic
1006580996 6:35078034-35078056 CCTTGTCCCAGGGAGAAGGGTGG - Intronic
1007253216 6:40510580-40510602 CTGAGGCACAGTGAGGAGTGGGG + Intronic
1007424773 6:41739856-41739878 CTGGGGCACAGTGAGCAGAGAGG + Exonic
1008271069 6:49490756-49490778 TTGTGTCACAGGGAATAGGGAGG + Intronic
1009338891 6:62529221-62529243 CTCTGTCACAATGGGAATGGAGG + Intergenic
1009487088 6:64238292-64238314 CTGTTTCACAGTATGAAGGGTGG + Intronic
1009977218 6:70683999-70684021 CTTGTGCACAGTGAGAAGGGAGG + Intronic
1011823389 6:91278588-91278610 CTGAGTAACAGGGAGAAGAGAGG - Intergenic
1012023872 6:93962955-93962977 GTGTGTGTCAGTGAGGAGGGTGG - Intergenic
1012472345 6:99586519-99586541 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
1015500800 6:133931206-133931228 CTCTGTCTCAGGGAGATGGGAGG - Intergenic
1015545134 6:134354211-134354233 TTGTGTCACAGTGAGAAACCTGG + Intergenic
1015648285 6:135421019-135421041 CTGTGTCTCAGAGAATAGGGAGG + Intronic
1017213141 6:151879217-151879239 CTGTCTCACAGCGGGAAGGGAGG + Intronic
1017967269 6:159277209-159277231 CTGTGTGGCTGGGAGAAGGGAGG + Intergenic
1019175564 6:170157665-170157687 CTGGGTCACAGAGAGATGGCGGG + Intergenic
1019175572 6:170157705-170157727 CTGGGTCACAGAGAGATGGCGGG + Intergenic
1019175581 6:170157746-170157768 CTGGGTCACAGAGAGACGGCGGG + Intergenic
1019175589 6:170157787-170157809 CTGGGTCACAGAGAGATGGCGGG + Intergenic
1019175609 6:170157870-170157892 CTGGGTCACAGAGAGATGGTGGG + Intergenic
1019175646 6:170158078-170158100 CTGGGTCACAGAGAGATGGCGGG + Intergenic
1019175672 6:170158203-170158225 CTGGGTCACAGAGAGATGGTGGG + Intergenic
1020411556 7:7897196-7897218 CTGTGTCACCCTGTGAAGTGTGG - Intronic
1020765054 7:12308938-12308960 CTGTGTCTCAGGGAAGAGGGAGG + Intergenic
1021015575 7:15527032-15527054 CTGTGTCTCAGGGAACAGGGAGG - Intronic
1021824825 7:24539183-24539205 CTGAGGCTCAGTGAGTAGGGTGG - Intergenic
1022732889 7:33047335-33047357 ATGTGGCACAGTAAGAAGGAAGG - Intronic
1023253091 7:38286008-38286030 CTGTGTCCCAAGGAGAAGGCAGG + Intergenic
1026934025 7:74241656-74241678 CTGTGTCAGAAAGAGAAGGATGG + Intronic
1027325239 7:77044130-77044152 CTGTCTCACAGTCTGAAGTGTGG - Intergenic
1028134625 7:87212330-87212352 CAGTGTCCCTGTGAGAATGGTGG - Intronic
1028368712 7:90066079-90066101 CAGTGTAACAGTGAGAAATGAGG + Intergenic
1028408614 7:90503605-90503627 CTGTGTCTCACTGAAGAGGGAGG + Intronic
1030334432 7:108309231-108309253 CTATGTCACAATGAAGAGGGAGG + Intronic
1030495019 7:110288056-110288078 TTGTGTCCCAGTGAATAGGGAGG + Intergenic
1030988605 7:116272214-116272236 ATGAGTCACAGTGTGGAGGGAGG + Intergenic
1033768045 7:144516340-144516362 CTCTGTCACAGTCATAAGGAAGG + Intronic
1034339453 7:150342136-150342158 CTGAGCCACACTGAGAAGGAAGG + Intergenic
1034855455 7:154541912-154541934 CTGTGTCCCAGGGAGAAGGAAGG + Intronic
1034984336 7:155498010-155498032 CTGTGTCAAGGTCAGAAGAGAGG - Intronic
1036108070 8:5863642-5863664 CTGTGTCTCAGGGACTAGGGAGG + Intergenic
1037816678 8:22116235-22116257 CTGTGGCACAGGGAGGTGGGAGG + Intronic
1038424606 8:27456529-27456551 TTGTGTCCCAGGGAAAAGGGAGG - Intronic
1038442912 8:27584300-27584322 GTTTATCATAGTGAGAAGGGAGG - Intergenic
1039937286 8:42056688-42056710 CAGATTCCCAGTGAGAAGGGAGG - Intergenic
1040704702 8:50111475-50111497 TGAGGTCACAGTGAGAAGGGAGG + Intronic
1041055405 8:53980682-53980704 TTGTGTCTCAGGGAGTAGGGAGG - Intronic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1042419418 8:68568004-68568026 CTGTGTCTCAGGGAATAGGGAGG + Intronic
1045465601 8:102466847-102466869 CTTTGTCTCAGTGAATAGGGAGG + Intergenic
1047680677 8:127251310-127251332 CTTTGTGAAACTGAGAAGGGAGG - Intergenic
1048054240 8:130848229-130848251 CTGTGCCTCAGTGAGTAGTGTGG - Intronic
1048914072 8:139165293-139165315 CTGTGTCCCAGGGAAATGGGGGG + Intergenic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1050128160 9:2381061-2381083 CTGTGTGTAACTGAGAAGGGTGG - Intergenic
1051613576 9:18985093-18985115 CTGTGTCTCAATGAATAGGGAGG + Intronic
1053217757 9:36286831-36286853 TTGTGTCTCAGGGAGTAGGGAGG + Intronic
1053544021 9:39003991-39004013 GTGTGGCACAGTGAGCAGAGTGG - Intergenic
1053808454 9:41827488-41827510 GTGTGGCACAGTGAGCAGAGTGG - Intergenic
1054622138 9:67359940-67359962 GTGTGGCACAGTGAGCAGAGTGG + Intergenic
1056277914 9:85011324-85011346 CTGTGCCAGAATCAGAAGGGAGG + Intronic
1056899220 9:90582994-90583016 CTGTTTCACAGAGAGTATGGGGG - Intergenic
1057538994 9:95946981-95947003 CTGTGTCTCAGGGAAGAGGGAGG - Intronic
1058356382 9:104088392-104088414 GTATGTCACAATGAGAATGGAGG + Intergenic
1059668328 9:116470533-116470555 CACTGTCTCATTGAGAAGGGTGG + Intronic
1059720912 9:116959404-116959426 GAGTGTCACACTGAGAAGTGTGG + Intronic
1059950796 9:119460663-119460685 CTGTGTCACAGAAAGAATGCTGG + Intergenic
1060215041 9:121733805-121733827 GTGTGTGACTGTGAGAAAGGCGG + Intronic
1060679443 9:125548283-125548305 CTGTGTGACAGTCACAAAGGTGG + Intronic
1060691957 9:125669604-125669626 CTGTGACCCAGAGTGAAGGGTGG + Intronic
1060818241 9:126646760-126646782 CTGTGTCTCAGTGAAAGGGCAGG - Intronic
1060900561 9:127253814-127253836 CTGTTTAACAGGAAGAAGGGAGG + Intronic
1061396855 9:130348233-130348255 TGGTGTCACAGTGACCAGGGAGG - Intronic
1061411860 9:130426108-130426130 CTGTGTCCCTGTGAGGAGTGGGG - Intronic
1061445627 9:130635686-130635708 CTGTGACAGACAGAGAAGGGGGG - Intronic
1186256011 X:7720660-7720682 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
1186484888 X:9926405-9926427 ATGTGTCGCAGTGAGAATGCAGG + Intronic
1187172196 X:16862954-16862976 CATTGTGACAGTGACAAGGGTGG - Exonic
1187516618 X:19977131-19977153 TTGTGTCTCAGGGAGTAGGGAGG - Intergenic
1192974310 X:76267242-76267264 CTCTGTCCCAGGGAGAGGGGGGG + Intergenic
1193085066 X:77441644-77441666 CTGTGTAACAGTGAGAGTTGTGG - Intergenic
1195698817 X:107686480-107686502 CTGTTTCACAGTTTGAAGGTGGG + Intergenic
1198072198 X:133159872-133159894 CTTTGTCCCAGGGAGATGGGAGG - Intergenic
1199916840 X:152351873-152351895 CTGTATCTCAGGGAGAAGGAAGG + Intronic
1200020245 X:153197879-153197901 TTGTGTCTCAGGGAGTAGGGAGG - Intergenic
1200053298 X:153445902-153445924 CTGTGTGCCAGGGACAAGGGTGG - Intronic
1202149609 Y:21832858-21832880 CTGTGTCCCACTGAGAAGACAGG - Intergenic
1202344578 Y:23908027-23908049 CTGTGAGACACTGAGAGGGGAGG + Intergenic
1202526190 Y:25762056-25762078 CTGTGAGACACTGAGAGGGGAGG - Intergenic