ID: 1166903047

View in Genome Browser
Species Human (GRCh38)
Location 19:46081125-46081147
Sequence CCCTGACCTTTGGTGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166903047_1166903054 14 Left 1166903047 19:46081125-46081147 CCAGGCCACACCAAAGGTCAGGG No data
Right 1166903054 19:46081162-46081184 TAACGCTTATTTCAGGTGTGAGG No data
1166903047_1166903056 27 Left 1166903047 19:46081125-46081147 CCAGGCCACACCAAAGGTCAGGG No data
Right 1166903056 19:46081175-46081197 AGGTGTGAGGGAGCATGTGAAGG No data
1166903047_1166903055 15 Left 1166903047 19:46081125-46081147 CCAGGCCACACCAAAGGTCAGGG No data
Right 1166903055 19:46081163-46081185 AACGCTTATTTCAGGTGTGAGGG No data
1166903047_1166903053 7 Left 1166903047 19:46081125-46081147 CCAGGCCACACCAAAGGTCAGGG No data
Right 1166903053 19:46081155-46081177 AGATACATAACGCTTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166903047 Original CRISPR CCCTGACCTTTGGTGTGGCC TGG (reversed) Intergenic
No off target data available for this crispr