ID: 1166903594

View in Genome Browser
Species Human (GRCh38)
Location 19:46087064-46087086
Sequence GCATCAGTGTTAGCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166903591_1166903594 -4 Left 1166903591 19:46087045-46087067 CCCAGGGTGGCATACACTGGCAT No data
Right 1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG No data
1166903592_1166903594 -5 Left 1166903592 19:46087046-46087068 CCAGGGTGGCATACACTGGCATC No data
Right 1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG No data
1166903590_1166903594 -3 Left 1166903590 19:46087044-46087066 CCCCAGGGTGGCATACACTGGCA No data
Right 1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG No data
1166903587_1166903594 9 Left 1166903587 19:46087032-46087054 CCTGTCTTTGGGCCCCAGGGTGG No data
Right 1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166903594 Original CRISPR GCATCAGTGTTAGCAGGTCC AGG Intergenic
No off target data available for this crispr