ID: 1166905772 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:46107423-46107445 |
| Sequence | GGGTCCGCACAGATGGGACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166905763_1166905772 | 30 | Left | 1166905763 | 19:46107370-46107392 | CCAGGGGCTCTGGGAGTGGCTGC | 0: 499 1: 274 2: 95 3: 106 4: 556 |
||
| Right | 1166905772 | 19:46107423-46107445 | GGGTCCGCACAGATGGGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166905772 | Original CRISPR | GGGTCCGCACAGATGGGACA TGG | Intergenic | ||
| No off target data available for this crispr | |||||