ID: 1166905772

View in Genome Browser
Species Human (GRCh38)
Location 19:46107423-46107445
Sequence GGGTCCGCACAGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166905763_1166905772 30 Left 1166905763 19:46107370-46107392 CCAGGGGCTCTGGGAGTGGCTGC 0: 499
1: 274
2: 95
3: 106
4: 556
Right 1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166905772 Original CRISPR GGGTCCGCACAGATGGGACA TGG Intergenic
No off target data available for this crispr