ID: 1166921059

View in Genome Browser
Species Human (GRCh38)
Location 19:46229534-46229556
Sequence CATAGCACAGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166921047_1166921059 18 Left 1166921047 19:46229493-46229515 CCTATTTTCCAGAGGACTCAGTG No data
Right 1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 334
1166921046_1166921059 22 Left 1166921046 19:46229489-46229511 CCTTCCTATTTTCCAGAGGACTC No data
Right 1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 334
1166921044_1166921059 28 Left 1166921044 19:46229483-46229505 CCTGAACCTTCCTATTTTCCAGA No data
Right 1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 334
1166921052_1166921059 10 Left 1166921052 19:46229501-46229523 CCAGAGGACTCAGTGTGGGGGAC No data
Right 1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166921059 Original CRISPR CATAGCACAGAGAAGGTGGA GGG Intergenic
900397243 1:2458136-2458158 GACAGCACAGGGAAGGTGGCCGG + Intronic
901239066 1:7682440-7682462 GTTAGCACAGAGAGCGTGGACGG - Intronic
901470596 1:9453861-9453883 CACAGCCCAGAGATGGAGGAGGG + Intergenic
901516367 1:9749456-9749478 CTTACCACAGAGCCGGTGGAGGG + Exonic
901662544 1:10807628-10807650 CATAGCAAAGAGAACATGGAAGG - Intergenic
902263320 1:15243593-15243615 AACAGCCCAGAGAAGGTGGCTGG + Intergenic
902645021 1:17791931-17791953 GATAGCAAAGAGATGGTGGCAGG - Intronic
904277710 1:29395058-29395080 CATCTCACAGGGAAGGTGGGAGG - Intergenic
905345253 1:37306911-37306933 CCTAGCACAGACCTGGTGGAGGG - Intergenic
907504328 1:54906816-54906838 AAGAGCACAGAGAAGGGAGATGG - Intergenic
909036968 1:70604404-70604426 CAGGGCACAGGGATGGTGGAGGG - Intergenic
909499407 1:76317226-76317248 CATGGCACAGACATGGTGGTAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
920078622 1:203355394-203355416 GATAACTCAGGGAAGGTGGAGGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
922464608 1:225838622-225838644 CAGAGCACAGTCAGGGTGGAGGG - Intronic
922563745 1:226587715-226587737 CCCAGCAGAGAGAAGGTGTATGG - Intronic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064428611 10:15252360-15252382 CAGAGTTCAGTGAAGGTGGATGG - Intronic
1064701095 10:18023018-18023040 CTTAGCACTGAGAAGGGGCATGG - Intronic
1068238103 10:54264441-54264463 CATAGAACTCAGAAGATGGATGG + Intronic
1069750331 10:70741248-70741270 CATACACCAGTGAAGGTGGAGGG + Intronic
1069825019 10:71249678-71249700 CAAAGCACAGAGCAGGTAGAAGG + Intronic
1070253389 10:74792841-74792863 AATAGTACAAAGAAGGTTGAGGG + Intergenic
1070415857 10:76188614-76188636 CATACAACTGAGAAGATGGAGGG + Intronic
1071233253 10:83613840-83613862 CATATGGCAGAAAAGGTGGAAGG - Intergenic
1071521354 10:86333016-86333038 GATAGCAGAGAGGAGCTGGAAGG - Intronic
1072224405 10:93355127-93355149 CATATCACATATAAGGTGAAGGG - Intronic
1073400547 10:103253405-103253427 AATAGCACAAAGAAGGAGAAAGG - Intergenic
1073499684 10:103925146-103925168 AATAGCACAAAGAAGGTGGGAGG - Intergenic
1073667474 10:105550049-105550071 AACAGCACAAAGAAGGTGGATGG + Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074870329 10:117571043-117571065 CAGAGCACAGAGAAGCTTGTGGG - Intergenic
1075153078 10:119952702-119952724 CATATCACTGAGGAGTTGGATGG + Intergenic
1075467735 10:122664181-122664203 CATCCCACAAAGAATGTGGATGG - Intergenic
1075499896 10:122963771-122963793 AATGGCACAGATAAGATGGAAGG + Intronic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1076578872 10:131493564-131493586 GTTAACACAGAGAAGGTGGCTGG + Intergenic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1076843714 10:133058836-133058858 CAAAACACAGAAAAGGTGCATGG - Intergenic
1078100649 11:8328612-8328634 CAAAGCACTGAGAATGTGGATGG - Intergenic
1079608781 11:22404487-22404509 CATTGATCAGAGAAGGTGAAAGG - Intergenic
1079671899 11:23181169-23181191 AATAGCTCTGAGAAGGTGGAGGG + Intergenic
1080075126 11:28139570-28139592 CATGGCACAGACAAGGTCTAGGG - Intronic
1081679922 11:44994918-44994940 CCTAGCATTGAGAAGGTTGAGGG + Intergenic
1083139833 11:60712852-60712874 CATTTCATAGTGAAGGTGGATGG - Intronic
1083777050 11:64899204-64899226 CATAGAATAGAGAAGGGGTAGGG - Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1085228374 11:74943116-74943138 CATAGCAGATAGAGGATGGAAGG - Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085789325 11:79483378-79483400 CTTACCACAAAGAAGGAGGAAGG + Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1087868123 11:103258634-103258656 CACAGCACTGAGTAGATGGATGG + Intronic
1089789315 11:120931209-120931231 CACAGGTCAGAGCAGGTGGAGGG + Intronic
1089880750 11:121771115-121771137 CATAAGACAGAGAAGGTCAAGGG - Intergenic
1090022674 11:123141524-123141546 CACAGCACAAGGAAGGAGGAAGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094194811 12:27737221-27737243 CTTAGCACTGAGATGGTGAAGGG + Intronic
1094371474 12:29742928-29742950 CACAGCAAAGAAAAGGTGAATGG + Intronic
1095614456 12:44171869-44171891 CCAAGCAGAGAGAAAGTGGAGGG + Intronic
1095909415 12:47410841-47410863 AAAAGCACAGAGAGGGTGTATGG - Intergenic
1096950885 12:55469784-55469806 CATAGGACAGAGCAGCTAGAAGG + Exonic
1098326211 12:69305108-69305130 CACAGCACAAAGGAGGTGGATGG - Intergenic
1101010155 12:100441146-100441168 GAGAGCACAGAGAAGGTAGGAGG - Intergenic
1101765169 12:107691278-107691300 TGAAGCACAGAGAAGGTGGATGG + Intronic
1101820866 12:108183472-108183494 CGTACCACAGAGAAGGTGCCAGG - Intronic
1102467178 12:113136608-113136630 CAAAGCACAGAGAGGTTGAATGG - Intergenic
1102548016 12:113670541-113670563 CAAAGCTCAAAGAAGGTAGAAGG + Intergenic
1104076829 12:125397258-125397280 CATAGAACAGTGAAGTTGGCTGG - Intronic
1107067838 13:36235063-36235085 AACAGCACAAAGAAGGTGAAGGG + Intronic
1107594285 13:41946509-41946531 AATAGCACTGAGGAGCTGGAAGG + Intronic
1108092099 13:46859633-46859655 CATGGCCCAGAGCAGGAGGAAGG - Intronic
1108745342 13:53387782-53387804 CACAGTACAGAGATGTTGGATGG + Intergenic
1108945390 13:56016942-56016964 CAGAGCACAGAGAATTTGTAGGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1111078247 13:83266750-83266772 AACAGCACAAAGAAGGTGGTGGG - Intergenic
1111145473 13:84173433-84173455 GATAGCAGAGAGACTGTGGATGG - Intergenic
1112414279 13:99191503-99191525 CATTGCACAGAGCAGCTGCAAGG + Intergenic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1116021943 14:39471870-39471892 CAGAGCACAGAGGATCTGGAGGG - Intergenic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1121748044 14:96318206-96318228 CAAAGAACAGAAAAGGAGGACGG + Intronic
1121811434 14:96894537-96894559 CACAGAACAGAGAAGCTGGAGGG - Intronic
1122753820 14:103961183-103961205 CATAGCACTGAGAAGAGGAATGG + Intronic
1202829411 14_GL000009v2_random:10366-10388 CATAGCACAGAGAATTTTTAGGG - Intergenic
1123866350 15:24523278-24523300 CAAAGGACTGAGAATGTGGAGGG + Intergenic
1124263689 15:28214624-28214646 CAGGGCACAGGGAAGGTAGACGG + Intronic
1124835648 15:33194256-33194278 CTTGGCACAGGAAAGGTGGAGGG - Intronic
1125274571 15:37977597-37977619 CAAAGCACAGAGATGGAGCATGG - Intergenic
1125303900 15:38288481-38288503 AATAGTGGAGAGAAGGTGGATGG + Intronic
1125802445 15:42462194-42462216 CATAGCACAGTGTAGTTGCATGG + Intronic
1126379681 15:48033462-48033484 CAGAGCACAGAGGAGTTGTAGGG + Intergenic
1128233207 15:66049693-66049715 CAGAGCAGAGAGAGGGTGTAAGG - Intronic
1129377423 15:75142755-75142777 CATGGCATAGAGAAGGTATAGGG - Intergenic
1130133208 15:81160740-81160762 CACAGCACAGAGACGATGCAGGG - Intronic
1130443240 15:83976094-83976116 TATAGGACAGAGACGGTGGTGGG + Intronic
1130731961 15:86504690-86504712 AATAGCACAAAGAAAGGGGAAGG - Intronic
1130899142 15:88193761-88193783 CATAGCAGAGAGACAGTTGAGGG - Intronic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132007280 15:98239757-98239779 CAGAGAACAGAGAATGTTGAGGG + Intergenic
1132157714 15:99508117-99508139 CAAAGTACAGAGAAGATTGATGG - Intergenic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133164438 16:3936454-3936476 CCTAACTCAGAGAGGGTGGAAGG - Intergenic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1134303544 16:13012472-13012494 CATAGCACAGGGACTGGGGAGGG + Intronic
1134336035 16:13300444-13300466 CATATCACAGAGTAGGTCGAGGG - Intergenic
1134926219 16:18162643-18162665 CAAAGCAACGAGAAGGTGGTTGG + Intergenic
1135060608 16:19268360-19268382 CACAGGACATAGAAGGTGGGAGG + Intergenic
1136004904 16:27322729-27322751 ATTAGAAGAGAGAAGGTGGATGG - Intronic
1137019747 16:35413828-35413850 CTTAGCACAGACAATGTGCAAGG + Intergenic
1137246418 16:46709538-46709560 CATAGCTCAAAGAAAATGGAAGG - Exonic
1138541702 16:57691542-57691564 CAAAGCCCAGAGCAGATGGATGG + Intergenic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142800815 17:2344375-2344397 TACAACACAGAGAAGGTGAATGG - Intronic
1144124977 17:12194864-12194886 GACAGCATGGAGAAGGTGGATGG - Intergenic
1144174014 17:12687049-12687071 AATAGCACACCGAAGTTGGAAGG + Intronic
1144469998 17:15530428-15530450 AATAGCACAAAGGAGGAGGAAGG - Intronic
1144752676 17:17660541-17660563 CAGAGCACAGAGAAATTGCAAGG + Intergenic
1144926346 17:18813223-18813245 AATAGCACAAAGGAGGAGGAAGG + Intergenic
1145921697 17:28614570-28614592 CTTAGCACAGAGACTGGGGAGGG + Exonic
1147261678 17:39212654-39212676 CCCATCACAGAGGAGGTGGAGGG + Intronic
1147751703 17:42739285-42739307 AATACCTCAGAGAAGTTGGAGGG - Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1149433804 17:56616779-56616801 CAAAGCACAGGGAAGGAGCAAGG - Intergenic
1150444741 17:65220249-65220271 CAAAGAACAGAGAAGATAGATGG - Intronic
1150592759 17:66577957-66577979 CATGGCACAGAGCAGGTGTGCGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1153424439 18:4946287-4946309 CAAAGCACTGAGAAGGAGCATGG + Intergenic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156571687 18:38262732-38262754 CAAATCACACAGAAGGTGGCAGG - Intergenic
1156637279 18:39046930-39046952 AATAGCACAGAGAAGATAAAAGG + Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1158291526 18:55950342-55950364 CATATCCCAGAGATGCTGGAAGG + Intergenic
1158866878 18:61646491-61646513 GCTAGCCCAGTGAAGGTGGAGGG + Intergenic
1159141424 18:64399942-64399964 CTTAGCACGCAGAAGGTTGAGGG + Intergenic
1159148009 18:64480222-64480244 CCTAGAACACAGAAAGTGGATGG + Intergenic
1159686487 18:71427682-71427704 CACAGAAGAGAGAAGCTGGAAGG + Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1161584332 19:5096891-5096913 AATAGCTCAGAGAAGGCTGAGGG + Intronic
1161688008 19:5713126-5713148 CATGGGACACAGAAGGTGGGTGG - Exonic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162915107 19:13870500-13870522 CATAGCACCAGGAAGGTGCAGGG - Intronic
1163465799 19:17467960-17467982 CAGAGCACAAGAAAGGTGGAGGG + Intergenic
1164963797 19:32461383-32461405 CATAGCCCAGCCAAGCTGGAAGG - Intronic
1166008061 19:39920664-39920686 CACAGCTCAGAGAATGTGTAAGG - Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167672007 19:50858949-50858971 CACAACACAGAAAAGCTGGAGGG + Intronic
1167768228 19:51498214-51498236 GACAGCACAGACAAGGTGCAGGG + Exonic
1168697888 19:58415756-58415778 CATAAGACAGGAAAGGTGGAAGG - Intronic
1202643282 1_KI270706v1_random:117416-117438 CATAGCACAGAGAATTTTTAGGG + Intergenic
925827919 2:7868508-7868530 CAGAGCTCAGAGAAGCTGAAGGG - Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926254016 2:11174356-11174378 GTTAGCACAGAGACAGTGGAAGG + Intronic
926925168 2:17980116-17980138 CATAGCCCTGAGAAGGATGATGG - Intronic
928435235 2:31250684-31250706 CATGGCACAGAGAGGGTAGTGGG - Intronic
928534544 2:32227372-32227394 CAAGGAACAGAGGAGGTGGAAGG - Intronic
928865139 2:35908294-35908316 GACAGCTCAGATAAGGTGGATGG - Intergenic
929055963 2:37876006-37876028 CCTAGCACAGAGTAGGTGCTTGG - Intergenic
931199149 2:60080352-60080374 CATAGCACACAAAAGGAGTAAGG + Intergenic
933021849 2:77204191-77204213 CATAGCACTGAGTAGCTGGGTGG + Intronic
933254170 2:80061580-80061602 CATAGCACAGAGAATGACCATGG - Intronic
934965850 2:98721500-98721522 AATAGCACAGAGGAGGTAGGTGG + Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
937065010 2:119011348-119011370 CATGGCACACAGAAGGTGCTTGG + Intergenic
937139014 2:119582323-119582345 CATAGCATATACAAGATGGAGGG + Intronic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
939581792 2:143958650-143958672 CATAGCACAAAGAAGGTTAAAGG - Intronic
942634228 2:177985044-177985066 GATAGCTGAGAGAAGTTGGAAGG - Intronic
943584266 2:189719379-189719401 CATACCAAAGACAAGATGGAAGG + Intronic
943638458 2:190332680-190332702 CAGAGCACAAAGACAGTGGAAGG + Intronic
945202720 2:207299276-207299298 AATGGCACAAAGAAGGTAGATGG + Intergenic
946023830 2:216659975-216659997 CAAAGGAGTGAGAAGGTGGAAGG - Intronic
946107046 2:217380053-217380075 CAAAGGACAGAGCAGGTGGTAGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946394997 2:219439161-219439183 GTTAGGACAGAGAAGGGGGAAGG + Intronic
946765143 2:223033545-223033567 GATTGAACAGAGAAGCTGGAAGG - Intergenic
948451731 2:238079528-238079550 AATAGCACAAAGGAGGTGGGAGG - Intronic
948565837 2:238885495-238885517 CATAGCACACAGAAGATGTCTGG + Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1169778997 20:9288671-9288693 TAAAGGACAGAGGAGGTGGAGGG + Intronic
1169933527 20:10858646-10858668 CATAGCAGAGAGGAGCTGGAAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171415717 20:24979299-24979321 TATTTCACAGAGAAGATGGAAGG + Intronic
1171792403 20:29539207-29539229 CAGAGCACAGAGAATGTTCACGG - Intergenic
1172222930 20:33286090-33286112 CAAACCACAGAGAAGGGTGAAGG - Exonic
1173133260 20:40414545-40414567 CCTAGCACATAGCTGGTGGAAGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174277298 20:49413362-49413384 CATAGTACAGAGCAGGTAGTGGG - Intronic
1175978974 20:62727608-62727630 GATAGCACAGAGAGGGTGGCTGG + Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176608595 21:8855207-8855229 CATAGCACAGAGAATTTTTAGGG - Intergenic
1179469333 21:41600154-41600176 AGTAGCACAGAGAAGGTAAAGGG - Intergenic
1180358680 22:11865022-11865044 CATAGCACAGAGAATTTTTAGGG - Intergenic
1180379586 22:12127309-12127331 CATAGCACAGAGAATTTTTAGGG + Intergenic
1182412528 22:30199311-30199333 CATTGCAGAAATAAGGTGGAGGG + Intergenic
1182448195 22:30402118-30402140 CACCGCCCAGAGATGGTGGAGGG + Intronic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
949218872 3:1605567-1605589 AATAGTACAAAGTAGGTGGATGG - Intergenic
949561082 3:5203201-5203223 CAGAGCCCAGAGAAGATGAAAGG - Intronic
950313955 3:11984000-11984022 CATAGCAGAGAGATGGAGAAAGG + Intergenic
950495781 3:13333493-13333515 CAGAGCACAGAGGAGCTGGGAGG - Intronic
950718910 3:14868544-14868566 CATAGCACAGAGAAAGTGCATGG - Intronic
952216253 3:31280529-31280551 CATAGCAAAGAGCAGCTGTAGGG - Intergenic
952236962 3:31490139-31490161 AACAGTACAAAGAAGGTGGAAGG - Intergenic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
955821577 3:62901531-62901553 CAAAGTACAGAGAAGATGGTGGG - Intergenic
958126172 3:89357869-89357891 CATACCTCAGGGAAGATGGATGG - Intronic
959350863 3:105261116-105261138 CATTTCACAGACAAGGTGGCTGG - Intergenic
960618839 3:119620206-119620228 CATAGCATAGGGAAGGATGACGG - Intronic
961493845 3:127276245-127276267 CATGGCACAGATAAGGTCTAGGG + Intergenic
961551007 3:127670739-127670761 CTTAGCAGAGAGAAGCAGGAGGG - Intronic
962151479 3:132897981-132898003 CATAGCACAGAGAAGATCATGGG - Intergenic
963049437 3:141128564-141128586 CAGCCCCCAGAGAAGGTGGAAGG + Intronic
964249937 3:154701665-154701687 AACAGCACAAAGAAGGTGGGTGG + Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964843578 3:161022277-161022299 AACAGCACAGAGAATGGGGAGGG - Intronic
966194017 3:177296132-177296154 CATAGCACAGAGAATTTTTAGGG - Intergenic
966549193 3:181184976-181184998 CAAAGCACAAAGGATGTGGAAGG + Intergenic
967936165 3:194729559-194729581 CATAGCAGAGAGAGTTTGGAAGG - Intergenic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
968544103 4:1187710-1187732 GATAGCACAGAGGAGGAGGAGGG - Intronic
968854613 4:3110294-3110316 CATATTACAAAGAAGTTGGAAGG - Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976610926 4:87029576-87029598 GATAGCACAGGGAAGTTGGATGG + Intronic
977546830 4:98392932-98392954 CATAACACAGAGGAGGATGATGG + Intronic
977675882 4:99746251-99746273 GATAGTACAGAGAATTTGGAAGG + Intergenic
977929282 4:102733972-102733994 CAGAGCACAGAGAATGTTTATGG + Intronic
978309888 4:107375317-107375339 CAGAGCACAGAGAATGTTTAAGG + Intergenic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
979689527 4:123546076-123546098 GTTAGCAGAGAGAAGTTGGAGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983584448 4:169340477-169340499 CTTATCACAGAGAAGTTTGAAGG + Intergenic
1202770654 4_GL000008v2_random:203326-203348 CATAGCACAGAGAATTTTTAGGG + Intergenic
985806049 5:2044254-2044276 CATTGTACAGAGAAGCTGGAGGG + Intergenic
985992337 5:3573893-3573915 GACCTCACAGAGAAGGTGGAAGG + Intergenic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
987651288 5:20743604-20743626 AACAGCACAAAGAATGTGGATGG + Intergenic
988588887 5:32531713-32531735 AACAGCTCAGAGATGGTGGAGGG + Intronic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
990056768 5:51591367-51591389 CATAGCACAGATGAAGTTGATGG + Intergenic
990775008 5:59296498-59296520 CATAAGCCAGAGAAGGTGGAAGG + Intronic
991421112 5:66443162-66443184 CAAAGCACAGATAAGGAAGATGG + Intergenic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992845545 5:80743326-80743348 GAGAGCACAGAGAAGGTACAAGG - Intronic
993813018 5:92506421-92506443 AACAGCACAAATAAGGTGGAAGG + Intergenic
994915007 5:105963934-105963956 CAGAGCACAGAGAATTTTGATGG - Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995799672 5:115980251-115980273 CAAAGCACAGAGAAAAGGGAAGG + Intronic
996134143 5:119818100-119818122 CACAGCATAGAGAATGTGGAAGG - Intergenic
996604088 5:125300503-125300525 CATATCAGAGAAAAGCTGGAGGG - Intergenic
996958838 5:129219037-129219059 CATAGCATGGAGAAGGTGTATGG + Intergenic
998158922 5:139802165-139802187 CATAACACAGAGATTGGGGAGGG + Intronic
999073392 5:148771726-148771748 GATAGTCCAGAGAAGGTGGGTGG + Intergenic
999087754 5:148908201-148908223 GATAGCAGGGAGAAGATGGAGGG - Intergenic
999625928 5:153520261-153520283 CATCCTACAGAGAAGGTGAAGGG + Intronic
1000992790 5:167928110-167928132 CATACCCCAGAGAAGAAGGAGGG - Intronic
1001646692 5:173287353-173287375 CAAAGCATAAAGGAGGTGGAGGG + Intergenic
1001896042 5:175382228-175382250 CACAGCTCAGTGGAGGTGGAGGG - Intergenic
1002659026 5:180777752-180777774 CCTGGCACAGAGTAGGTGGTGGG - Intergenic
1003396645 6:5759120-5759142 CATAGCTCAGAGGAGGAGAATGG + Intronic
1005290946 6:24378273-24378295 CATGGCACACAGAAGCGGGAGGG - Intergenic
1005956337 6:30665850-30665872 CATTGCAGAGGGAAGGTAGAGGG - Intronic
1006518462 6:34557420-34557442 CATTCCCCAGAGAAGGTTGAGGG + Intergenic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1006793991 6:36720885-36720907 TATAGCTCAGAGAAGTGGGATGG + Intronic
1007439584 6:41846744-41846766 CATAGCACAGAGCAAGTTGGAGG + Intronic
1007665912 6:43512868-43512890 CATAGCCCTGGGAAGGAGGATGG + Exonic
1009459632 6:63896681-63896703 CAGAGCACAGAGAATTTTGAGGG - Intronic
1012441964 6:99269172-99269194 CAGACCACACAGAAGGTAGAAGG - Intergenic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1013036771 6:106392538-106392560 CACAGGAAAGAGATGGTGGAGGG + Intergenic
1014211568 6:118713797-118713819 TCTATCACAGAGAAGGTGGGAGG - Intergenic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014296805 6:119628430-119628452 CACAGCACAGGAAAGGTAGAAGG - Intergenic
1015049468 6:128821750-128821772 CAAAACACAGAGAATTTGGAGGG + Intergenic
1015547470 6:134376196-134376218 CATAGCATAGAGAAGGAGCATGG - Intergenic
1016466803 6:144333923-144333945 CCTAGCACATAGTAGGTGGGTGG - Intronic
1016639372 6:146331475-146331497 TATATCACAGAGAATGTGAAGGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1018116976 6:160595906-160595928 CATATTTCACAGAAGGTGGAAGG - Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1020021323 7:4871241-4871263 CTTAGCACAGTGGAGGTGAAAGG - Intronic
1020362566 7:7344533-7344555 AATAGCACAAAGAAAGTGGATGG - Intergenic
1020500241 7:8909250-8909272 CATACCACAAAGAGGGAGGAGGG - Intergenic
1021816947 7:24456331-24456353 CATAGCTCAGGGAGGCTGGAGGG - Intergenic
1021968179 7:25942788-25942810 GATAGCAAAGAAGAGGTGGAGGG - Intergenic
1022389809 7:29933708-29933730 CCTAGCACATAGTAGGAGGAGGG + Intronic
1022888113 7:34667400-34667422 CCAAGCCCAGAGAAGGTGGGAGG + Intronic
1023286898 7:38630378-38630400 CACAGCCCAAAGCAGGTGGAGGG - Intronic
1023806920 7:43878893-43878915 CAGGGCACAGAGAAGGTCTAAGG + Exonic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024938122 7:54733408-54733430 CACAGGACAGGCAAGGTGGAAGG - Intergenic
1027367490 7:77473563-77473585 CACAGTACAGAGAAGAGGGAAGG + Intergenic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028320673 7:89456044-89456066 CATAGCAAAGAAAGGGTGGGGGG - Intergenic
1030328531 7:108248119-108248141 AATAGCACTGAGAAGATGTAAGG + Intronic
1032668629 7:134063492-134063514 GAAAGCACAGAGAAGTTAGAGGG - Intronic
1034379463 7:150678315-150678337 AAAAGCACAGAGAAGGTGATGGG + Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1035773017 8:2164643-2164665 CTTTGCACAGTGAAGATGGATGG - Intronic
1036453491 8:8890101-8890123 CTTAGAACAGAGAATGTGCACGG + Exonic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036922425 8:12870696-12870718 AATAGCACATAGAATCTGGAAGG + Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1039041673 8:33414417-33414439 CATAGGGCAGAGAAGGGTGAGGG - Intronic
1043012604 8:74900071-74900093 CACAGGACAGAGAAGATGGGTGG + Intergenic
1043069457 8:75620493-75620515 TATTGTCCAGAGAAGGTGGAAGG - Intergenic
1044602051 8:94015099-94015121 AATAGCACAGAGGGTGTGGATGG - Intergenic
1045808287 8:106191405-106191427 CAAAGCTTAGAGAAGGTGAAGGG + Intergenic
1045892779 8:107177125-107177147 AATAGCACAAAGAATTTGGAAGG + Intergenic
1046042155 8:108918848-108918870 CATAGAACTGTGAAGTTGGAAGG + Intergenic
1050908241 9:11032508-11032530 AACAGCACAAAGTAGGTGGATGG - Intergenic
1050941583 9:11467064-11467086 AATAGCAAAGAGAAAGTGTAAGG + Intergenic
1051438928 9:17062318-17062340 AATAGAACAGGGAAGGTGGTAGG + Intergenic
1051643827 9:19248754-19248776 CAAAACAGAGAGAAAGTGGAAGG - Intronic
1051823562 9:21194090-21194112 CATAGCATTGAGAAGGAGCACGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053657982 9:40239631-40239653 CATAGCACAGAGAATTTTTAGGG - Intronic
1054526614 9:66136590-66136612 CATAGCACAGAGAATTTTTAGGG + Intronic
1054818419 9:69497747-69497769 GCTAGCACAGAGATGGTGCAGGG - Intronic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1055441592 9:76342011-76342033 CCTGGAGCAGAGAAGGTGGATGG + Intronic
1055752492 9:79522284-79522306 CACAGAACATAGAAGTTGGATGG + Intergenic
1056088203 9:83177030-83177052 AAAAGCACAGAGAAGGTGATGGG - Intergenic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1056794459 9:89648062-89648084 CACAGCACAGACAAGGGGGAGGG - Intergenic
1058169113 9:101657719-101657741 CATGCCACAGAGGTGGTGGATGG + Intronic
1058857528 9:109078191-109078213 CATAGCACAAAGAAGAGGGCTGG - Intronic
1060002021 9:119967429-119967451 CACATCATAGAGATGGTGGAGGG + Intergenic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060833512 9:126736133-126736155 AATAGCACAAAGAAGGGGAAGGG + Intergenic
1062675359 9:137740072-137740094 CAGAGGGCAGACAAGGTGGATGG - Intronic
1203703994 Un_KI270742v1:20421-20443 CATAGCACAGAGAATTTTTAGGG - Intergenic
1186149252 X:6656585-6656607 CATAGCATAAAGGATGTGGAGGG + Intergenic
1187053607 X:15718652-15718674 CCTAGCCCCGAAAAGGTGGAAGG - Intronic
1189068166 X:37834083-37834105 CAGAGGACAGAGATGGTGAAGGG - Intronic
1189200288 X:39189507-39189529 CATAACCCAAAGAAGGGGGATGG - Intergenic
1189909017 X:45790769-45790791 CACAGCTCATAGAAGGTGGTTGG + Intergenic
1190396159 X:49987370-49987392 CATTTCTCATAGAAGGTGGATGG + Intronic
1190627401 X:52350018-52350040 CTTAGCAAAGAAAAGGTGTATGG - Intergenic
1192084719 X:68084823-68084845 CAGAGCTCAGAGAAGGTGCTTGG + Intronic
1192451695 X:71248854-71248876 GAGAGCACACAGAAGGTGTAAGG + Intronic
1192544267 X:72000215-72000237 CCTCGCACAGAGAAGGTGCTGGG - Intergenic
1193440455 X:81534812-81534834 CAGAGCACTGAGAGGGTGCAGGG - Intergenic
1195620400 X:106948323-106948345 AATAGCACAAAGGAGGTGGATGG - Intronic
1199554667 X:149093471-149093493 CATAGCTCAGTGAAGGATGAGGG - Intergenic