ID: 1166924896

View in Genome Browser
Species Human (GRCh38)
Location 19:46260735-46260757
Sequence GTCCCAGCCGGGGGTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166924885_1166924896 23 Left 1166924885 19:46260689-46260711 CCACTGGAGGAGACAGAGCTGGT No data
Right 1166924896 19:46260735-46260757 GTCCCAGCCGGGGGTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166924896 Original CRISPR GTCCCAGCCGGGGGTCCCCT GGG Intergenic
No off target data available for this crispr