ID: 1166925675

View in Genome Browser
Species Human (GRCh38)
Location 19:46265468-46265490
Sequence CCACCCTGCTGGGCTGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166925675_1166925679 4 Left 1166925675 19:46265468-46265490 CCTATTTCAGCCCAGCAGGGTGG No data
Right 1166925679 19:46265495-46265517 CACCTGTAATCCCAGACCTTTGG 0: 16
1: 2331
2: 80119
3: 221328
4: 292991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166925675 Original CRISPR CCACCCTGCTGGGCTGAAAT AGG (reversed) Intergenic
No off target data available for this crispr