ID: 1166925679

View in Genome Browser
Species Human (GRCh38)
Location 19:46265495-46265517
Sequence CACCTGTAATCCCAGACCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596785
Summary {0: 16, 1: 2331, 2: 80119, 3: 221328, 4: 292991}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166925675_1166925679 4 Left 1166925675 19:46265468-46265490 CCTATTTCAGCCCAGCAGGGTGG No data
Right 1166925679 19:46265495-46265517 CACCTGTAATCCCAGACCTTTGG 0: 16
1: 2331
2: 80119
3: 221328
4: 292991
1166925677_1166925679 -6 Left 1166925677 19:46265478-46265500 CCCAGCAGGGTGGCTCACACCTG No data
Right 1166925679 19:46265495-46265517 CACCTGTAATCCCAGACCTTTGG 0: 16
1: 2331
2: 80119
3: 221328
4: 292991
1166925678_1166925679 -7 Left 1166925678 19:46265479-46265501 CCAGCAGGGTGGCTCACACCTGT 0: 7
1: 424
2: 1784
3: 4151
4: 6741
Right 1166925679 19:46265495-46265517 CACCTGTAATCCCAGACCTTTGG 0: 16
1: 2331
2: 80119
3: 221328
4: 292991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166925679 Original CRISPR CACCTGTAATCCCAGACCTT TGG Intergenic
Too many off-targets to display for this crispr