ID: 1166932171

View in Genome Browser
Species Human (GRCh38)
Location 19:46308141-46308163
Sequence TTGGAGCAGGGGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 3, 3: 92, 4: 748}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166932166_1166932171 -10 Left 1166932166 19:46308128-46308150 CCAGGCTCATGAATTGGAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG 0: 1
1: 0
2: 3
3: 92
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166932171 Original CRISPR TTGGAGCAGGGGAATGAGGA TGG Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900476691 1:2879468-2879490 TTGCACCAGAGGAACGAGGAAGG - Intergenic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
901002563 1:6155802-6155824 TTGGCACAGGGGAAAGAGGAGGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901418702 1:9135677-9135699 TTCAAACAGGGAAATGAGGAAGG - Intergenic
902063109 1:13661780-13661802 TTTGAGCATGGGGGTGAGGAAGG - Intergenic
902113096 1:14099362-14099384 GGGAACCAGGGGAATGAGGAAGG - Intergenic
902177903 1:14665092-14665114 TTGGGGCAGCGGAATAAAGAGGG - Intronic
902252468 1:15163458-15163480 TTTGAGCAGGGGTACGAGGTAGG - Intronic
902601928 1:17545821-17545843 GTGTAGCAGGGGAATGGGGTAGG + Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903404028 1:23081429-23081451 TTGGAGCTGGGGAAACAGAAAGG - Exonic
904131802 1:28281050-28281072 TGTGGGCAGGGGAAGGAGGAAGG - Exonic
904271227 1:29351461-29351483 GTGGAGCTGGGGCATGAGGTGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904447812 1:30588816-30588838 ACAGAGCAGGGGAAAGAGGAGGG + Intergenic
904679035 1:32216027-32216049 TAGGAGCAGGAGAACGGGGAGGG - Exonic
904839345 1:33361832-33361854 ATGGAGCGTGGGAATGAGGGAGG + Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905266005 1:36754851-36754873 TTGGAGCAGAGGATCAAGGAAGG + Intergenic
905277159 1:36825668-36825690 TGGGGACAGGGGATTGAGGAAGG + Exonic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
906125736 1:43425974-43425996 GTGGAGCAGGGGAGTGGGTAGGG + Intronic
906138160 1:43515084-43515106 TGGGAGAACGGGAATGAGAAGGG - Intergenic
906708480 1:47912074-47912096 TTGGAGGAGGGGGCTGAGGGAGG + Intronic
907255029 1:53172790-53172812 ATGGAGCAAGGGAAAGAGGGAGG - Intergenic
907362706 1:53932667-53932689 TTGGAGCTGAGGCATGAGGATGG - Intronic
907728656 1:57044575-57044597 TTGTAGCTAGGGAATGAAGAAGG + Intronic
907973170 1:59404611-59404633 TTGCAGCAGGGGGCTGAGGCTGG + Intronic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
908675212 1:66595911-66595933 TTTGAGGAGGGGGAGGAGGAAGG + Intronic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910362727 1:86430355-86430377 TAGGAGCTAGGGAAGGAGGAAGG - Intronic
910929687 1:92430905-92430927 TGGGATCAGGGGAATGGGGAGGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911305515 1:96227222-96227244 TTGGAGGGCAGGAATGAGGAAGG - Intergenic
914677156 1:149914085-149914107 GGGGAGCAGGGGAATGGGAAGGG + Exonic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915120683 1:153628205-153628227 ATGGTGCAGGGGAAAGAGGTGGG - Intronic
915147090 1:153801690-153801712 CGGGAGCAGGGGAATGTGAAGGG - Intergenic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915727983 1:158032325-158032347 TGGGAGCAGGGAGATGAGGTTGG + Intronic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
915923241 1:159994586-159994608 TTAGAGCAGAGGAAAAAGGAAGG + Intergenic
915981679 1:160424308-160424330 GAGGAGCTGGGGAAGGAGGAAGG - Intronic
916443098 1:164846716-164846738 TTGGGGCAGGGGCAGGAGGGAGG + Exonic
916451397 1:164923927-164923949 TAGGGGCAGGGGAAGAAGGAGGG + Intergenic
916584448 1:166138221-166138243 TTTGATGAGGGGAGTGAGGAGGG - Intronic
916827989 1:168462038-168462060 TTGGAGCAGGAGAAAGAGTGAGG + Intergenic
917226524 1:172789247-172789269 TTGCTGCTGGGGAATGGGGAAGG + Intergenic
917750690 1:178050592-178050614 TTTGAGCTGGAGAATGATGAGGG + Intergenic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919362673 1:196614392-196614414 TTTGAGCAGGGGCATGAGTTTGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919752692 1:201048155-201048177 TGGGAGCAGGGGAAGGAGTCAGG - Intronic
919789414 1:201280892-201280914 TTGGTGCAAGGGACGGAGGAAGG + Intergenic
920121589 1:203662792-203662814 TTGTAGCAGGAAACTGAGGAGGG + Intronic
920312729 1:205058158-205058180 CTGCAGCAGGGGACAGAGGAAGG - Intronic
920968566 1:210722498-210722520 TGGGAGCAGGGGATGGAGAAGGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921672219 1:217938241-217938263 TTGGAAGAGGGGAAAAAGGAAGG - Intergenic
922119360 1:222647781-222647803 ATGGAGCAGAGGAATTAGCAAGG + Intronic
922332490 1:224589742-224589764 TTGCAGCATGGGATTGAGAAAGG + Intronic
922708780 1:227810252-227810274 TGAGAGCAGGGGAGAGAGGAGGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924904921 1:248442015-248442037 ATTGAGCATGGGAGTGAGGATGG - Exonic
1063108845 10:3017619-3017641 TGGGAGCAGAGGCAGGAGGAAGG + Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064721283 10:18231841-18231863 TTTCAGCAGGGGAGTGATGAGGG - Intronic
1065429061 10:25635131-25635153 TTGCAGCAGGTGAATAAGGTGGG - Intergenic
1065555578 10:26912324-26912346 TTGGAAGAGGGCAATGAGGCGGG + Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066003171 10:31123599-31123621 TTGGAGGAGGGGGATCTGGATGG - Intergenic
1066494322 10:35927575-35927597 TTGGAGCAGAGGAAGCGGGAGGG - Intergenic
1066574312 10:36808967-36808989 TTGGAAAAGGGCAATGAGGCAGG - Intergenic
1067008117 10:42683849-42683871 TGGGTGCAGTGGAATGAGGCTGG + Intergenic
1069134055 10:64742138-64742160 TTGGATCTGGGTAATGAGTAGGG + Intergenic
1069304997 10:66957990-66958012 CTGGAGCAGGGTACAGAGGAAGG + Intronic
1069351075 10:67528311-67528333 TTTAAGCAGGGTAATGATGAGGG - Intronic
1069500529 10:68949098-68949120 TAAGAGCAGAGGACTGAGGAGGG + Intergenic
1069509786 10:69033442-69033464 GTGGTGGAGGGGAATGAGTAGGG - Intergenic
1069568613 10:69480277-69480299 TGGGGGCAGGGGAATGGGGAAGG + Intronic
1069709629 10:70480115-70480137 TTGGAGCAAGGTAATAAGGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070339144 10:75480815-75480837 TTGGAGCAGTGGAGTGTGGAAGG + Intronic
1070519075 10:77236059-77236081 GGGGAGCAGGGGACTGAGGCTGG + Intronic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071713479 10:88072467-88072489 GTGGAGCAAGGGAATGGGGAAGG + Intergenic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1073045994 10:100638591-100638613 TTGGAGCAGAGCACTGCGGAGGG + Intergenic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073605828 10:104894810-104894832 TAGGTGCAGGAGAATGATGATGG + Intronic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075657075 10:124169122-124169144 TTAGAGTGGGGGATTGAGGAAGG - Intergenic
1075686333 10:124367614-124367636 TTGGAGGGGGGGAAGGAGGTGGG - Intergenic
1075686354 10:124367668-124367690 TTGGAGCGGGGGAAGGAGGTGGG - Intergenic
1076146733 10:128127736-128127758 TGGGAGCATGAGAATGAGAAGGG - Intergenic
1076579018 10:131494512-131494534 TTGGAGCAGGGAGATTGGGATGG + Intergenic
1076772875 10:132676681-132676703 TTGGAGCAGAGTCAGGAGGAGGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077190533 11:1254325-1254347 ATGGTGCATGGGAAGGAGGAGGG + Exonic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1078034901 11:7793645-7793667 TTGGAGCAGGAGAGTCATGATGG + Intergenic
1078263522 11:9734702-9734724 CTTGAGCAGGGGAGTGAGCATGG - Intronic
1078387514 11:10905412-10905434 ACAGAGCAGGGGCATGAGGAGGG - Intergenic
1078427455 11:11263500-11263522 TGGGAGCTGGGGGATGAGGATGG - Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081702957 11:45163468-45163490 TGGGAGCAGGTGCTTGAGGATGG + Intronic
1081731717 11:45376443-45376465 GGGGAGCAGGGGAAAGAGGAGGG - Intergenic
1081850623 11:46272850-46272872 TTGGAGCAGGTGATTCAGGCTGG + Intergenic
1081858034 11:46316276-46316298 CTGGAGCAGGGTCCTGAGGAGGG - Exonic
1082868417 11:57920592-57920614 TTGGGGCTGAGGAATGAGCAAGG + Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083291911 11:61695206-61695228 TGGGAGGAGGGGCAAGAGGAGGG + Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083660876 11:64251375-64251397 TTGGGGCAGGGGCACGCGGACGG - Intergenic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1083796793 11:65021605-65021627 ATGGAGCAGGGCCTTGAGGAAGG + Intronic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084731342 11:71075611-71075633 GTGGAGCTGGGCACTGAGGATGG - Intronic
1084949590 11:72657327-72657349 TGGGAGGAGGGGAAAGAGGAGGG + Intronic
1085336752 11:75702388-75702410 CAGGAGCCAGGGAATGAGGAGGG + Intergenic
1085707440 11:78799291-78799313 TTGGGGCTGGGGAAAGGGGATGG + Intronic
1086089696 11:82993160-82993182 CTGGAGCAAGGAAAGGAGGAAGG - Intronic
1086193427 11:84108174-84108196 GGGGAGCAGGGGAAGGAAGAGGG + Intronic
1086880337 11:92146386-92146408 TAGGAGCAGGGAAATGGGGTGGG - Intergenic
1086922336 11:92601650-92601672 TAGGAGGAGGGGATTGATGAAGG + Intronic
1086953298 11:92912301-92912323 TTGGATGTGGGGTATGAGGAAGG - Intergenic
1087046510 11:93848035-93848057 TTGGAGGAGGGGATTTAGGGAGG - Intronic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1088531917 11:110819651-110819673 TTTGGGTAGGGGAAGGAGGAGGG + Intergenic
1088875497 11:113932831-113932853 TGGGGGCAGGAGAACGAGGAAGG + Intronic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089116312 11:116097857-116097879 TTGGGGTTGGGGAAAGAGGAGGG + Intergenic
1089255657 11:117192654-117192676 ATGGAGCAGGGGAACCAGGCAGG - Intronic
1089272043 11:117308045-117308067 TTGGGGCGGGGGGATGGGGATGG + Intronic
1089473521 11:118739875-118739897 ATGGAGCAGGGAAAAGAGCAAGG + Intergenic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090413954 11:126528095-126528117 TTAGAGCAGGGGTTTGAGCAGGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090726942 11:129536514-129536536 TAGGCACAGTGGAATGAGGAAGG - Intergenic
1090920112 11:131199370-131199392 TTGAAGCAGGATAATGAGGCTGG - Intergenic
1091356081 11:134938627-134938649 CTGGAGCAAGGGGATGAGGATGG + Intergenic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1092154477 12:6273594-6273616 GGGGAGCAGGGGAAGGAGCAGGG + Intergenic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1093387369 12:18574534-18574556 TTGGGGCAGTGGTATGGGGAGGG - Intronic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1094146391 12:27232922-27232944 TTGGGGCAGGGGGATGGTGAGGG - Intergenic
1094365218 12:29672651-29672673 TCAGAGCATGTGAATGAGGATGG - Intronic
1096152424 12:49323056-49323078 TGGGAGGCGGGGAAAGAGGAAGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096273090 12:50182332-50182354 TAGGAGCAGGGGATGGGGGAAGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096619021 12:52850886-52850908 TGGGGCCAGGGGAAGGAGGAAGG - Intergenic
1096836389 12:54353818-54353840 GTGGAGGAGGTGAATGGGGAAGG + Intergenic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097124242 12:56760809-56760831 TTGGACATGGGGGATGAGGAAGG + Intronic
1097410679 12:59248721-59248743 TAGGAGGTGGGGAGTGAGGATGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098429275 12:70402068-70402090 TTTGAGCAAGGAAATGAGGTTGG - Intronic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1099066224 12:77983244-77983266 TTTGGGCAGGGGAATAGGGATGG + Intronic
1099355817 12:81633831-81633853 TTGGAGCAGGGGGGAGAGGAAGG + Intronic
1099560095 12:84162228-84162250 TTGGTGCAGTGGGACGAGGATGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100490993 12:95077708-95077730 TAACAGCAGGGCAATGAGGATGG + Exonic
1100669034 12:96789475-96789497 TTGGAGTAGGGGGCAGAGGACGG + Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101251980 12:102945798-102945820 TTGGAGCTTGGGTATGAGGTTGG - Intronic
1101261776 12:103039503-103039525 TTTCAGCAGGGGTATGAGGGTGG - Intergenic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101581781 12:106048364-106048386 TTGCAGAAGGGGAATGCAGAAGG - Intergenic
1102158689 12:110751102-110751124 TTGGAGCAGGGGGATTTAGATGG + Intergenic
1102268080 12:111506190-111506212 TGGGAGTAGGGGAAAGAGAAGGG + Intronic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102887096 12:116530444-116530466 TGGGAGGATGGGAAGGAGGAAGG + Intergenic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1104818052 12:131659945-131659967 TTGGGGGATGGGAATGGGGAGGG + Intergenic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1104928970 12:132328542-132328564 TTGAAGGTGGGGAAAGAGGAGGG - Intronic
1105070851 12:133233740-133233762 TTGCGGCCGGGGAATGAGAAGGG + Intronic
1106102642 13:26708046-26708068 CAGGGGCAGGGGAATGAGGTGGG - Intergenic
1106145799 13:27048917-27048939 TTGGAGGTGGAGAATGAGGCGGG - Intergenic
1106576963 13:30983664-30983686 TAAGCGCAGGGGAAAGAGGAGGG - Intergenic
1106928923 13:34642322-34642344 TTGGAGCTGAGGATTGAGGTTGG + Intergenic
1107873525 13:44768759-44768781 TTGGAGCTGGGAAAGGAGGAAGG + Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1110286175 13:73752696-73752718 AGGGAGCAGGGGAATGAGTGAGG - Intronic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111156524 13:84334909-84334931 TGGTTGCAGGGGACTGAGGAAGG + Intergenic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112765482 13:102737525-102737547 CAGGAGCAAGGGAAAGAGGACGG - Exonic
1113086261 13:106572313-106572335 TTGGAGAAGGGAATGGAGGAAGG - Intergenic
1113350852 13:109527853-109527875 TGGGAGCAGAGGGCTGAGGAAGG - Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113573180 13:111373217-111373239 TTTGAGGATGGTAATGAGGAGGG - Intergenic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1115160591 14:30389535-30389557 TTGGAGCAGGGGGAGGGGAAGGG - Intergenic
1115211591 14:30972192-30972214 TTGGAGCAGGTGAGTCAGGGTGG - Intronic
1115283647 14:31693427-31693449 TTGGATGAGGTGGATGAGGATGG - Intronic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1116152980 14:41165789-41165811 TTGGAGCAGGGGGAAGAAGGAGG - Intergenic
1116427427 14:44807885-44807907 TTGGAGAAGGTCAATGAGGGTGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1117291403 14:54337239-54337261 TTGCTGGAGGGCAATGAGGAAGG + Intergenic
1117803488 14:59467301-59467323 TTGGAGATGGGGAGTGAAGAAGG + Intronic
1117841600 14:59866426-59866448 TATGAGCAGGGCAATGAGCAGGG + Intronic
1117986564 14:61391908-61391930 TGGGAGCAGGGGATTGAAAAAGG - Intronic
1118900170 14:69979860-69979882 TTGGAGGAGGGGAATCTGGGTGG - Intronic
1119065727 14:71524508-71524530 TGGGAACTGGGGAATGAGAATGG - Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119431360 14:74570095-74570117 TTGGAGGAGGGGCTGGAGGAAGG + Intronic
1119477360 14:74938883-74938905 TTGGCCCAGGGGAGTGGGGAGGG + Intergenic
1119630212 14:76224229-76224251 TGGGAAAAGGGGAATGGGGAAGG + Intronic
1119727138 14:76928365-76928387 GTGGAGGAGGGGAGTGGGGAAGG - Intergenic
1120199398 14:81519794-81519816 TTTGGGCAAAGGAATGAGGAAGG + Intronic
1120425255 14:84339459-84339481 GAGGAGCAGGGGTATGAGGATGG - Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121111143 14:91313936-91313958 TTGGAGCAGGCCAAGGAGAAGGG - Exonic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1121570274 14:94941895-94941917 TTGGAGCAGGTGAATGACTAAGG - Intergenic
1121810797 14:96887832-96887854 TTGGGGCAGGGGAAGGAGTAGGG - Intronic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122844790 14:104486976-104486998 CTGGAGCAGAGTAATGAGAATGG - Intronic
1124381619 15:29172486-29172508 TTGGAGCAGGCCAGTGGGGATGG + Intronic
1125428538 15:39573743-39573765 TAGGAGGAGGGGAATAAGAAGGG + Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126957260 15:53947444-53947466 TTGGAGATGGGGATTGAGTATGG - Intergenic
1127014381 15:54666956-54666978 TTGTAGCAGGGAAAGGAGAAAGG + Intergenic
1128678798 15:69631327-69631349 TGGGAGCAGAGCAAAGAGGAGGG + Intergenic
1128835605 15:70806920-70806942 ATGAAGCATGGGAAAGAGGAGGG + Intergenic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129006060 15:72374853-72374875 TGGGGGCTGGGGATTGAGGAGGG - Intronic
1129834266 15:78692160-78692182 TGGGAGCAGGGGGATGGGGCAGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130843323 15:87722382-87722404 GGGGAGCAGGGGAAGGAGGGAGG - Intergenic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131520285 15:93109405-93109427 TTGGAGGCGGGGAGGGAGGACGG - Intergenic
1131681165 15:94725342-94725364 TTGGAGCAGGCGATTGATGTGGG - Intergenic
1131694332 15:94859054-94859076 GTGGCACAGGGGAATGGGGATGG - Intergenic
1131996304 15:98136002-98136024 TTGGAGTAGGGGATTGATGTGGG + Intergenic
1132353921 15:101157786-101157808 TTGGAGCTGGGGAACAAAGATGG - Intergenic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133548506 16:6831173-6831195 TTGGAGGTGGGGAATGAGAGAGG + Intronic
1133577611 16:7109075-7109097 GATGAGCAGGGGAGTGAGGATGG + Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133997926 16:10762124-10762146 TGGTGGCAGGGGACTGAGGAGGG + Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134523474 16:14928696-14928718 TTGGGGGAGCGGGATGAGGATGG - Intronic
1134523483 16:14928722-14928744 TTGGGGGAGGGGGATAAGGATGG - Intronic
1134523494 16:14928748-14928770 TTGGGGGAGGGGGATAAGGATGG - Intronic
1134549398 16:15132172-15132194 TTGGGGGAGGGGGATAAGGATGG + Intronic
1134687596 16:16169609-16169631 TGGGAGGAGAGGGATGAGGAGGG + Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134711068 16:16327180-16327202 TTGGGGGAGCGGGATGAGGATGG - Intergenic
1134711077 16:16327206-16327228 TTGGGGGAGGGGGATAAGGATGG - Intergenic
1134711088 16:16327232-16327254 TTGGGGGAGGGGGATAAGGATGG - Intergenic
1134948486 16:18341351-18341373 TTGGGGGAGGGGGATAAGGATGG + Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948506 16:18341403-18341425 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948515 16:18341429-18341451 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137459100 16:48642043-48642065 TTGGATGAGAGGAATGAGCAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1138047121 16:53736890-53736912 CTGGGGGAGGGGAATGAGTATGG - Intronic
1139310388 16:66023499-66023521 CATGAGCAGGGGAGTGAGGAAGG - Intergenic
1139577201 16:67849154-67849176 GTGGAGCTGGGCAATAAGGAGGG + Intronic
1140250461 16:73290150-73290172 TAGGCACAGGGGAATCAGGAAGG + Intergenic
1140663498 16:77209497-77209519 TTTCAGCTGGGGAATGAGGTAGG - Intronic
1140725565 16:77808465-77808487 ATGGAGCAGGGGTGGGAGGATGG - Intronic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1140913830 16:79477292-79477314 CTGGAGCATGGGTTTGAGGATGG + Intergenic
1141051223 16:80766064-80766086 TTGGAGCTAAGGGATGAGGAGGG + Intronic
1141067715 16:80927411-80927433 TTGGAGGAGGTGAATGAAGGAGG + Intergenic
1141599084 16:85114399-85114421 TTGGAGGAGGGGAAAGGGCAGGG - Intergenic
1141604814 16:85146728-85146750 TGGGAATGGGGGAATGAGGAGGG + Intergenic
1141847578 16:86621501-86621523 TAGGAGAAAGGGAAAGAGGAAGG - Intergenic
1141942502 16:87286927-87286949 TGGGAGGAGGGGAAGGAGAAGGG + Intronic
1142256463 16:89015920-89015942 CAGGAGCAGGGGGCTGAGGAGGG + Intergenic
1142322508 16:89393202-89393224 TGGGAACAGGTGAATGAGGCTGG - Intronic
1142341478 16:89525813-89525835 CTGCAGCACGGGACTGAGGATGG - Intronic
1142581062 17:943091-943113 TTGGTGCAGGGAAGGGAGGAGGG - Intronic
1142635034 17:1251846-1251868 TTGGAGCAGGGCAGTGTGGTGGG - Intergenic
1143129920 17:4671776-4671798 TTGGAAGAGGAGACTGAGGATGG - Exonic
1143631689 17:8143631-8143653 TGGGAGCAGGGGGAAGAGGCTGG + Exonic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144324889 17:14169415-14169437 TTGGAGCTGGGTAATGGGCAGGG - Intronic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1144535137 17:16081456-16081478 TTTGATCAGGAGAATGAGAATGG - Intronic
1145177087 17:20710115-20710137 TTGGGGGAGGGGAATGAGATAGG - Intergenic
1145386740 17:22419235-22419257 TTGCTGGAGGGGAAAGAGGAAGG - Intergenic
1145762696 17:27435182-27435204 TTGGAGCAGGGAGATGGGGTGGG + Intergenic
1147459854 17:40561280-40561302 TTGGAGGAGGTGGATGAGCAAGG + Intronic
1147935920 17:44011058-44011080 TTGGAACAGGGGAAAGATCACGG + Intergenic
1148395410 17:47304236-47304258 TTGGAGCTGGGAGATGAGCAGGG - Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148539342 17:48467399-48467421 CAAGAGCAGGGGAATAAGGATGG - Intergenic
1148785837 17:50145835-50145857 TTGGAGCAGGGGAGGGAAGCAGG + Intronic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1149853632 17:60058465-60058487 TTGGTACAGTGGAATGAGCAGGG + Intronic
1150053438 17:61988947-61988969 TGGGGGTAGGGGAATGGGGATGG - Intronic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151431458 17:74066300-74066322 TTGAAGCAGGGAGCTGAGGAAGG + Intergenic
1151875889 17:76868236-76868258 TTGGCTCAGGGGAAGGAGCAGGG + Intergenic
1152152226 17:78609353-78609375 TGCGTGCAGGGGCATGAGGATGG - Intergenic
1152292186 17:79446227-79446249 TTGGAGTATGGGAATGATGGAGG - Intronic
1152319571 17:79600933-79600955 GTGAAGGAGGGGAGTGAGGAAGG + Intergenic
1152396648 17:80036929-80036951 TTGGAGTAGGGGAAAGAGGGAGG - Intronic
1152430692 17:80246901-80246923 TGGGGGCAGGGGGATCAGGAGGG - Intronic
1152448214 17:80358963-80358985 TGAAAGCAGGGAAATGAGGAGGG - Intronic
1152491087 17:80635203-80635225 TTGGACCAGGGCAGTGAGAAAGG - Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152829198 17:82486695-82486717 GTGGAGCTGGGGCCTGAGGAAGG + Intronic
1154467898 18:14667752-14667774 TGGGTGCAGTGGAATGAGGCTGG - Intergenic
1154470442 18:14695001-14695023 TGGGTGCAGTGGACTGAGGATGG - Intergenic
1154498534 18:14980677-14980699 CTGGAGCAAGGGGATGAGGATGG - Intergenic
1156140284 18:34100359-34100381 GGGGAGCAGGGGAAAGAGGTAGG - Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1156647239 18:39179842-39179864 TTGAATCAGGGATATGAGGAAGG + Intergenic
1156944957 18:42817650-42817672 TTGGTCCAGGGGAAGGAGGGAGG + Intronic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157193715 18:45602406-45602428 TTGAAGCAGGGCAAGGAGGCAGG + Intronic
1157208116 18:45717847-45717869 GTGGGCCAGGGGAGTGAGGATGG - Intergenic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1158120741 18:54045796-54045818 TTGGGGTAGGGGAATGAGTTAGG - Intergenic
1158547758 18:58410481-58410503 ATGGTGCTGGGGAATGGGGATGG + Intergenic
1158582815 18:58699828-58699850 TTGGAGGTGGGGACTGTGGATGG + Intronic
1158736695 18:60090679-60090701 TTGGAGAAGGGGGATGTGGTTGG + Intergenic
1159009274 18:63042928-63042950 TGGGAGCATGGGGAGGAGGATGG + Intergenic
1159022148 18:63152047-63152069 TTCGAGTAGGGGATTGAGCAGGG + Intronic
1159197236 18:65133239-65133261 TTGGAATAGGGTATTGAGGAGGG - Intergenic
1159301805 18:66582294-66582316 TTGAAGCTGGGAAATGTGGATGG + Intronic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1160373387 18:78392202-78392224 TTGTAGAAGGGGAACGAGAAAGG + Intergenic
1160413545 18:78690648-78690670 TAGAAGCAGGGGGATGAGGCAGG + Intergenic
1160617599 18:80144611-80144633 TGGGAGCAGGGGACAGAGCAGGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161879411 19:6937426-6937448 TGGGAGGAGGGGGATGGGGAGGG - Intronic
1162323861 19:9986812-9986834 TTAGAGCAGGGGACTGAGTCTGG - Intronic
1162490448 19:10988056-10988078 TGGGAGCAGGGAGGTGAGGAAGG - Intronic
1163191118 19:15677482-15677504 TGGGAGGAGGGGAATGAGTGAGG - Intronic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1165310678 19:35027805-35027827 TTGGAGCAGGGGACTGGAGGAGG + Intergenic
1165407254 19:35638374-35638396 TTGGAGCTGGGAAATGAAAAAGG + Intergenic
1165721053 19:38080032-38080054 GTGGAGCAGGGGAAGGAGTTTGG + Intronic
1166079618 19:40435423-40435445 GGGGAGCAGAGGAGTGAGGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166593917 19:44027608-44027630 TGGGAGCAGGGGCATCAGCAGGG - Intronic
1166695897 19:44851304-44851326 AGGGAGCAGGGGACTGAGGCTGG - Intronic
1166886780 19:45966283-45966305 TTGGAGGAAGGGAAGGAAGAAGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167153961 19:47726783-47726805 TTGGGGCAGGCTAAGGAGGAAGG - Intronic
1167622887 19:50568705-50568727 GAGGAGCAGGGGAGAGAGGAGGG + Intergenic
1167729000 19:51239472-51239494 TTAGAGCAGGGCAGTGAGGAGGG - Intronic
1168451676 19:56471163-56471185 TGGGAGCAGGAGAAAGAGGCAGG - Intronic
1202646703 1_KI270706v1_random:148470-148492 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
925080702 2:1062368-1062390 TGGGAGCAGAGGAATGAAGTGGG + Intronic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
926076830 2:9949703-9949725 TTGGACCAGGGCACAGAGGAGGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927640106 2:24840721-24840743 TTGGAGCAGGGGCAAGAGTAGGG + Intronic
927916306 2:26938845-26938867 CTGGAGCAGGGGAGTCAGGTGGG - Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928792392 2:34973316-34973338 TTTGAGCAGGAAAATGAGTAAGG - Intergenic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929250791 2:39752905-39752927 TAGGAGCAGGGGAAGGCAGAGGG - Intronic
929298646 2:40276192-40276214 TTGTAACAGGGGAAAGAAGAAGG - Intronic
929532008 2:42758681-42758703 GGGGAGGAGGGGAATGATGATGG - Intergenic
929590993 2:43146178-43146200 TGGGAGCAGGGGAGAAAGGAAGG + Intergenic
929611769 2:43276069-43276091 TCAGAGCAGGGAAAGGAGGAAGG + Intronic
929714051 2:44292924-44292946 TTGGAGAAGGGGTTTGAGTAGGG + Intronic
929748344 2:44683158-44683180 TTGGAGCATGGAAAGGAGGCAGG + Intronic
929960656 2:46493922-46493944 TGGGAGCAGGAAAATGAGGCGGG + Intronic
931177530 2:59868910-59868932 TTGGAGCAAGGTTATGTGGAAGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932918925 2:75887571-75887593 TGGCAGCAGAGGAAAGAGGAGGG - Intergenic
933555175 2:83823051-83823073 TTGGTACATGTGAATGAGGATGG - Intergenic
934509861 2:94928888-94928910 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
934716379 2:96547018-96547040 TTGGAGCAGAGGAAAGAAAAGGG + Intronic
935191467 2:100781933-100781955 TGGGAGCTGGGGACTGGGGAGGG - Intergenic
935469189 2:103436531-103436553 TTCCAACAGGGGAAAGAGGAAGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937910376 2:127072812-127072834 GCGGGGCCGGGGAATGAGGAAGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938119222 2:128622177-128622199 TTGCAGCTGGGGAAAGAGGCTGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
940639984 2:156334564-156334586 TGTGAGTAGGGGGATGAGGAGGG + Intronic
941527171 2:166620674-166620696 TTGAAGCAGGGGAGTGGGAATGG - Intergenic
941658377 2:168169089-168169111 ATGGATGAGGGGAATGATGAAGG - Intronic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942192354 2:173482824-173482846 GCGGAGCAGGGGAGTGGGGATGG - Intergenic
943532666 2:189103884-189103906 TAGGAGGAAGGGAAGGAGGAAGG - Intronic
943577909 2:189653047-189653069 TTGAAGCAGGAGAATCAGGCAGG - Intergenic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
943808907 2:192159731-192159753 CTGAAGCAGGGCAATGAGGTGGG - Intronic
944528366 2:200642974-200642996 TTGGAGCAGGAGTCTGAGTAAGG - Intronic
944686762 2:202124458-202124480 TTGGACCAGGGGAGCCAGGAGGG - Intronic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
946390696 2:219415082-219415104 TGGGAGGAGGGGAAGGTGGAGGG + Intergenic
946396301 2:219445341-219445363 TGGGAGCAGGGGGATGTGGGCGG - Intronic
946467109 2:219921680-219921702 GTGGAGCAGGTGAGAGAGGACGG + Intergenic
946940051 2:224760966-224760988 TAGGAGCTGGGGAACCAGGATGG + Intergenic
947119267 2:226799263-226799285 TGGGAGGAGGCGAAGGAGGAGGG - Exonic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948934166 2:241151368-241151390 GTGGAGCTGGGGAAGGAGGGCGG + Intronic
1168901501 20:1368912-1368934 TTGGTGCAGGGGGATGGGGTTGG - Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1171127844 20:22620010-22620032 TTGGGGGAGGGGAATGGGGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172214524 20:33225639-33225661 TTGGAGCAGGGGCTTGGGCATGG - Intronic
1172411304 20:34725467-34725489 TGTGATCAGAGGAATGAGGACGG + Intronic
1172999897 20:39098191-39098213 TTGGGGCAGGGGGAAGATGAGGG + Intergenic
1173180780 20:40804820-40804842 TTGGATTATGGGAGTGAGGAGGG - Intergenic
1173498441 20:43535375-43535397 TTGCAGCAGGGAAATAAGGAAGG - Intronic
1173869523 20:46332664-46332686 CAGGGGCAGGGGAATAAGGAGGG + Intergenic
1174098278 20:48106895-48106917 ATTGAGCAGGGGAGTGAGAAGGG - Intergenic
1174117593 20:48237925-48237947 CTGCAGCAGGGGAGTGAGGTGGG - Intergenic
1174151439 20:48489071-48489093 GTGGAGCAGAGGAATCAGAAGGG + Intergenic
1174163919 20:48571222-48571244 CTGCAGCAGGGGAGTGAGGTGGG + Intergenic
1174250378 20:49215099-49215121 TTGGGCCAGGAGGATGAGGATGG - Intergenic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175382672 20:58574629-58574651 ATGGAGGAAGGGAATGAGGGAGG - Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176304111 21:5114424-5114446 GTGGAGCAGGGGACTGAGTGTGG + Intergenic
1176605163 21:8824294-8824316 TTGGTGTAGTGGAATGAGGCTGG - Intergenic
1176804044 21:13462866-13462888 TGGGTGCAGTGGACTGAGGATGG + Intergenic
1176806614 21:13489901-13489923 TGGGTGCAGTGGAATGAGGCTGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179595846 21:42442718-42442740 TTGCAGCAGGGGAGAGAGGTGGG + Intronic
1179852945 21:44147606-44147628 GTGGAGCAGGGGACTGAGTGTGG - Intergenic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180347456 22:11715899-11715921 TTGGTGTAGTGGAATGAGGCTGG - Intergenic
1180355220 22:11834007-11834029 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1180383031 22:12158320-12158342 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1182236781 22:28883024-28883046 TTGGGGCGGGGGAAGCAGGAAGG + Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182402208 22:30087184-30087206 ATGGAACATGGGAACGAGGAAGG + Intronic
1182522471 22:30892183-30892205 TTAGAGGAGGAGCATGAGGAGGG + Intronic
1182541391 22:31044594-31044616 GTGGAGCTGGTGAATGTGGAGGG + Intergenic
1183138481 22:35913842-35913864 TAAGAAAAGGGGAATGAGGAAGG + Intronic
1183286574 22:36968744-36968766 TAGGAGGAGGGGAAGAAGGAAGG - Intergenic
1183324502 22:37184043-37184065 TTTGGGGAGGGCAATGAGGAGGG + Intronic
1183334043 22:37236638-37236660 GTGGAGGAGGGGAATGGGGCAGG + Intronic
1183826929 22:40395760-40395782 TTGGATGTGGGGAATGAGAATGG - Intronic
1183854677 22:40623224-40623246 TTGGAGCTGGGTAAAGGGGAGGG - Intronic
1184092504 22:42299895-42299917 TTGGAGCGGGTGGAGGAGGAGGG + Intronic
1184176823 22:42793590-42793612 TTCCAGCAGGGGACTGGGGATGG + Intergenic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1185142133 22:49108434-49108456 CTGGATCTGGGGAGTGAGGATGG - Intergenic
949483116 3:4512491-4512513 TTTCATCAGGGGAATTAGGAAGG + Intronic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
949887024 3:8703723-8703745 TGGGGACAGAGGAATGAGGAAGG - Intronic
951707524 3:25558263-25558285 TTGTAGCAGAGCAATAAGGATGG - Intronic
952509127 3:34036397-34036419 TTGGAGGAGGGGAAAGGGAAGGG + Intergenic
952925859 3:38318700-38318722 TGGGGGCAGGGGAGTGGGGAGGG + Intergenic
953114330 3:39976896-39976918 TGGGAGGAGGGGAGTGGGGAGGG + Intronic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
953865012 3:46576367-46576389 TTGAGGCAGGAGAATGAGGCAGG + Intronic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
955075612 3:55610284-55610306 GGGGAGCTGGGGAATGAGGGGGG - Intronic
955108845 3:55927727-55927749 TTGGAGTCGGGGAGTGGGGATGG - Intronic
955298040 3:57751445-57751467 TTGGGGCACGGGGACGAGGAAGG - Intergenic
955621866 3:60873102-60873124 TTGGAGGAGGGGAACAAGGCAGG + Intronic
956920754 3:73926730-73926752 TTGGGGTAGAGGGATGAGGAAGG - Intergenic
956927245 3:74002710-74002732 TTGGGGCAGGGGAATCTTGAGGG - Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957841157 3:85671598-85671620 TTAGAGAAGGGGAAGGAGAAGGG - Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959355460 3:105322483-105322505 TTGGAGCACTGAGATGAGGAAGG - Intergenic
959394465 3:105819918-105819940 ATGGACCAGGGGCATGGGGATGG + Intronic
959739636 3:109702431-109702453 TTGTGGGAGGGGAATGAGAATGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960185648 3:114634918-114634940 TAGGAGCAAAGAAATGAGGAGGG + Intronic
960235863 3:115281296-115281318 TTGGAACAGGGAAAGGAGGATGG - Intergenic
960258041 3:115532787-115532809 CTGGAACATGTGAATGAGGATGG - Intergenic
961289140 3:125831408-125831430 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
961584793 3:127913519-127913541 TTGGGGGAGGGGGATGGGGACGG - Intergenic
961602742 3:128073594-128073616 TTGGGGCAGGGGAGTGAGGTGGG - Intronic
961941034 3:130637102-130637124 TTGGAGGAGGGGGAGGGGGAGGG - Intronic
962092144 3:132255579-132255601 TAAGAGCAGTGGAATGAGGGAGG + Intronic
962864954 3:139440801-139440823 TGAGAGGAGGGGAATGAAGAAGG + Intergenic
963081495 3:141399254-141399276 TGGGAGGTGGGGAATGGGGATGG - Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
964028116 3:152102968-152102990 TTGGAGGAAGGGAGGGAGGAAGG - Intergenic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
965318828 3:167226013-167226035 CTGGACCAAGGGAATGAGTATGG - Intergenic
965781241 3:172288400-172288422 TTGGAGGAGGGTAATGAGACAGG - Intronic
965999437 3:174929415-174929437 TTAGAGGAGGAGAATAAGGAAGG - Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966211721 3:177460239-177460261 TGGGAGGAGGGGAAGGAAGAAGG + Intergenic
966422292 3:179745541-179745563 TGGGAGGAAGGGAAGGAGGAAGG - Intronic
966629031 3:182051369-182051391 TTGGAGGAGGGGAGTGATAAAGG - Intergenic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967428790 3:189358157-189358179 TTGGTGGTGGGGAATGAGTAGGG + Intergenic
967929771 3:194682548-194682570 TTGGAGGAGGGGCGAGAGGAAGG + Intergenic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969446368 4:7246958-7246980 TTCTAGCTGGGGAATAAGGAAGG - Intronic
969804851 4:9599295-9599317 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
970738998 4:19210668-19210690 TGGGAGGTGGGAAATGAGGATGG + Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
972352001 4:38244565-38244587 TGGAAGCAAGGGAAGGAGGAGGG - Intergenic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972708639 4:41571349-41571371 TCGGAGCAGGGGAAAGGAGACGG + Intronic
973141473 4:46773942-46773964 ATGGAACAAGGGAATTAGGAGGG - Intronic
973372943 4:49266610-49266632 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
973388056 4:49528449-49528471 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974434426 4:61839040-61839062 GTGGAGCAAGGAAATGGGGAAGG + Intronic
975206191 4:71646356-71646378 TTGAAGCAGGGAAGTGAGGGTGG + Intergenic
975785986 4:77888853-77888875 TTGGAGTAGGGGACGGGGGAGGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977459613 4:97308957-97308979 TTGGGGCAGGGGAGAGAGAAGGG - Intronic
978311119 4:107385973-107385995 TCTGAGCAGTGGAAAGAGGACGG + Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978924831 4:114230964-114230986 TGGGAGCAGGAGAAAGAGGGTGG + Intergenic
979342933 4:119549277-119549299 TTGGAGCATTGGAATGATGTAGG + Intronic
979748160 4:124242994-124243016 TTGGAGCTGGGTAATGGGTAAGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980891360 4:138818736-138818758 GAGGAGCGGGGGAAGGAGGAAGG + Intergenic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982475895 4:155850122-155850144 AGGGAGCAGGGGAATGGGAAAGG + Intronic
983566044 4:169152962-169152984 GTGGAGCTGTGGAATTAGGAGGG - Intronic
983580649 4:169306400-169306422 TTGGAAGAGGGGAAGGAGGGAGG + Intergenic
983856089 4:172647174-172647196 TGGGTGAAAGGGAATGAGGATGG - Intronic
985148384 4:186919152-186919174 TGGAAGTACGGGAATGAGGATGG + Intergenic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985341068 4:188955295-188955317 TTGGAGCAGGAGACAGAGCAAGG + Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986020409 5:3796366-3796388 TGGGTGCAGGGGAATCAGGCTGG - Intergenic
986349731 5:6866495-6866517 TTGAATCAGTGGACTGAGGAAGG + Intergenic
986631607 5:9779197-9779219 ATGGAGCAAGGGAGAGAGGAAGG - Intergenic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987241224 5:16002022-16002044 TGGGAGGAGGGGAATGAAGAGGG - Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
988347957 5:30064640-30064662 TTGTGGGAGGGGAATGAGGGAGG + Intergenic
988549308 5:32185858-32185880 TGGGAGCAGGGGAGGGAGAAGGG - Intergenic
988585717 5:32505788-32505810 TTGGAGCAGGGGCATTGGGCAGG - Intergenic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
991917945 5:71623927-71623949 TTTGAGTAGGGGAAGAAGGATGG - Intronic
992263217 5:74991293-74991315 TTGGAGCAGAGGGTTAAGGAAGG - Intergenic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993605770 5:89989264-89989286 TTGGAACCTGGGAAAGAGGAGGG - Intergenic
994305353 5:98196568-98196590 TCTGAGAAGGGGAATGAGAAAGG + Intergenic
995574810 5:113518242-113518264 TTAGTGCAGTGGAATGATGACGG + Intronic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995865563 5:116686573-116686595 TAGGAGGAGGGGATGGAGGAGGG + Intergenic
996643012 5:125780106-125780128 TTGGAGTAGGACAAAGAGGATGG - Intergenic
997659532 5:135578800-135578822 TGGGAGCAGGGACATGGGGAGGG + Exonic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
998226878 5:140334036-140334058 TTGGTGGAGGGGAATCAGAAGGG + Exonic
998732502 5:145096524-145096546 TGGGAGTAGGGGAAAGAGGTGGG - Intergenic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999937964 5:156508475-156508497 TTGAAGGTGTGGAATGAGGACGG - Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000295663 5:159911426-159911448 TGGGAGCTGGGGAGTGAGGCGGG - Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1001041908 5:168342225-168342247 TTGGAGCAGAGGAAGGGAGAGGG + Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001321172 5:170683005-170683027 TTAAAGCAGGGGAAGGAAGATGG - Intronic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1003178124 6:3769071-3769093 TTGGGGCGGGGGAATGGGGGAGG - Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004239593 6:13907984-13908006 AGGGAGGAAGGGAATGAGGAAGG - Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006088854 6:31616035-31616057 TTTCAGCAGGGGACTGAGGAAGG - Intronic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1006397203 6:33795270-33795292 CTGGAGCAGGGGAGTGGGGTGGG + Intronic
1006478568 6:34273711-34273733 TTGGAGCAGGTGGAGGAGGTGGG - Intergenic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006649292 6:35537560-35537582 TTGGAGGATGGTAATCAGGATGG + Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007211112 6:40194053-40194075 TTGTAGCAGGGAAAGGAGGCTGG - Intergenic
1007341481 6:41193909-41193931 TAGGGTCAGGGGGATGAGGATGG - Intronic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008460546 6:51764908-51764930 TTGGAGCATGGGATTGAGATTGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011556703 6:88576831-88576853 GAGGAGCAGGTGAATGAAGAAGG + Intergenic
1011772925 6:90694917-90694939 TTGGAGCAGGGCAATAAGAAGGG - Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1012947455 6:105482897-105482919 TTGGAGGAGGGGAGTGGGGGGGG - Intergenic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015885198 6:137910674-137910696 TGGGAGGAGGGAAAGGAGGAAGG + Intergenic
1015891462 6:137973763-137973785 TTGGAGCAGGGGGTGGAGGATGG + Intergenic
1016126215 6:140407635-140407657 TTGGAACTGGGTAATGAGCAAGG + Intergenic
1016390042 6:143565645-143565667 ATGGAGCAGGGGCATTAGGTGGG + Intronic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016772748 6:147870349-147870371 TTGGAGGCAGGGAATGGGGATGG - Intergenic
1016793278 6:148089491-148089513 TGGGAGCAGGGAAGAGAGGAAGG + Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017541208 6:155404904-155404926 TTGAAGGAGGTTAATGAGGAGGG - Intronic
1018248160 6:161841941-161841963 TTGCAGCAGGGGAAGGAGATTGG - Intronic
1018292243 6:162303891-162303913 TGGGAGGATAGGAATGAGGAGGG + Intronic
1018361751 6:163077866-163077888 TATGAACAGGGGAATGAGGAAGG + Intronic
1018672308 6:166189760-166189782 TTGGAGCAGCTGAGTGAGGGAGG - Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019508352 7:1404798-1404820 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508367 7:1404832-1404854 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508382 7:1404866-1404888 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508397 7:1404900-1404922 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019710892 7:2517754-2517776 TGGCTGCAGGGGATTGAGGAGGG + Intronic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1021196297 7:17678240-17678262 TTGGGGCATGGGAGTGAAGAAGG + Intergenic
1021322045 7:19224350-19224372 TAAGAGCAGGGGAAGGAGGGAGG + Intergenic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021920951 7:25484260-25484282 TTTAATCAGGGGAATGAGAAGGG + Intergenic
1022577550 7:31512711-31512733 TGGGAACAGGGAAATAAGGATGG + Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023136225 7:37055497-37055519 TTTGGGCAGGTGAATGTGGAAGG - Intronic
1023526271 7:41107047-41107069 TTGGAGTAGGGGAAAGGGCAAGG - Intergenic
1023854676 7:44175475-44175497 TGGGAGCAGGAGAATGAGAGGGG + Intronic
1024713115 7:52040242-52040264 CTCCACCAGGGGAATGAGGAGGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026844488 7:73690430-73690452 TTGGAGGAAGGGAACAAGGAGGG + Intronic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1027630881 7:80604128-80604150 CTAGAGGAGGGGAATGAGGTTGG + Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028451788 7:90993446-90993468 TTGGAGCAGGCAAGAGAGGATGG + Intronic
1028516974 7:91688445-91688467 TTGGAGATGGGGCATGTGGAAGG - Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1031072668 7:117179634-117179656 TTAGAGCAGAGGGATGAGGAGGG + Intronic
1031998375 7:128247675-128247697 TTCCAGCAGGGGAATCAGGGAGG - Intronic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1035053829 7:156020357-156020379 TTGGAGCAGGGGTAGGGGGCAGG + Intergenic
1035108787 7:156463418-156463440 TGGGAGCAGGGGGAAGAGGTGGG + Intergenic
1035528177 8:330942-330964 TAGGAGCAGGGACTTGAGGAAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036393724 8:8348525-8348547 TTGGAACAGAGGATTTAGGAGGG - Intronic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1036981250 8:13472337-13472359 TTGGGGGAGGGGAATGAGTGAGG + Intronic
1037045712 8:14300373-14300395 AGGGAGGAAGGGAATGAGGAAGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037633665 8:20680449-20680471 TTGGAGCATGTGAGGGAGGAAGG - Intergenic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1038417408 8:27407295-27407317 TTGGAGCAAGAGAATCATGAAGG - Intronic
1038483868 8:27919981-27920003 TTTGAGCAGGGGGATGACGTGGG + Intronic
1038613452 8:29073078-29073100 TACGAGGAGGGGTATGAGGAGGG + Intronic
1038792630 8:30681872-30681894 TGGGGGCAGGGGAAAGAGGAAGG + Intronic
1038795236 8:30703776-30703798 GGGGAGCAGGGGAAGGAAGAAGG + Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039344959 8:36693442-36693464 TTGGAACAAGGAAATGTGGATGG - Intergenic
1039405569 8:37309658-37309680 TTGGAGCAGGGGGGTGAAGCAGG - Intergenic
1039775474 8:40732057-40732079 TGGGAGGAGGGGAATCAGGGAGG + Intronic
1040433319 8:47365225-47365247 TTGGACCACGTGAATGTGGAAGG - Intronic
1040485602 8:47868810-47868832 TTGCTGCTGGGGGATGAGGAAGG - Intronic
1040840192 8:51776796-51776818 TTGCAGGAGGGGAAAGAGGTGGG - Intronic
1041311109 8:56517503-56517525 GAGGAGGAGGGGAAAGAGGAGGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041588878 8:59552620-59552642 TTGGGGGAGGGACATGAGGAGGG - Intergenic
1042299619 8:67263089-67263111 TGGGAGCAGAGGAAGGAGAAGGG - Intronic
1042817532 8:72894099-72894121 TTGGGGTAGGTGAATGATGAAGG + Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043291522 8:78607624-78607646 TTAGAGGAGAGGAATGAGAATGG - Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044365087 8:91335975-91335997 TTGGAGCCTGGAAGTGAGGACGG - Intronic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044893530 8:96863213-96863235 TTGGAGCAGGGGGAGGATGATGG + Intronic
1044933196 8:97269767-97269789 TTGGAGCTGGGGAATTGTGAGGG + Intergenic
1045207741 8:100060158-100060180 TTGAAGCAAGGGAAAGAGAATGG - Intronic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1046710583 8:117506713-117506735 TTGGACCATGGGAGTGACGAAGG - Intergenic
1046991243 8:120457832-120457854 TTGAGGCAGGAGAATGAGGCAGG + Intronic
1047473823 8:125205718-125205740 TTGAAGCAGGGGAGTGGGGGAGG + Intronic
1047655738 8:126974976-126974998 CTGCAGCAGGTCAATGAGGAAGG - Intergenic
1048490280 8:134885594-134885616 TGGGAGCATGGGGATGGGGAGGG + Intergenic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1049076531 8:140400755-140400777 CGGGAGCAGGGAAAGGAGGAAGG + Intronic
1049108768 8:140629870-140629892 GGGGAGCAGGGGGAAGAGGAGGG + Intronic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049666607 8:143846751-143846773 TCAGGGCAGGGGAAAGAGGAGGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050478451 9:6064880-6064902 TTGCTGAAGGGGCATGAGGAAGG + Intergenic
1050733540 9:8736906-8736928 CGGGAGGAGGGGAATGGGGAGGG - Intronic
1051582598 9:18694175-18694197 TTGGAGGAGGGGGCTGGGGAAGG - Intronic
1051951650 9:22641928-22641950 GTGAAGCAGGGGAACCAGGACGG + Intergenic
1051970346 9:22879748-22879770 TTGGGGGATGGCAATGAGGATGG + Intergenic
1052283800 9:26761959-26761981 AGGGAGCAGGGGATGGAGGAGGG + Intergenic
1052918200 9:33939994-33940016 GAGGAGGAGGGGAAAGAGGAGGG + Intronic
1053174088 9:35909900-35909922 TGGGGGCAGGGACATGAGGAGGG - Intergenic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1053905907 9:42844582-42844604 TTGGTGCAGTGGAATGAGGTTGG - Intergenic
1054351938 9:64025394-64025416 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1054707456 9:68477534-68477556 TTGCAGCAGGGCAATGAGAATGG - Intronic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054990375 9:71318924-71318946 TTGGAGCTGGGGACTGGGGCAGG - Intronic
1057282411 9:93722395-93722417 TGGAAGCAGTGGATTGAGGAAGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057372497 9:94486944-94486966 TTGGTGCAGTGGAATGAGACTGG - Intergenic
1057387136 9:94614183-94614205 GAGGAGCAGGGGGAGGAGGAGGG + Intronic
1057861212 9:98642250-98642272 TTGGACGAGGAGACTGAGGAAGG - Intronic
1059131422 9:111754919-111754941 TTTGAGCATGGGAAATAGGAAGG + Intronic
1059179877 9:112201599-112201621 TTGAGGCAATGGAATGAGGAAGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059621615 9:116012019-116012041 TTGGACTTGGGGTATGAGGAAGG + Intergenic
1059747858 9:117220281-117220303 GGGGAGCTGGGGAATGAGCAGGG - Intronic
1060061110 9:120460567-120460589 TTGCAGCAGAGTAATGAGGTAGG - Exonic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1061668082 9:132172064-132172086 TAGGAGCTGGGGAAGGAGGAGGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1203696653 Un_GL000214v1:104635-104657 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
1203552562 Un_KI270743v1:176393-176415 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186502976 X:10066704-10066726 TTGGAGCCGGGGAGAGAGGCTGG + Intronic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1187437089 X:19281767-19281789 CTAGAGCAAGGCAATGAGGAGGG + Intergenic
1187778066 X:22786229-22786251 TTGAAGCAGGACAATGAGCATGG - Intergenic
1187944388 X:24412146-24412168 AAAGAGCAGGGGAATGAAGAAGG - Intergenic
1188131714 X:26442903-26442925 TTGGTGCAGGAGAATGAGTGGGG - Intergenic
1188266241 X:28079164-28079186 TTGATGCAGGGGAATAAGGAAGG + Intergenic
1189363295 X:40369631-40369653 TTGGGGCAGGGGAGTGGGGAGGG + Intergenic
1189374423 X:40455585-40455607 TGGGAGCAAGGGAGAGAGGAGGG + Intergenic
1190057855 X:47192253-47192275 GCGGCGCAGGGGAATGGGGAGGG - Intronic
1190116213 X:47627584-47627606 TTGGAGCAGGTGACAGAGCAAGG + Exonic
1190243803 X:48677238-48677260 TTGCAGCAGGGGAAAGAAAAGGG + Intronic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1191759436 X:64630537-64630559 TTGGAGGAGAGGTATGTGGATGG + Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1191882606 X:65857601-65857623 TAGGAGCAGGGCAATGCTGAAGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1193272598 X:79546306-79546328 TTGGAGCAGGGTAATGGGTAGGG - Intergenic
1194538693 X:95142448-95142470 TTGGATTAGTGGAATGAGTAAGG + Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1194988151 X:100513510-100513532 GTGGAGCAGGGCAATGAGTCTGG + Intergenic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196430011 X:115614296-115614318 TTGCAGCAGGGGAAAAATGATGG + Intronic
1197286924 X:124606689-124606711 TTGGAGGAATGGAATGAGCATGG + Intronic
1197365849 X:125563624-125563646 TGGGAGCAGGGGGAGGAGGGGGG + Intergenic
1197558653 X:127990706-127990728 TTGGAACTGGGTAATGAGCAGGG + Intergenic
1197798384 X:130322424-130322446 TAAGGGCAGGGGAAAGAGGAAGG - Intergenic
1197886092 X:131219983-131220005 TGGGAGAAGGGGAATGGTGAGGG + Intergenic
1198272662 X:135068985-135069007 TCCGAGCAGGGGAATGAGGTAGG + Intergenic
1198626539 X:138582156-138582178 TGGGGGTAGGGGAGTGAGGAGGG - Intergenic
1198786909 X:140298680-140298702 GTGGAGCAGGGGCAAGATGAAGG - Intergenic
1198929931 X:141844339-141844361 TTTCAGCAAGGGAATGAGAAGGG - Intronic
1199229232 X:145416460-145416482 TTTGAGCAGGGTAATGATGCAGG - Intergenic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1201153826 Y:11111966-11111988 TTGGTGCAGTGGAATGAGGCTGG - Intergenic