ID: 1166945184

View in Genome Browser
Species Human (GRCh38)
Location 19:46391872-46391894
Sequence TCCACACAGCTCCACGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166945184_1166945187 0 Left 1166945184 19:46391872-46391894 CCTCTCCCGTGGAGCTGTGTGGA 0: 1
1: 0
2: 1
3: 15
4: 284
Right 1166945187 19:46391895-46391917 CAGCGCTTATTTTCCCCGCATGG 0: 1
1: 0
2: 0
3: 0
4: 48
1166945184_1166945192 24 Left 1166945184 19:46391872-46391894 CCTCTCCCGTGGAGCTGTGTGGA 0: 1
1: 0
2: 1
3: 15
4: 284
Right 1166945192 19:46391919-46391941 TGCGACAGCGTGCTGGAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 91
1166945184_1166945191 17 Left 1166945184 19:46391872-46391894 CCTCTCCCGTGGAGCTGTGTGGA 0: 1
1: 0
2: 1
3: 15
4: 284
Right 1166945191 19:46391912-46391934 GCATGGATGCGACAGCGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166945184 Original CRISPR TCCACACAGCTCCACGGGAG AGG (reversed) Intronic
900645892 1:3708630-3708652 CCCAGACAGCTTCAGGGGAGGGG + Intronic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902236825 1:15063017-15063039 TCCAATTAGCTCCACGGTAGTGG + Intronic
902628035 1:17688255-17688277 TACACACAGCTACGCAGGAGGGG - Intronic
902756562 1:18552899-18552921 TCCACACAACTCCTAAGGAGTGG + Intergenic
903499266 1:23792658-23792680 ACCACACGGCTCCACGGCGGGGG - Exonic
905365542 1:37449201-37449223 TGCACACAGCTGCCAGGGAGTGG + Intergenic
906478899 1:46187652-46187674 TCCACACAGGCACACGGCAGAGG - Intergenic
906550216 1:46659413-46659435 TCCACACTGAGCCATGGGAGAGG + Intronic
906610517 1:47198699-47198721 TCCACAGTGCTCCAGGTGAGAGG + Intergenic
908624865 1:66028713-66028735 TCCACAAATCTCTAGGGGAGGGG + Intronic
908885127 1:68780358-68780380 TCCACAGATCTCCAGGGCAGGGG - Intergenic
909293395 1:73912864-73912886 TCCACAGATCTCCAGGGCAGGGG + Intergenic
909457703 1:75869220-75869242 TCCACAGATCTCCAGGGCAGGGG - Intronic
909794804 1:79719818-79719840 TCCACAGATCTCCAGGGCAGGGG + Intergenic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
911104342 1:94118183-94118205 TCCGAACAGTTCCACGAGAGAGG - Intronic
911799095 1:102110802-102110824 TCCACACATCTCTAGGGCAGAGG + Intergenic
912907222 1:113719476-113719498 TCCACAAATCTCTAAGGGAGGGG + Intronic
913490717 1:119377254-119377276 TCCACAGATCTCTAAGGGAGGGG + Intronic
915058504 1:153159276-153159298 ACCACACATCTCCAGGGCAGAGG + Intergenic
916075136 1:161196292-161196314 TCCACACAGGTCCTGTGGAGAGG + Exonic
917681901 1:177375951-177375973 TCCACAAATCTCCAGGGCAGAGG + Intergenic
918935180 1:190912586-190912608 TCCACAGATCTCCAGGGCAGGGG + Intergenic
918955793 1:191205336-191205358 TCCACACATCTCTAGGGCAGGGG - Intergenic
919200326 1:194348378-194348400 TCCACAAATCTCCAGGGCAGGGG - Intergenic
919273662 1:195384606-195384628 TCCACAAATCTCTAGGGGAGTGG - Intergenic
919292004 1:195644237-195644259 TCCACAGATCTCTACGGCAGGGG + Intergenic
919388790 1:196955178-196955200 TCCACACATCTTCAGGGCAGGGG + Intronic
922706562 1:227793628-227793650 TCCAGCCAGCTGCACGGAAGAGG + Intergenic
922791945 1:228315728-228315750 TCCACATAGCTTCTGGGGAGGGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923805320 1:237251332-237251354 TCCCCACAGCTCCACTGAAATGG + Intronic
924947962 1:248858581-248858603 TCCCCACAGCTCCACTTCAGTGG - Exonic
1065371024 10:24986531-24986553 CCCACAGTGCTCCACAGGAGTGG + Intronic
1066098883 10:32099144-32099166 TCCACAGAGCTCTAGGGCAGGGG + Intergenic
1069173690 10:65263306-65263328 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1073401245 10:103259413-103259435 TCCACAAATCTCCAGGGCAGGGG - Intergenic
1075281739 10:121144552-121144574 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1075421113 10:122301423-122301445 TGCAGACAGCTCCTGGGGAGGGG - Intronic
1077135699 11:997236-997258 TGCACACAGCTCCTTGGGGGAGG + Intronic
1077544318 11:3162627-3162649 CCCATACATCTCCACGGGAAAGG + Intronic
1079500327 11:21095140-21095162 TCCACACATCTCTAGGGCAGGGG + Intronic
1079838727 11:25367416-25367438 TCCACACATCTCTACGGCAGGGG + Intergenic
1080449824 11:32369497-32369519 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1080663284 11:34314556-34314578 TGCACACAGCTGCAAGGGAGAGG + Intronic
1080959931 11:37146339-37146361 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1085754865 11:79193903-79193925 TCCAGACAGGGCCATGGGAGTGG + Intronic
1086503591 11:87479061-87479083 TCCACACATCTCTAGGGCAGGGG - Intergenic
1088177064 11:107065707-107065729 TCCACACATCTCAAAGGGACAGG + Intergenic
1089118315 11:116113825-116113847 TCCACACACCTGCACAGGATAGG + Intergenic
1089289050 11:117426821-117426843 TCCTCTCAGCTCCTAGGGAGCGG + Intergenic
1092904380 12:13088740-13088762 GCCACAAAGCCCCAAGGGAGGGG + Intronic
1093605033 12:21078786-21078808 TCCACAGATCTCCAGGGTAGGGG + Intronic
1094716108 12:33016868-33016890 TCCACACATCTCCAGGGTGGGGG - Intergenic
1094738189 12:33259233-33259255 TCCACAGAGCTCTAGGGCAGGGG - Intergenic
1095131656 12:38549584-38549606 TCCACAGATCTCCAGGGCAGGGG + Intergenic
1098231160 12:68373203-68373225 TCCAAACTGCTCCACAGGATTGG - Intergenic
1099386361 12:82018291-82018313 TCCACAGATCTCCAGGGCAGGGG - Intergenic
1100142212 12:91633012-91633034 TCCACAGAGCTCCACCAGGGTGG + Intergenic
1101083687 12:101214213-101214235 TCCACAAATCTCCAGGGCAGGGG - Intergenic
1101117905 12:101549816-101549838 TCCACAAATCTCTACGGTAGGGG + Intergenic
1101923441 12:108951891-108951913 GCCACACAGATCCCCAGGAGGGG - Intronic
1103016457 12:117498455-117498477 TCCACACTGGCCCAGGGGAGGGG + Intronic
1106033394 13:26022725-26022747 TCCACCCTGCCCCAGGGGAGGGG - Exonic
1106619245 13:31357614-31357636 TCCACCCAGATCCACGCCAGAGG - Intergenic
1107916947 13:45162037-45162059 TCCTCACAACTCCACGAGGGAGG + Intronic
1108155975 13:47584848-47584870 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1109390112 13:61682181-61682203 TCCACACATCTCTAGGGCAGGGG - Intergenic
1110926941 13:81165167-81165189 TCCACAGATCTCCAGGGAAGGGG + Intergenic
1111143756 13:84155400-84155422 TCCACAGATCTCTAGGGGAGGGG - Intergenic
1111212560 13:85098464-85098486 TCCACAGATCTCCAGGGCAGGGG - Intergenic
1114380437 14:22198142-22198164 TCCACAAATCTCCAGGGCAGGGG - Intergenic
1114839686 14:26248663-26248685 TCCACACATCTCTAAGGCAGGGG - Intergenic
1115113597 14:29854407-29854429 TCCACACATCTCTAGGGCAGGGG - Intronic
1115609275 14:35035911-35035933 TCCACAAATCTCCAGGGCAGAGG + Intergenic
1116378470 14:44232988-44233010 TCCACAGATCTCTACGGCAGGGG + Intergenic
1118365014 14:65087277-65087299 TTCTCACAGCTCCACTAGAGAGG - Intronic
1118662466 14:68029065-68029087 CCTGAACAGCTCCACGGGAGAGG - Intronic
1119004132 14:70908321-70908343 GCCACACAGCCCCACGGGCGGGG - Intronic
1119100990 14:71880110-71880132 TCCACAAATCTCTAGGGGAGGGG - Intergenic
1120418909 14:84257041-84257063 TCCACATGGCTTCACTGGAGAGG + Intergenic
1121587775 14:95075237-95075259 ACCACACAGAACCACGGGGGTGG + Intergenic
1121611438 14:95283673-95283695 TCCACACATCTCTAGGGCAGGGG - Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122747876 14:103910389-103910411 TGCACAGAGAGCCACGGGAGTGG - Intergenic
1124254730 15:28131367-28131389 ACCCCACAGCCCCACGAGAGAGG + Intronic
1124364574 15:29062884-29062906 TCCCCACAGCCCCACGAGATGGG - Intronic
1125348419 15:38742715-38742737 TCCACACAGCTTGACTGGTGTGG + Intergenic
1129598315 15:76982193-76982215 TCCACACAGCTGCAAGGACGAGG - Intergenic
1130112205 15:80975061-80975083 TACACATGGCTCCACTGGAGAGG - Intronic
1131768005 15:95701236-95701258 TCCACAAATCTCTAGGGGAGGGG + Intergenic
1135057082 16:19240607-19240629 TCCACTCTGGTCCACGGGACTGG + Intronic
1136600654 16:31285073-31285095 TCTAAACAGGTCCACGTGAGGGG + Intronic
1137521008 16:49195452-49195474 TACACTCAGCTGCAGGGGAGGGG - Intergenic
1139690533 16:68638835-68638857 AGCACACAGCGCCAAGGGAGGGG + Intronic
1140211965 16:72977609-72977631 TCCACACAGCTCTTGAGGAGAGG + Intronic
1145022490 17:19442690-19442712 TCCACAGATCTCTAGGGGAGGGG - Intergenic
1146231554 17:31115368-31115390 TCCACACAGTTCCACTGAACTGG - Intronic
1148390603 17:47269458-47269480 TCCACAGAGCTCTAGGGCAGGGG + Intronic
1151576853 17:74956827-74956849 TGCACACAGCTGCTGGGGAGAGG - Intronic
1152903977 17:82960591-82960613 TCCTCACAGTGACACGGGAGAGG + Intronic
1155036241 18:22027086-22027108 TCCACACCTCTGCAGGGGAGAGG + Intergenic
1156366217 18:36429717-36429739 TTCACACAGCTTCATGGGTGCGG - Intronic
1156583703 18:38409053-38409075 TCCACAGATCTCTAGGGGAGGGG - Intergenic
1156858929 18:41814287-41814309 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1157053522 18:44198136-44198158 TCCAAACAGCTCCTGGGAAGGGG + Intergenic
1157505435 18:48222948-48222970 GCCACACAGCTCCAGGGGCAGGG - Intronic
1158216913 18:55110111-55110133 TACATACACCTCCAGGGGAGTGG + Intergenic
1160573878 18:79837558-79837580 TCCACAGATCTCTACGGCAGGGG + Intergenic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163823374 19:19509100-19509122 GCCACAAAGCTCCAGAGGAGAGG - Intergenic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1166991790 19:46697287-46697309 CCCAAGCAGCTCCACGGGATAGG - Intronic
927605536 2:24483397-24483419 TCCACACATCTCTAGGGCAGGGG - Intergenic
927611983 2:24549988-24550010 TCCACAAACCTCCAGGGCAGGGG + Intronic
928474786 2:31615471-31615493 TCCACAGATCTCCAGGGCAGGGG - Intergenic
928582904 2:32726423-32726445 TCCACACATCTCTAGGGCAGGGG + Intronic
929578298 2:43066489-43066511 ACCACACAGCCACATGGGAGGGG - Intergenic
929687607 2:44047957-44047979 TACTCACAGCTCCACGTGGGTGG + Intergenic
930442928 2:51431833-51431855 TTCACACATCTCCAGGGCAGGGG - Intergenic
930687457 2:54324955-54324977 TCCACAGATCTCCAGGGCAGGGG - Intergenic
931096045 2:58942438-58942460 TCCACAGATCTCTACGGCAGGGG - Intergenic
931119305 2:59198828-59198850 TCCACACATCTCAAGGGCAGGGG - Intergenic
933723122 2:85410585-85410607 TCCACACAGCCCCACCACAGTGG + Intronic
933790675 2:85881608-85881630 TCCACACATTTCTACGGCAGGGG - Intronic
937313240 2:120915028-120915050 TCCAGCCAACGCCACGGGAGAGG - Intronic
939508229 2:143075259-143075281 TCCACAAATCTCCAGGGCAGAGG - Intergenic
942131162 2:172881109-172881131 TCCACACACCTCCACAAGCGTGG - Intronic
943006622 2:182393755-182393777 TCCACAGATCTCCAGGGCAGGGG + Intronic
943205385 2:184887168-184887190 TCCACAAATCTCCAGGGCAGGGG + Intronic
943788089 2:191900924-191900946 TCCACAGATCTCCAGGGCAGGGG - Intergenic
944010225 2:194965655-194965677 TCCACAGATCTCCAGGGCAGGGG + Intergenic
945141104 2:206686938-206686960 TCCACTCTGCTCCTCAGGAGGGG - Intronic
945760134 2:213903888-213903910 TCCACACATCTCTAGGGCAGGGG + Intronic
947011590 2:225571969-225571991 TCCACAGATCTCCAGGGCAGGGG + Intronic
947659079 2:231853308-231853330 ACCAGACAGCTCCAAGAGAGAGG - Intergenic
948697718 2:239741684-239741706 TCCACCCAGCTCCATGTGTGTGG - Intergenic
1169592716 20:7163263-7163285 TCCACACATCTCTAGGGCAGGGG - Intergenic
1169966411 20:11222795-11222817 GGGACATAGCTCCACGGGAGAGG - Intergenic
1171102971 20:22403445-22403467 TCAGCATAGCTCCCCGGGAGCGG + Intergenic
1172100335 20:32481474-32481496 TCCACAGAGCCCCAGGGTAGGGG + Intronic
1173370241 20:42428605-42428627 GCCACTCAGCTTCACAGGAGGGG + Intronic
1173595381 20:44255771-44255793 TCCACTCTGGTCCAGGGGAGAGG - Intronic
1174602692 20:51737821-51737843 ACCAAACACCTCCACGGGACAGG + Intronic
1175052269 20:56166511-56166533 GCCACACAGCAGCACGTGAGTGG + Intergenic
1176156218 20:63622632-63622654 TCCACACAACTCCAAGGTAAAGG + Intronic
1177653496 21:23986937-23986959 TCCACAAATCTCTACGGCAGGGG - Intergenic
1178902661 21:36609778-36609800 TCCACACAGATTCAAGGGACAGG - Intergenic
1179625251 21:42645655-42645677 TCCACTCAGCTCCAAGTGTGGGG + Intergenic
1181158504 22:20941245-20941267 TCCACACACCACCACGGCATGGG - Intronic
1181474580 22:23160470-23160492 TCCTCACAGCCCCACCGGACAGG + Intronic
1182298987 22:29327554-29327576 TCCTCAGAGTGCCACGGGAGGGG + Intergenic
1182816731 22:33171097-33171119 TCCACAGATCTCTACGGCAGGGG - Intronic
1184697285 22:46147182-46147204 GCCCCACAGCTCCAGGGGGGTGG - Intergenic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
1184978593 22:48080524-48080546 TCCACACAGGTCCACGCAGGTGG + Intergenic
1185099964 22:48834682-48834704 CACACACAGCTCCACGGAGGAGG + Intronic
1185179199 22:49349540-49349562 TCCACACAGCCCTGCGAGAGAGG + Intergenic
951058310 3:18173594-18173616 TCCACAAATCTCCAGGGCAGGGG + Intronic
952105617 3:30066112-30066134 TCCACAAATCTCCATGGCAGGGG + Intergenic
954810567 3:53244743-53244765 CACACACAGCACCACGGGATGGG - Intronic
955471977 3:59295456-59295478 TCCACACATCTCTAGGGCAGGGG + Intergenic
956306331 3:67831098-67831120 TCCACACATCTCTAGGGCAGGGG - Intergenic
956558882 3:70551622-70551644 TCCACAAATCTCTACGGCAGGGG + Intergenic
959113843 3:102152603-102152625 TCCACACATCTCTAGGGTAGGGG + Intronic
959175545 3:102904821-102904843 TCCACACATCCCCACGTGTGTGG - Intergenic
959418420 3:106104572-106104594 TCCACCAAGCTCCTGGGGAGAGG - Intergenic
960255297 3:115505375-115505397 TCCACACATCTCTAGGGCAGGGG - Intergenic
962382397 3:134908552-134908574 TCCACAGAGCTCCACCAGCGTGG + Intronic
966368902 3:179225080-179225102 TCTACACAGGTCCACGGGAGGGG - Intronic
968175799 3:196548594-196548616 TCCACAGAGCTCTAAGGCAGGGG - Intergenic
968590533 4:1456914-1456936 TCCACAGAGCTCCAGGGCAGGGG + Intergenic
969340817 4:6539857-6539879 CCCACACAGCTGCACGGGCTTGG - Intronic
973718508 4:53700968-53700990 TCCACACATCTCTAGGGCAGGGG + Intronic
974178651 4:58358099-58358121 TCCACAGATCTCTAGGGGAGAGG - Intergenic
974923532 4:68270820-68270842 TCCACAGATCTCCAGGGCAGGGG + Intergenic
974931322 4:68364561-68364583 TCCACAGATCTCCAGGGCAGGGG - Intergenic
976286519 4:83376044-83376066 TCCACACATCTCTAGGGCAGGGG + Intergenic
978087227 4:104668575-104668597 TCCACACATCTCTAGGGCAGGGG + Intergenic
979183344 4:117757425-117757447 TCCACAAATCTCCAGGGCAGAGG - Intergenic
979700087 4:123657228-123657250 TCCACACATCTCTAGGGCAGAGG + Intergenic
979974835 4:127184154-127184176 TCCACAAATCTCCAGGGCAGGGG - Intergenic
982075932 4:151737322-151737344 TCCACACATCTCCAGGGCAGGGG - Intronic
982478450 4:155879939-155879961 TCCACAGACCTCCAGGGCAGGGG + Intronic
983431861 4:167660438-167660460 TCCACAAAGCTCTAGGGCAGAGG + Intergenic
983785832 4:171728720-171728742 TCCACAGAACTCTAGGGGAGAGG - Intergenic
984219539 4:176955984-176956006 TCCACAGATCTCCAGGGCAGGGG + Intergenic
985201341 4:187488323-187488345 TCCACACATCTCTAGGGCAGGGG - Intergenic
986258786 5:6124466-6124488 TCCACAAATCTCCAGGGCAGGGG + Intergenic
986397160 5:7342602-7342624 TCCACACATCTCTAGGGCAGGGG - Intergenic
987393739 5:17401388-17401410 TCCACCCAGCCCCACTGCAGTGG - Intergenic
987723167 5:21664105-21664127 TCCACACACCTCTAGGGCAGGGG + Intergenic
987873207 5:23647126-23647148 TCCACAAATCTCCAGGGCAGGGG - Intergenic
987927884 5:24365168-24365190 TCCACATAGCCCCATTGGAGGGG + Intergenic
988200004 5:28055251-28055273 TCCACACACCTCTAGGGCAGGGG + Intergenic
988472047 5:31548413-31548435 TCCACACATCTCTAGGGCAGGGG + Intronic
988768339 5:34406239-34406261 TCCACACATCTCTAGGGCAGGGG - Intergenic
990672471 5:58148498-58148520 TCCAAGGAGCTCCACAGGAGAGG - Intergenic
993200739 5:84812384-84812406 TCCACACATCTCTAGGGCAGGGG - Intergenic
995969770 5:117953876-117953898 TCCACAAAGCTCTATGGCAGGGG - Intergenic
995989776 5:118223419-118223441 TCCACATAGCTCTAGGGCAGGGG + Intergenic
996605320 5:125314166-125314188 TCCACACATCTCTAGGGCAGGGG + Intergenic
998759118 5:145412353-145412375 TCCACAGATCTCTACGGCAGGGG + Intergenic
999150866 5:149424974-149424996 TCCACAAAGCTCCATGGGAAGGG - Intergenic
999919703 5:156304896-156304918 TCCACAAATCTCCAGGGCAGGGG - Intronic
1000859469 5:166439002-166439024 TCCACAGATCTCCAGGGCAGGGG - Intergenic
1002102398 5:176863905-176863927 TCCACAAAGCACCAAGGGAGAGG - Intronic
1003007122 6:2392415-2392437 CCCAGAAAGCTCCACGGGGGAGG + Intergenic
1004218392 6:13723450-13723472 TCCCTCCAGCTCCACAGGAGAGG - Intergenic
1005340195 6:24836610-24836632 TTCACACAGCTAGACGGGACAGG + Intronic
1005483520 6:26277203-26277225 TCCCAACAGCTCCAAGGGAGTGG + Intergenic
1006234243 6:32614607-32614629 TCCCCACAGCTCCATATGAGAGG + Intergenic
1006327709 6:33366246-33366268 ACCACACGGCTCCATGGCAGGGG + Intergenic
1007122658 6:39396332-39396354 TGCACTCACCTCCATGGGAGTGG + Intronic
1007685790 6:43666635-43666657 TCCGCAAAGTTCCATGGGAGTGG + Intronic
1010324156 6:74545422-74545444 TCCACAAATCTCTAGGGGAGGGG + Intergenic
1010366704 6:75059608-75059630 TCCACAGATCTCCAGGGCAGGGG + Intergenic
1010610811 6:77952154-77952176 TTCTCACAGCTCCACAAGAGGGG - Intergenic
1011122007 6:83964421-83964443 TCCACAAATCTCCAGGGCAGGGG - Exonic
1013829661 6:114256521-114256543 TCCACACATCTCTAGGGCAGGGG + Intronic
1014449289 6:121564987-121565009 TCCACACATCTCCAGGGTGGGGG - Intergenic
1014714481 6:124848597-124848619 TCCACACATCTCTAGGGCAGGGG - Intergenic
1016424082 6:143915729-143915751 TCCACACATCTCTATGGCAGGGG - Intronic
1017232273 6:152085799-152085821 TCCACTCAGTTTCAAGGGAGAGG + Intronic
1019750062 7:2723670-2723692 TCCCCACAGCTTCAGGGCAGAGG + Intronic
1019791386 7:3016133-3016155 TGGACACAGCCCCACGGGAAGGG - Intronic
1021013110 7:15496139-15496161 TCCACTCATCTCCATGAGAGGGG - Intronic
1021175058 7:17440528-17440550 TCCACAGATCTCCAGGGCAGGGG + Intergenic
1023681670 7:42693865-42693887 TCCTCACAGCTCCACAGATGTGG + Intergenic
1024138059 7:46430619-46430641 TCCACACATCTCTAGGGGAAGGG + Intergenic
1024792706 7:52984966-52984988 TCCACACATCTCCAGGGAAGGGG - Intergenic
1025143673 7:56485964-56485986 TCTTCACAGCTCCACTGAAGAGG - Intergenic
1027544814 7:79514058-79514080 TCCACACAGTTGCACAGGAATGG - Intergenic
1028048324 7:86151793-86151815 TCCACAGATCTCCAGGGCAGGGG - Intergenic
1028745388 7:94321023-94321045 TCCACAAATCCCCAGGGGAGGGG + Intergenic
1031182107 7:118432347-118432369 TCCACAGATCTCCAGGGAAGAGG - Intergenic
1031806897 7:126317661-126317683 TCCACAGATCTCCAGGGCAGGGG + Intergenic
1032053079 7:128661928-128661950 TCCACACATCTCTAGGGCAGGGG - Intergenic
1032390964 7:131555303-131555325 TCAGCTCAGCCCCACGGGAGAGG - Intronic
1032453968 7:132057874-132057896 TCCACAGATCTCCAGGGCAGGGG - Intergenic
1032709109 7:134447119-134447141 TGCACACGGCTCCACTGGTGAGG + Intronic
1033871644 7:145761797-145761819 TCCACAGATCTCTACGGCAGGGG - Intergenic
1033910632 7:146259571-146259593 TCCACAGAGCTCTAGGGCAGGGG - Intronic
1034011365 7:147532279-147532301 TCCACACATCTCTAGGGCAGGGG + Intronic
1035263704 7:157676986-157677008 CTCACACAGCACCAGGGGAGGGG - Intronic
1035844947 8:2853047-2853069 TCCAAAGAGCACCACGTGAGCGG + Intergenic
1037863041 8:22419771-22419793 TCCACAATGCACCACGGAAGAGG + Exonic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1041849796 8:62378201-62378223 TCCACAGAGCTCTAGGGCAGAGG - Intronic
1042396056 8:68292896-68292918 CCCACTCAGGTCCACGGGACTGG - Intergenic
1042601251 8:70501936-70501958 TCCACAGATCTCTAGGGGAGGGG - Intergenic
1043584337 8:81749914-81749936 TCCACACATCTCTAGGGCAGGGG - Intronic
1043834828 8:85034093-85034115 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1043881032 8:85543090-85543112 TCCACACAGCACCACCATAGTGG - Intergenic
1046004201 8:108459021-108459043 TCCACACATCTCTAGGGCAGGGG + Intronic
1046618185 8:116500173-116500195 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1048675223 8:136770501-136770523 TCCACAAATCTCTAGGGGAGGGG + Intergenic
1049076230 8:140398575-140398597 TCCACAAATCTCCAGGGCAGGGG - Intronic
1049694892 8:143978297-143978319 CCCGCAGACCTCCACGGGAGGGG - Intronic
1049862826 8:144911895-144911917 TCCACACATCTCTAGGGCAGGGG - Intergenic
1050264125 9:3872056-3872078 TCCACAAATCTCCAGGGCAGAGG + Intronic
1050274590 9:3983693-3983715 TCCACACATCTCTATGGCAGGGG - Intronic
1052019291 9:23507735-23507757 TCCACACATCTCTAGGGTAGGGG - Intergenic
1052522140 9:29562313-29562335 TCCACACATCTCTAGGGCAGAGG - Intergenic
1052637351 9:31122038-31122060 TCCACAGATCTCTAGGGGAGGGG + Intergenic
1052889758 9:33687490-33687512 TCATCACAGCTCCAAGGGAGAGG - Intergenic
1053574433 9:39344586-39344608 TCCACACATCTCCAGGGCAGGGG - Intergenic
1053838997 9:42172834-42172856 TCCACACATCTCCAGGGCAGGGG - Intergenic
1054117460 9:61179215-61179237 TCCACACATCTCCAGGGCAGGGG - Intergenic
1054590295 9:67003351-67003373 TCCACACATCTCCAGGGCAGGGG + Intergenic
1055264044 9:74475371-74475393 TCCACAGATCTCTACGGTAGGGG - Intergenic
1056165288 9:83935165-83935187 TCCATTCAGCTTCAGGGGAGGGG + Intergenic
1057517646 9:95735605-95735627 TCCACACAGCTCCAGGTCTGTGG + Intergenic
1058004654 9:99902372-99902394 TCCACAAATCTCCAGGGCAGGGG + Intergenic
1058076449 9:100656697-100656719 TCCACAAATCTCTAGGGGAGGGG - Intergenic
1058188678 9:101886995-101887017 CCCTCCCAACTCCACGGGAGAGG - Intergenic
1060187386 9:121572016-121572038 TTCACACAGCTCCAAGGGGCTGG - Intronic
1060622573 9:125081450-125081472 TCCACAGATCTCCAGGGTAGGGG - Intronic
1061914058 9:133739882-133739904 TCACCACAGCTCCAGGGCAGTGG + Exonic
1186222645 X:7366106-7366128 TCCACAAATCTCCAGGGCAGGGG - Intergenic
1186372951 X:8965824-8965846 TCCACAGATCTCCAGGGCAGTGG + Intergenic
1186638053 X:11427438-11427460 TCCCCACAGGTCCACGGCTGAGG - Intronic
1187214587 X:17264301-17264323 TCCACAGACCTCTACGGAAGGGG - Intergenic
1188057433 X:25557792-25557814 GCCACACAGTTCCAAGGAAGAGG - Intergenic
1189088076 X:38047844-38047866 TCCACACATCTCTAGGGCAGGGG + Intronic
1190269750 X:48853383-48853405 TCCACAGATCTCCAAGGCAGGGG + Intergenic
1190641700 X:52486614-52486636 TCTTCACAGCTCCACTGAAGAGG + Intergenic
1190645972 X:52526251-52526273 TCTTCACAGCTCCACTGAAGAGG - Intergenic
1192278875 X:69662883-69662905 TCCACACATCTCTAGGGCAGGGG - Intronic
1193706321 X:84824197-84824219 TCCACAGATCTCTAGGGGAGGGG + Intergenic
1194089146 X:89564152-89564174 TCCACAAATCTCCAGGGCAGTGG + Intergenic
1194554292 X:95338108-95338130 TCCACACATCTCTAGGGCAGAGG + Intergenic
1196512900 X:116533018-116533040 TCCACAGATCTCTAGGGGAGGGG + Intergenic
1196605724 X:117655085-117655107 TCCACAGAGCTCTAGGGCAGGGG + Intergenic
1197373567 X:125654923-125654945 TCAACACAGCTCAATGGGATTGG - Intergenic
1198913471 X:141639030-141639052 TCCACAGATCTCCAGGGCAGGGG + Intronic
1198951762 X:142080131-142080153 TCCACACATCTCTAGGGCAGGGG + Intergenic
1199325375 X:146492790-146492812 TCCACAAATCTCCAGGGCAGGGG - Intergenic
1200441814 Y:3220202-3220224 TCCACAAATCTCCAGGGCAGTGG + Intergenic