ID: 1166946425

View in Genome Browser
Species Human (GRCh38)
Location 19:46399818-46399840
Sequence GGTCGCACAATGCCCAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166946425_1166946432 15 Left 1166946425 19:46399818-46399840 CCATCCTTGGGCATTGTGCGACC No data
Right 1166946432 19:46399856-46399878 CGGGAATAGTTAACAGTTGTGGG No data
1166946425_1166946431 14 Left 1166946425 19:46399818-46399840 CCATCCTTGGGCATTGTGCGACC No data
Right 1166946431 19:46399855-46399877 ACGGGAATAGTTAACAGTTGTGG No data
1166946425_1166946428 -4 Left 1166946425 19:46399818-46399840 CCATCCTTGGGCATTGTGCGACC No data
Right 1166946428 19:46399837-46399859 GACCTCTGCGCCTGTAAAACGGG No data
1166946425_1166946427 -5 Left 1166946425 19:46399818-46399840 CCATCCTTGGGCATTGTGCGACC No data
Right 1166946427 19:46399836-46399858 CGACCTCTGCGCCTGTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166946425 Original CRISPR GGTCGCACAATGCCCAAGGA TGG (reversed) Intergenic
No off target data available for this crispr