ID: 1166946869

View in Genome Browser
Species Human (GRCh38)
Location 19:46402777-46402799
Sequence TGCACCAGCACTGCGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166946869_1166946873 20 Left 1166946869 19:46402777-46402799 CCACATCACGCAGTGCTGGTGCA No data
Right 1166946873 19:46402820-46402842 GCAGTTCTCTTGCACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166946869 Original CRISPR TGCACCAGCACTGCGTGATG TGG (reversed) Intergenic
No off target data available for this crispr