ID: 1166946873

View in Genome Browser
Species Human (GRCh38)
Location 19:46402820-46402842
Sequence GCAGTTCTCTTGCACAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166946869_1166946873 20 Left 1166946869 19:46402777-46402799 CCACATCACGCAGTGCTGGTGCA No data
Right 1166946873 19:46402820-46402842 GCAGTTCTCTTGCACAGCTCAGG No data
1166946867_1166946873 30 Left 1166946867 19:46402767-46402789 CCAGTGGCTACCACATCACGCAG No data
Right 1166946873 19:46402820-46402842 GCAGTTCTCTTGCACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166946873 Original CRISPR GCAGTTCTCTTGCACAGCTC AGG Intergenic
No off target data available for this crispr