ID: 1166948306

View in Genome Browser
Species Human (GRCh38)
Location 19:46410739-46410761
Sequence CAAGGTGCTCAGCTTGATAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166948306_1166948309 7 Left 1166948306 19:46410739-46410761 CCTTTATCAAGCTGAGCACCTTG 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1166948309 19:46410769-46410791 TTTGAGGAAATGAAAACTATAGG 0: 1
1: 0
2: 3
3: 41
4: 466
1166948306_1166948307 -9 Left 1166948306 19:46410739-46410761 CCTTTATCAAGCTGAGCACCTTG 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1166948307 19:46410753-46410775 AGCACCTTGAGTTGCATTTGAGG 0: 1
1: 0
2: 2
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166948306 Original CRISPR CAAGGTGCTCAGCTTGATAA AGG (reversed) Exonic
901789721 1:11647844-11647866 CTAGGGGCCCAGCTTGATGAAGG + Intergenic
902999389 1:20254214-20254236 CAAGGTCCTCATCTTTAAAATGG - Intergenic
906055313 1:42911394-42911416 CAATGTCCTCAGCTTCATTAGGG + Intergenic
907133753 1:52120009-52120031 CAGGGTGATCTGCATGATAAAGG - Intergenic
910370137 1:86506714-86506736 CAAGGGCCTCTGTTTGATAATGG + Intergenic
910559626 1:88576637-88576659 CAAGGGGCTCAGTTTTATAATGG - Intergenic
910899048 1:92100005-92100027 GAATGTCCTCAACTTGATAAAGG - Intronic
913969458 1:143403438-143403460 CAATGTGCTCAGCTTGGCACAGG - Intergenic
914063835 1:144229037-144229059 CAATGTGCTCAGCTTGGCACAGG - Intergenic
914115315 1:144737317-144737339 CAATGTGCTCAGCTTGGCACAGG + Intergenic
916034469 1:160909308-160909330 CAAGGGCCTCTGCTTAATAATGG + Intergenic
917504975 1:175619179-175619201 CAAGTTGCCTAGCTTGCTAATGG + Intronic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
918087476 1:181257928-181257950 CAGAGTGTTCAGCATGATAAGGG - Intergenic
918985836 1:191624120-191624142 CAATGTGCTCAGCTAGAAATTGG - Intergenic
922537574 1:226392513-226392535 CAAGGAGCTCAGTCTGAGAAGGG - Intronic
922707788 1:227798746-227798768 CAAGGTCCTCATCTTGACAATGG - Intergenic
924847538 1:247788179-247788201 CAGGGTCCTCAGCTTTATCAGGG + Intergenic
1065664265 10:28041053-28041075 CAAGGTGCTCATGTTGTAAAGGG - Intergenic
1066688495 10:38003475-38003497 CCAGGTGATCAACTTAATAAAGG - Intergenic
1067272652 10:44805444-44805466 AAAGGTGCTCAGCCTGAGACTGG + Intergenic
1067891508 10:50140715-50140737 GAAGCTCCTCAGCCTGATAATGG + Intergenic
1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG + Intronic
1068852661 10:61761934-61761956 CAAAGTCCTCAGCTTAATAAGGG + Intronic
1077878881 11:6331857-6331879 CAATGTGCTCAGTTTGATGGAGG - Intergenic
1081488865 11:43551719-43551741 CTAGGTACTCAGTTTTATAAAGG + Intergenic
1083146266 11:60761494-60761516 CAAGGGCCTCTGTTTGATAATGG + Intronic
1086273988 11:85102626-85102648 GAACTTCCTCAGCTTGATAAAGG + Intronic
1088266625 11:107993639-107993661 AAATGTGCTGGGCTTGATAAGGG - Intergenic
1091849564 12:3684322-3684344 CAAGGTGCAAAGCAGGATAAAGG - Intronic
1092491612 12:8950227-8950249 CAAGGTACTCAACTGGAAAAAGG - Intronic
1092890798 12:12967496-12967518 GAAGCTGTTCAGCCTGATAAAGG + Intergenic
1093298401 12:17420525-17420547 CAAGGTTCTCAACCTGATAAAGG - Intergenic
1097976372 12:65691143-65691165 CAAGTTGCTCAGCTTCACACAGG - Intergenic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1098297215 12:69016091-69016113 CCAGGTGGACAGCTTGATAAAGG + Intergenic
1098861314 12:75713792-75713814 TAAAATGCTCAGCTTGATACTGG - Intergenic
1099315713 12:81079566-81079588 CAAGGTGCTCAGATTCTAAAGGG - Intronic
1100350608 12:93777946-93777968 CAAGGTTTTCAGCTTCAGAAAGG + Intronic
1103656289 12:122473741-122473763 GAAGGTGCCCTTCTTGATAATGG - Exonic
1104428021 12:128693981-128694003 CACGGAGCTCAGCCAGATAAAGG + Exonic
1106046588 13:26147584-26147606 CAATGTCCTCAGCTTCATCAGGG + Intronic
1106054265 13:26223190-26223212 CCAGGTGCCCAGCATAATAATGG - Intergenic
1106230203 13:27815576-27815598 CACCGTGCTCAGCCTGGTAAGGG - Intergenic
1111573955 13:90126077-90126099 CATGGTGCTCAGGTTTAAAATGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1117191244 14:53293876-53293898 CCAGGTGCTAAACTTCATAAAGG - Intergenic
1118026728 14:61776166-61776188 TAAAGCCCTCAGCTTGATAAAGG + Exonic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1125371757 15:38985223-38985245 CAAGGTGCTGAGATTTTTAAAGG + Intergenic
1126749547 15:51862926-51862948 CAAGGAGCTCATCTTCATCAAGG - Exonic
1127376379 15:58388893-58388915 GAAGGTGCACAGCTTGATGGTGG + Intronic
1127411943 15:58717957-58717979 GAACTTGCTCAGCTTGATAAAGG - Intronic
1127609013 15:60618912-60618934 AAAGGTGCTCAGCATAAAAAGGG + Intronic
1130351500 15:83096178-83096200 CAAGGTGCTGGGCTTCATTAGGG + Intergenic
1130635513 15:85615931-85615953 CAAGTTGCTCAGTGAGATAATGG + Intronic
1130854060 15:87825252-87825274 CAAGTTTCTCAGCTTTAAAATGG - Intergenic
1132306099 15:100813818-100813840 CAATGTCCTCAGCTTCATCAGGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133420392 16:5641726-5641748 CAAGGAGCTCAGCGGAATAAAGG + Intergenic
1133458422 16:5964149-5964171 AAAGGTGCTCAGCATGATCAGGG + Intergenic
1134827909 16:17299257-17299279 CATGGTGGCCAGGTTGATAAAGG - Intronic
1136091274 16:27921793-27921815 CAGGGTCCTCAACTTGAGAAGGG - Intronic
1137620477 16:49873493-49873515 CAAGGTGCTGAGCTTGGTGCTGG - Intergenic
1137733908 16:50710400-50710422 CAAAGTGCACAGCTTGTGAATGG + Intronic
1138401450 16:56748274-56748296 CAAGCTGTTCAGCTTGCTGAAGG - Exonic
1138895388 16:61198371-61198393 CAAGGTGTTCAGTTTTAAAAGGG + Intergenic
1139582718 16:67882887-67882909 CAAGGTGGTGGGCTTGAGAAAGG + Intronic
1146635529 17:34501569-34501591 CAGGTTGCTCAGCTAGTTAAGGG - Intergenic
1152968899 18:142518-142540 TAAAATGCTCAGCTTGAAAAGGG + Intergenic
1154447358 18:14446210-14446232 CCTGGTGCTCACCTTGATGAGGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156564174 18:38164700-38164722 CAAGGTCCCCAGCTTCATTAGGG + Intergenic
1159766135 18:72490440-72490462 CCAGGTTCTCAGCTGGGTAATGG + Intergenic
1159767744 18:72510237-72510259 AAAGGTATTCAGCTTTATAAGGG - Intergenic
1164203259 19:23036053-23036075 CCAGGTGATCACCTTAATAAAGG - Intergenic
1164299775 19:23951637-23951659 CAAGGACCTCTGTTTGATAATGG - Intergenic
1166948306 19:46410739-46410761 CAAGGTGCTCAGCTTGATAAAGG - Exonic
1168439967 19:56356205-56356227 CCAGGTGCTCACCTTAATAAAGG - Intronic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
925817094 2:7764118-7764140 AAAGGTGTTCTGTTTGATAAAGG - Intergenic
926719149 2:15945956-15945978 CAAGGTGGTCATTTTGAAAAAGG + Exonic
926816771 2:16805273-16805295 AAAGGTGTTCAGTTTTATAAGGG - Intergenic
927085263 2:19668987-19669009 AAAGCTGGTCAGTTTGATAATGG - Intergenic
927669527 2:25057491-25057513 CACCGTGCTCAGCCTGATAATGG - Intronic
928102136 2:28445026-28445048 CAAGCAACTCAGCTTCATAATGG + Intergenic
928804422 2:35132995-35133017 AAAGGTGTTCAGCTTTATAAGGG - Intergenic
929710626 2:44262990-44263012 GAAACTGCTCAACTTGATAAAGG + Intergenic
930537505 2:52662308-52662330 GAACTTCCTCAGCTTGATAAAGG + Intergenic
931700837 2:64907832-64907854 CAGGGAGCTCAGCTTCTTAAGGG + Intergenic
932317726 2:70797009-70797031 CAATGTGGTCACCGTGATAAGGG - Intergenic
933031094 2:77329630-77329652 GAAGGTGCTCAGGTTAGTAAGGG + Intronic
934174149 2:89564341-89564363 CAATGTGCTCAGCTTGGCACAGG - Intergenic
934284465 2:91638690-91638712 CAATGTGCTCAGCTTGGCACAGG - Intergenic
935080863 2:99792625-99792647 AAACTTCCTCAGCTTGATAAAGG - Intronic
938184479 2:129217134-129217156 AAATGTTCTCAGCTTGCTAAAGG + Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
938953365 2:136277577-136277599 CAATGTGCTTAGGTTGATAGTGG + Intergenic
941527862 2:166628643-166628665 CTGGGAGGTCAGCTTGATAAGGG + Intergenic
944853518 2:203744116-203744138 GCAGGTGCAGAGCTTGATAAGGG - Intergenic
946920344 2:224574412-224574434 CTACTTGCTCAACTTGATAACGG - Intronic
947375804 2:229493855-229493877 CAAGGAGCCCAGCTAGAAAAGGG + Intronic
1169576525 20:6968448-6968470 CAAGGCACTCAGGTTGTTAAGGG + Intergenic
1174161111 20:48551104-48551126 CAATTTGCTCAGCTTGAAAGTGG - Intergenic
1174699758 20:52596359-52596381 CATAGTGCTCAGTTTGATAAAGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180579546 22:16818770-16818792 CTGGGTGCTCAGCTTGCTATTGG - Intronic
1182332703 22:29562110-29562132 CAATGTTCTCATCTTGAAAATGG + Intronic
949463627 3:4320937-4320959 CTAAGTGCTCAGCATGTTAAAGG + Intronic
950329943 3:12148253-12148275 CAATGTGCTCAGATTGTGAATGG - Intronic
950470700 3:13184450-13184472 AAATGTCCTCAGCCTGATAAAGG + Intergenic
952336489 3:32407674-32407696 CAAGACGCACTGCTTGATAATGG - Intronic
954494323 3:50939719-50939741 AAACTTCCTCAGCTTGATAAAGG + Intronic
957265159 3:77954124-77954146 CAAGGTTATCAGCTTTTTAATGG - Intergenic
958420186 3:93920947-93920969 AAAGTTTCTGAGCTTGATAAAGG - Intronic
958529124 3:95302193-95302215 CAAGCTTCTCTACTTGATAAGGG - Intergenic
959633603 3:108536547-108536569 AAAGGTGCTAACATTGATAATGG + Intergenic
962193398 3:133334947-133334969 CAAGCTGGTGGGCTTGATAAAGG - Intronic
962513417 3:136125947-136125969 GAAGTTGCTAAGCCTGATAAAGG + Intronic
966056996 3:175705825-175705847 CAAGGAGCACAGTTAGATAAAGG - Intronic
967027070 3:185574046-185574068 CAAGGGCCTCTGTTTGATAATGG + Intergenic
967831018 3:193920330-193920352 CCAGGAGCTCAGCTCGACAAGGG + Intergenic
969077725 4:4593495-4593517 GAAGGTGCTCAGAATGATAGAGG + Intergenic
969828006 4:9773285-9773307 CAATGTGCTCAGCTTGGCACAGG - Intronic
971046241 4:22808364-22808386 CAAGGGGAACAGCTTGACAAAGG + Intergenic
974037017 4:56826317-56826339 AAAGGTGTTCAGTTTTATAAGGG + Intergenic
978003041 4:103580234-103580256 CATGGTGCTCTGCTAAATAAAGG + Intergenic
979995252 4:127424832-127424854 GAACGTGCTAAGCCTGATAAAGG + Intergenic
981927363 4:150154410-150154432 TAAGGTGCTTATCTTGATGAGGG + Intronic
983337568 4:166416263-166416285 AAAGGTATTCAGCTTTATAAGGG - Intergenic
986443298 5:7799622-7799644 CAAGGCTCTCAGCTGGCTAAGGG - Intronic
986814008 5:11388249-11388271 GAAGGTGCTCTAGTTGATAATGG - Intronic
988805693 5:34738466-34738488 CAAGGTGCCCAGCAAGAAAAGGG - Intronic
991516854 5:67446065-67446087 AAAGGTCCTCAACTTAATAAAGG - Intergenic
993029241 5:82685335-82685357 CAAGGTCTTCAGCTGGAAAATGG - Intergenic
998876702 5:146607251-146607273 CACTGTCCTCAGCTGGATAAAGG - Intronic
999502766 5:152163375-152163397 CTTGTTGCTCAGCTTGACAAGGG + Intergenic
1000716763 5:164653637-164653659 CTAGGTGCCCAGATTAATAATGG + Intergenic
1001716073 5:173817548-173817570 CAAAGTGCTCAGCAGAATAAAGG - Intergenic
1002207414 5:177573025-177573047 TACTGTGCTCAGCTTGATAAGGG + Intergenic
1005325219 6:24693526-24693548 CTTGGTTCTCAGCTTCATAAAGG + Intronic
1005598885 6:27406505-27406527 CAAGGTGCCCGGCTTGGTAGGGG - Intergenic
1006307564 6:33233377-33233399 CAAAGTGCTCGGATTGATTACGG + Intergenic
1006810106 6:36814723-36814745 GAGGGTGCTCAGGTTGGTAAAGG + Intronic
1007170324 6:39858275-39858297 CAAGGTGCTCTGCTAAAGAAGGG + Intronic
1007920399 6:45604187-45604209 CAACGTTCTCAGCTTTATAGAGG + Intronic
1011710455 6:90047561-90047583 GAAGGTGCTCAGCTTCATCAAGG - Intronic
1012634775 6:101524071-101524093 CAATGAGCTCTGTTTGATAATGG + Intronic
1012645500 6:101674056-101674078 CAAGATTCTCAACTTCATAAAGG - Intronic
1018475205 6:164133611-164133633 CAAGGTCCTCTGTTTGATTAGGG - Intergenic
1019302490 7:314289-314311 AAAGTTGCTCAACCTGATAAAGG - Intergenic
1019914451 7:4123842-4123864 GAAGGTGCTCAGCATGGTAGGGG + Intronic
1022010946 7:26307779-26307801 CACGGTGCTGATGTTGATAATGG - Intronic
1024208337 7:47182747-47182769 CATGGTGCCCAGCATGATGATGG + Intergenic
1025236491 7:57238116-57238138 CAATTTGCTCAGCTTGAAAGTGG - Intergenic
1027356648 7:77362990-77363012 CAAGGTGACAAGCTAGATAAGGG - Intronic
1028453358 7:91011031-91011053 CAGGCTCCTCAGCCTGATAAAGG - Intronic
1029411476 7:100414736-100414758 CACCGTGCCCAGCCTGATAATGG - Intronic
1030340041 7:108367689-108367711 CATGGTTCTCTGCTTGGTAAAGG - Intronic
1031141655 7:117949436-117949458 CAAGGAGCTCAGATTTCTAAAGG + Intergenic
1032459463 7:132099436-132099458 CAAATTTCTCAGCTTCATAAAGG - Intergenic
1034147540 7:148885442-148885464 AACAGTGCTCATCTTGATAAAGG - Intergenic
1034971785 7:155423901-155423923 CCAGGTGCTGGGCTTGAGAAAGG + Intergenic
1035952878 8:4043429-4043451 CAAGGTGCACATCATGATAATGG + Intronic
1037353728 8:17994779-17994801 AAAGGTGCTCAACATGATCACGG - Intronic
1039509790 8:38081866-38081888 CCAGGTGATCACCTTAATAAAGG - Intergenic
1039510986 8:38091617-38091639 CCAGGTGATCACCTTAATAAAGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1045321169 8:101082347-101082369 CAGGGTGATCAGATAGATAATGG - Intergenic
1045476715 8:102559014-102559036 GAAGGTGCTAAGCATGTTAAAGG - Intronic
1047498337 8:125424446-125424468 CATGATGCTCAGCTTGATGCTGG - Intergenic
1051325708 9:15965463-15965485 CAGGTTGCACAGCTTGCTAATGG - Intronic
1052929875 9:34047690-34047712 CACGGTGCTCAGCTAGTTGAGGG - Intronic
1057278290 9:93688590-93688612 GAATGTCCTCAGCCTGATAAAGG + Intergenic
1057464820 9:95303430-95303452 CTAGGACCTCAGCTTCATAAAGG - Intronic
1059439221 9:114294677-114294699 GAAGTTCCTCAACTTGATAAAGG + Intronic
1059781041 9:117527846-117527868 CAAGGTGCTCATATTGTGAAAGG - Intergenic
1060342189 9:122787557-122787579 CAATGTTCTCATCTGGATAATGG - Intergenic
1061373551 9:130211379-130211401 CAAGGTGCTCAGCATGGTCAGGG - Intronic
1062171866 9:135139179-135139201 CAAGGTGTTCAGGCTGAGAATGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1187102211 X:16205313-16205335 CATTGTTCTCAACTTGATAAGGG + Intergenic
1187361847 X:18635764-18635786 AAAGATGCACAGCTTAATAAGGG + Intronic
1192507965 X:71701527-71701549 CAAGGGCCTCTGTTTGATAATGG + Intergenic
1192518731 X:71780025-71780047 CAAGGGCCTCTGTTTGATAATGG - Intergenic
1193450632 X:81660301-81660323 TAATGTGTTCAGATTGATAATGG - Intergenic
1195041616 X:101019966-101019988 CAAGGTTCTCATCTTGGTATAGG - Intronic
1195610695 X:106863505-106863527 CCAGGTTCGCAGCTTGATAGAGG - Intronic
1195897993 X:109768060-109768082 AAACTTCCTCAGCTTGATAAAGG + Intergenic
1196352428 X:114747226-114747248 GAAGTTCCTCAACTTGATAAAGG + Intronic
1200123349 X:153801694-153801716 CAAGGTGCTCAGTTTGCAGAAGG - Intergenic
1201479278 Y:14420668-14420690 AAATGTTCTCAACTTGATAAAGG - Intergenic