ID: 1166948474

View in Genome Browser
Species Human (GRCh38)
Location 19:46411675-46411697
Sequence CCAGCTGACCAGAGGTCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 4, 3: 17, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166948474_1166948483 17 Left 1166948474 19:46411675-46411697 CCCTGTGACCTCTGGTCAGCTGG 0: 1
1: 1
2: 4
3: 17
4: 235
Right 1166948483 19:46411715-46411737 TATCTGCAGCCTCTTCCCTCTGG 0: 1
1: 4
2: 4
3: 52
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166948474 Original CRISPR CCAGCTGACCAGAGGTCACA GGG (reversed) Exonic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900774008 1:4568061-4568083 CCACCTTGACAGAGGTCACAGGG - Intergenic
900843381 1:5076231-5076253 CCAGGTGATCAGATGTCACCTGG - Intergenic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
900990657 1:6096805-6096827 CCAGCTGGCCGTAGGTAACAGGG + Intronic
901040872 1:6362570-6362592 CCAGCTCATCAGAGGGCACTCGG + Intronic
901574494 1:10189885-10189907 CCAGCAGCCCAGAGGTCTTATGG + Intergenic
901704387 1:11062335-11062357 CCACCTGACTTCAGGTCACAAGG + Intergenic
901985046 1:13068784-13068806 CCAGCTGACTGTAGGTCAGATGG - Intronic
901985308 1:13070937-13070959 CCAGCTGACTGTAGGTCAGATGG - Intronic
901990379 1:13108027-13108049 CCGGCTGACTATAGGTCAGATGG + Intergenic
901991349 1:13116741-13116763 CCGGCTGACTGTAGGTCACATGG + Intergenic
901996502 1:13155832-13155854 CCAGCTGACTGTAGGTCAGATGG + Intergenic
901996764 1:13157986-13158008 CCAGCTGACTGTAGGTCAGATGG + Intergenic
903084260 1:20840917-20840939 CCAGATCACCAGGGATCACATGG - Exonic
903371933 1:22842010-22842032 CCAGCTGTCCCGAGGCCCCATGG - Intronic
903451235 1:23455138-23455160 GCAGCTTGCCCGAGGTCACACGG - Intronic
903821335 1:26104843-26104865 CTATCTGAAGAGAGGTCACATGG - Intergenic
904102357 1:28042373-28042395 CCAGCTGAGAAAAGATCACATGG - Intronic
905253873 1:36667396-36667418 CCAGCTGACCAGAGGTCTCAGGG - Intergenic
905403894 1:37720654-37720676 CGGGCTGACCTGTGGTCACAGGG - Intronic
906607762 1:47183488-47183510 CCAGCTGCCCTGTGGGCACAGGG + Intergenic
907468004 1:54652306-54652328 CCAGCTGGCCACATGTGACAGGG - Intronic
909477279 1:76094993-76095015 ACAGGTGACCAGAAATCACATGG - Intronic
913164634 1:116173620-116173642 CCAGATGAGCAGAGGTCCCCAGG + Intergenic
913595931 1:120376822-120376844 CAAGCTTACCTGAAGTCACAGGG + Intergenic
914091350 1:144502154-144502176 CAAGCTTACCTGAAGTCACAGGG - Intergenic
914307255 1:146432035-146432057 CAAGCTTACCTGAAGTCACAGGG + Intergenic
914594851 1:149141086-149141108 CAAGCTTACCTGAAGTCACAGGG - Intergenic
915569886 1:156738754-156738776 CCATCTGCCCAGAGCTGACAAGG - Exonic
920754022 1:208710215-208710237 CCAGCCAAACAGAGGGCACAAGG - Intergenic
921315665 1:213888068-213888090 CTAGCTGAGCAGAGGCCAGAAGG + Intergenic
922505004 1:226121426-226121448 GCACCTGCCCCGAGGTCACACGG + Intergenic
924032569 1:239901092-239901114 GCAGCTGCTCAGAGGTCACTAGG - Intronic
924294423 1:242570879-242570901 CCAACTGTGCAGAGATCACATGG + Intergenic
1063506825 10:6607178-6607200 ATAACTTACCAGAGGTCACATGG + Intergenic
1067526829 10:47044259-47044281 CCTGCTGACCAGAGCTCATATGG - Intergenic
1067552416 10:47245149-47245171 CCACCCCACCAGAGGGCACAGGG - Intergenic
1073153693 10:101329540-101329562 CCAGCTGGTCAGAGTTCTCAGGG + Intergenic
1074326879 10:112459014-112459036 CCAGCTGACCAGCCTTCAGAAGG - Intronic
1075586469 10:123662027-123662049 CCACCTGACCAGGGGCAACAAGG - Intergenic
1075631988 10:124006018-124006040 CGGGCTGCGCAGAGGTCACAGGG - Intergenic
1075709688 10:124523980-124524002 TTAGCTCACCTGAGGTCACACGG + Intronic
1076000146 10:126906832-126906854 CCAGCTGGACAGTGGTCACGGGG + Intronic
1076026764 10:127122117-127122139 CCAGCAGATCACAGGTCACCAGG + Intronic
1076284132 10:129276987-129277009 CCAGCTGAGGAGAGCTCACGTGG + Intergenic
1077550771 11:3199282-3199304 CCTGCTGCTCAGAGGACACAGGG + Intergenic
1083483581 11:62966598-62966620 CCAGGTGGCAAGAGTTCACAGGG + Intronic
1083815877 11:65132262-65132284 CCAGCTGCACAGAGGCCCCACGG + Exonic
1084095786 11:66910337-66910359 CCAGCTGCCCTGATGGCACAAGG - Intronic
1084104969 11:66975260-66975282 CCATCTGACAAGAGATCACTGGG - Exonic
1084569154 11:69949201-69949223 CAAACTGAACAGAGGACACAGGG + Intergenic
1085449095 11:76621369-76621391 CCAGGTGACAGGAGCTCACAGGG + Intergenic
1086333381 11:85776133-85776155 CCAGCTGTGCAGAGATCACTTGG - Intronic
1086391573 11:86370391-86370413 CCAGCTGTGCAGAGATCACTTGG - Intergenic
1087936244 11:104037180-104037202 CCCGCTGCCCAGCGGTCACAGGG + Exonic
1089508199 11:118979104-118979126 CCAGCTGCTCAGAGGCCGCAGGG + Exonic
1092153688 12:6268544-6268566 ACAGCTGACCAGGGGTCACTGGG - Intergenic
1093851495 12:24045190-24045212 GTAACTTACCAGAGGTCACATGG - Intergenic
1103006878 12:117428131-117428153 CAAAATGGCCAGAGGTCACATGG + Intronic
1104521607 12:129480862-129480884 ACAGAGGACCAGAGGGCACATGG + Intronic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105587576 13:21759140-21759162 CCAGGTGACCAGACATCACCTGG + Intergenic
1108830149 13:54467787-54467809 CCAGCTAACCAAATGTTACACGG - Intergenic
1110158728 13:72350647-72350669 CAAGCTAACCAGGAGTCACAGGG + Intergenic
1113706827 13:112440466-112440488 CCAGATCACCAGAGGTGACCAGG - Intergenic
1115820806 14:37210730-37210752 TCATGTGGCCAGAGGTCACAAGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117036438 14:51734432-51734454 CAAGGTGGCCAGAGTTCACAGGG + Intergenic
1117180057 14:53182370-53182392 TCATGTGGCCAGAGGTCACAAGG + Intergenic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1121228694 14:92340666-92340688 CCAGATGCCCAGAGGTGAAAAGG - Intronic
1121506472 14:94481558-94481580 CAAGCAGAGCTGAGGTCACATGG - Intergenic
1122100518 14:99405652-99405674 CCAGGTGACCTGGGGTCACCAGG + Intronic
1122389623 14:101371273-101371295 CCAGCTGTCCCGAGGTCTCCAGG - Intergenic
1122406952 14:101506366-101506388 CCAGCTGAGCTCAGGTCAGAGGG + Intergenic
1122438888 14:101716800-101716822 CCAGCCGAAGAGGGGTCACAGGG - Intergenic
1122865102 14:104600199-104600221 CCAGCTCCCCAGAGGTCACAGGG + Intronic
1123717568 15:23042379-23042401 CCACCTGGCCAGAGGTGCCAGGG + Intergenic
1123718660 15:23046155-23046177 CCACCTGGCCAGAGGTGCCAGGG + Intergenic
1123719709 15:23049757-23049779 CCACCTGGCCAGAGGTGCCAGGG + Intergenic
1127042029 15:54987835-54987857 TCATGTGGCCAGAGGTCACAAGG - Intergenic
1127798029 15:62454880-62454902 CCACCTGCCCCGATGTCACAGGG - Intronic
1128125513 15:65189516-65189538 CTTACTTACCAGAGGTCACATGG - Intergenic
1128329234 15:66745039-66745061 CCCTCTGGCCAGAGGTCACCTGG - Intronic
1128724352 15:69976791-69976813 CCAGCTGACTACAGATCAGAAGG - Intergenic
1129365469 15:75051407-75051429 CCAGCTGGCCTGAGTCCACAGGG - Intronic
1129457965 15:75685701-75685723 CCTGGTTAACAGAGGTCACAAGG + Exonic
1130742474 15:86615644-86615666 CCAGCTGTCCAGAGGTGAACCGG - Intronic
1131506296 15:93022700-93022722 CAAGGTGGCCAGAGTTCACAGGG - Intronic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1134198083 16:12174476-12174498 CCATCTGCCCAGAGCTCAAATGG - Intronic
1139926900 16:70493722-70493744 CCCACTGTCCACAGGTCACAGGG - Intronic
1141692293 16:85603103-85603125 CCAGCTGCTCAGAGCTCACGAGG + Intergenic
1141914188 16:87082749-87082771 CTATCGGAGCAGAGGTCACAAGG - Intergenic
1142289125 16:89184718-89184740 CAGGCTGAACAGAGGACACACGG - Intronic
1144587218 17:16494378-16494400 CCAGGTGACCAGAGATCACCTGG + Intergenic
1145234737 17:21200563-21200585 CCATCTGACTAAAGGACACAAGG + Intronic
1147993463 17:44349163-44349185 CCAGCTCACCAGGGTCCACATGG - Exonic
1149865344 17:60148429-60148451 GGGGCTGGCCAGAGGTCACAGGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151917390 17:77128300-77128322 GCGCCTGACCAGAGGCCACAGGG + Intronic
1152419380 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG + Exonic
1152506991 17:80755897-80755919 CCAGCGGAGCAGAGCTCACTTGG + Intronic
1152598629 17:81250416-81250438 CCGGCTGTCCTGAGGCCACAGGG + Intronic
1152807289 17:82362149-82362171 CATGCTGACCGGAGGGCACATGG - Exonic
1153747341 18:8193508-8193530 ACAGCTGACCATAGCTCACTGGG - Intronic
1156032964 18:32734184-32734206 CAAGCTCACCAGAGTTCAGAAGG - Intronic
1156526002 18:37767983-37768005 CCAGTTGAGAAGAGGTCTCAGGG - Intergenic
1158679240 18:59551960-59551982 CCAGCTGAGCTTAGGCCACATGG - Intronic
1159352827 18:67298175-67298197 CCAGATGACTGGAGGCCACATGG + Intergenic
1159909663 18:74133750-74133772 CCAACTGTGCAGAGATCACACGG + Intronic
1161372014 19:3917852-3917874 CCTGCTGCCCAGAAGTCACCGGG - Intronic
1162599239 19:11654890-11654912 CCAGGTCACCAGAGATAACATGG - Intergenic
1162965251 19:14152442-14152464 CCAAAGGATCAGAGGTCACAAGG + Intronic
1163800244 19:19360478-19360500 CCAGGCTACAAGAGGTCACAGGG - Intergenic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1164631410 19:29764223-29764245 ACAGCTGACCAGAGATCACAGGG + Intergenic
1164906483 19:31972572-31972594 CCAGATGAACACAGGGCACACGG + Intergenic
1165349947 19:35269820-35269842 CCAGCTGACCATCAGTCACCTGG - Exonic
1165818925 19:38662031-38662053 CCAACTGACCAAAGGAAACAAGG - Intronic
1166948474 19:46411675-46411697 CCAGCTGACCAGAGGTCACAGGG - Exonic
1167456699 19:49599935-49599957 CCACCTGCCCAGAGCTCACCGGG - Exonic
1168351300 19:55677685-55677707 CCAGAAGACCAGACGTCCCAAGG - Exonic
924964067 2:59349-59371 CCATCTCAGGAGAGGTCACAAGG + Intergenic
925604617 2:5646169-5646191 CAAGCTTACCTGAAGTCACAGGG + Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
927663693 2:25014604-25014626 AGAGCTGCCCATAGGTCACAGGG + Intergenic
928736920 2:34301733-34301755 CCAGATGTGCAGAGATCACATGG - Intergenic
930663765 2:54081886-54081908 TCAGCTGAGCTGAGGTAACAGGG + Intronic
931489237 2:62726003-62726025 CCAGCAGACCAAGGGACACAGGG + Intronic
931791971 2:65671808-65671830 CCACCTGAACAGAGGTCACCAGG + Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
933153812 2:78948083-78948105 TCAGTTAGCCAGAGGTCACAAGG - Intergenic
933971960 2:87477086-87477108 CCAGCTGCCCAGTGAGCACATGG + Intergenic
934093113 2:88571881-88571903 ACATCTAACCAGAGGTCTCATGG + Intronic
934979952 2:98831461-98831483 CGAGCAGGCCAGAGGTGACAGGG + Intronic
935624711 2:105162563-105162585 CCAGCTTACCAGATGTGACCAGG + Intergenic
935868179 2:107415270-107415292 CCAGGTGGCCAGTGGTCACTAGG + Intergenic
936321766 2:111473111-111473133 CCAGCTGCCCAGTGAGCACATGG - Intergenic
936989268 2:118345331-118345353 CCAGCTGTGGAGAGATCACATGG - Intergenic
938081177 2:128370977-128370999 CCAGCTCACCACAGGCCACACGG + Intergenic
942886508 2:180931327-180931349 CCAGTTGACCAGAGTACCCATGG + Intergenic
944461788 2:199956981-199957003 CCAAGTGACCATATGTCACAAGG - Intronic
946538460 2:220657716-220657738 CCAGCAGACCAGCGGACAGAAGG - Intergenic
946695375 2:222352460-222352482 CAAGATGCCCAGAGTTCACAGGG - Intergenic
947114354 2:226752806-226752828 CCTGCTGTCCAGTGGTCGCATGG - Intronic
947588427 2:231370943-231370965 CCAGCTGACCAGAGCGCCCAGGG - Intronic
947617293 2:231566418-231566440 CAAGCAGACCAGACTTCACACGG + Intergenic
948278109 2:236725560-236725582 GCAGCTCACCAGAGGGCTCAGGG - Intergenic
948426352 2:237889225-237889247 ACAGCTGTGCGGAGGTCACACGG - Intronic
948480861 2:238249603-238249625 CTAGCTGACCAGAGGACTTAGGG + Intronic
1168934883 20:1656577-1656599 GCAGCTGACCCCCGGTCACAGGG - Intronic
1169743469 20:8919688-8919710 CCAGCTGACCAAAGCTCCCTGGG - Intronic
1172694649 20:36814013-36814035 TGATCTGACCAGAGGTCAGAGGG - Intronic
1172902339 20:38344266-38344288 CAAGCTGAGCAGAGGCCTCAGGG - Intergenic
1173946716 20:46957195-46957217 AGAGCTGACCAGAGGTCCCAAGG - Intronic
1174211916 20:48886465-48886487 CCAGCTGAGCAGTGGTTCCATGG - Intergenic
1175262573 20:57684104-57684126 GCAGCTGACCAGATGTCTCCTGG - Intronic
1175809625 20:61851022-61851044 CCACACGCCCAGAGGTCACAGGG - Intronic
1176044719 20:63086614-63086636 GCAGCTGACCAGGTGCCACAGGG - Intergenic
1176072200 20:63233079-63233101 CCAGCTGAGAAGATGTCAGATGG - Intergenic
1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG + Intergenic
1178408596 21:32346160-32346182 CCAGCTCTGCAGAGATCACACGG - Intronic
1178501327 21:33127962-33127984 CCTGCTGATGAGAGGGCACAGGG + Intergenic
1179537047 21:42059477-42059499 CCATCTGGCCAGTGGTCCCATGG + Intergenic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1179812298 21:43879875-43879897 CCAGGTGCCCAGAGGTCCTAAGG - Intronic
1179909675 21:44441211-44441233 TCAGGTGGCCAGAGCTCACAGGG + Intronic
1180333618 22:11555828-11555850 CCAGCTGATAAGAGGCCCCACGG - Intergenic
1180833584 22:18918829-18918851 CCGGATGCCCAGAGGACACAGGG - Intronic
1181066245 22:20307425-20307447 CCGGGTGCCCAGAGGACACAGGG + Intergenic
1182692694 22:32175091-32175113 TCAAGTGCCCAGAGGTCACAGGG - Intergenic
1183391845 22:37549821-37549843 CCTGCTGGCCAGAGCTCCCACGG - Intergenic
1184383896 22:44163522-44163544 CCACCTGATGAGAAGTCACAGGG - Intronic
1184550586 22:45202397-45202419 CCAGCTTGCCCCAGGTCACAAGG - Intronic
1185234556 22:49704553-49704575 CTGGCTGCCCAGAGGCCACAGGG - Intergenic
1203283669 22_KI270734v1_random:144127-144149 CCGGATGCCCAGAGGACACAGGG - Intergenic
949861194 3:8506361-8506383 CTAACTGACCAAAGGTGACAAGG + Intronic
950528975 3:13541546-13541568 CCAGGTAACCAGAGGTTACTTGG + Intergenic
951560583 3:23962224-23962246 CATGGTGACCAGAGCTCACAAGG + Exonic
952822155 3:37494743-37494765 CCAGCTGGCCAGAGACCACTGGG + Intronic
954246717 3:49338187-49338209 GCAGCTTCCCAGAGGTCACAAGG + Intronic
959112186 3:102134946-102134968 GCTGCTGACCAGAGGTCCCAAGG - Intronic
959468751 3:106722205-106722227 CCAGCTGACTAGTTGTAACAGGG + Intergenic
961455659 3:127022693-127022715 CCAGCTGTCCAGCAGGCACAGGG - Intronic
961620800 3:128223036-128223058 CCAGCTCCCCAGAGGTCAGGAGG - Intronic
966872855 3:184302983-184303005 CCAGCTGAAGAGAAGTCAGAGGG - Exonic
977681917 4:99806668-99806690 CCAGATGACCAGAGGTCCCATGG - Intergenic
979983241 4:127282843-127282865 CCACCTGAAATGAGGTCACAGGG - Intergenic
981239064 4:142452628-142452650 CCAGCTGACCAGTGGCCACACGG + Intronic
985485790 5:147443-147465 AGAGCTGACCAGAGGTTACCTGG + Intronic
985617316 5:931221-931243 TTTGCTGACTAGAGGTCACACGG + Intergenic
986238640 5:5936491-5936513 CCAGGTGCCCTGAAGTCACACGG + Intergenic
986284895 5:6351840-6351862 CCACCAGACCAGAGTTCACTGGG + Intergenic
986348640 5:6857018-6857040 CCAGCTGATCAGGGCTCAAAGGG + Intergenic
986772456 5:10986788-10986810 GCAGCTGAGCAGAGTTAACACGG + Intronic
988182684 5:27817385-27817407 CCAGCTGACCAGAGACAAAAAGG - Intergenic
988606010 5:32678833-32678855 CCACCTCACCAGAGGTCCAATGG - Intergenic
989541944 5:42628127-42628149 CCAGCTGACCAGCAGACAGATGG - Intronic
990946318 5:61253424-61253446 CCAGTTCACCCCAGGTCACAGGG + Intergenic
992688945 5:79224530-79224552 TCATGTGGCCAGAGGTCACAAGG - Intronic
994426666 5:99598042-99598064 CTATCTGTCCAGAGGTCACACGG + Intergenic
995205096 5:109470511-109470533 CCAGCTGTGCAGAGATCACATGG - Intergenic
995535394 5:113130726-113130748 CCGGCTGTGCAGAGATCACATGG - Intronic
995581221 5:113605216-113605238 CCAGCTGTACAGAGATCACATGG - Intergenic
995622542 5:114042285-114042307 CCTTCTGACCATAGGTCAGAAGG - Intergenic
998005490 5:138654241-138654263 CCAGCAGACAAGAGCACACAGGG + Intronic
998132475 5:139658415-139658437 CAGGCTGCCCTGAGGTCACAGGG + Intronic
998715032 5:144873494-144873516 TAAGCAGAGCAGAGGTCACAAGG + Intergenic
1000117350 5:158166109-158166131 CCAGCTGCCCAGAGGACCGAGGG + Intergenic
1002074314 5:176699073-176699095 CCAGATGCACAGAGGCCACAAGG - Intergenic
1002572870 5:180153962-180153984 CATGCTGACCAGGGGCCACATGG - Intronic
1004470258 6:15922603-15922625 CCAGATGACCAGAACACACAAGG - Intergenic
1004536240 6:16505152-16505174 CCAGCTGACCACAGCTGAGAGGG - Intronic
1005840932 6:29744258-29744280 CAGGCTCACCAGAGGGCACAGGG + Intergenic
1006072440 6:31507287-31507309 CAGGCTCACCAGAGGGCACAGGG - Exonic
1007214460 6:40226647-40226669 CCAGCTGTGCAGAGATCACATGG + Intergenic
1007222431 6:40289628-40289650 CCACCTGGCCAGTGGTAACAGGG + Intergenic
1007752991 6:44081312-44081334 CCAGCTCACCCCAGGGCACAGGG + Intergenic
1016581358 6:145632176-145632198 CCAGCTACCCAGTGGTGACAAGG + Intronic
1018413378 6:163579299-163579321 CCAGGTGCACAGAGATCACAAGG + Intergenic
1018572295 6:165224374-165224396 CCAGCAGACCACTGCTCACAGGG + Intergenic
1019567141 7:1689928-1689950 CCAGGTGTCCAGAGGGCTCAAGG - Intronic
1019636652 7:2079567-2079589 CCAGATAAACAGAGGCCACACGG + Intronic
1022175266 7:27866348-27866370 CCAACTGTCCAGAGCCCACATGG + Intronic
1023912386 7:44565247-44565269 CCTGCTTACCAGGCGTCACAAGG - Intergenic
1024399108 7:48903630-48903652 CCAGCTGACCATTAGCCACAAGG + Intergenic
1026376474 7:69756021-69756043 CTTTCTCACCAGAGGTCACAGGG + Intronic
1028177131 7:87672300-87672322 CAAGCTGACCAGAGGTGGAAAGG - Intronic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1029272617 7:99385924-99385946 CCAGCTGACCAGGGGCCTCCTGG + Intronic
1033591208 7:142809826-142809848 CAAGCTGTCCAGAGGCCCCAGGG + Intergenic
1033601609 7:142892726-142892748 CCAGCTGACCAGAAATCACTTGG + Intergenic
1034646571 7:152652970-152652992 CCTGCTGCCCAGAGACCACAGGG + Intronic
1037599474 8:20381781-20381803 ACAGCTGGCCAGAGGGGACAGGG - Intergenic
1040398799 8:47026308-47026330 CCAGCTGCCCTTAGGTCAAATGG + Intergenic
1042062558 8:64836926-64836948 ACCCCTGACCAGAGGTAACAAGG - Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1056368028 9:85925717-85925739 CTTGCTGACCAGAAGTCACTGGG - Intergenic
1057277958 9:93686297-93686319 CCAGCTAACATGAGGTCAAATGG - Intergenic
1057576378 9:96245829-96245851 ACAGCTGGACAGATGTCACATGG + Intronic
1059347167 9:113636932-113636954 ACAGCTGCCGAAAGGTCACATGG - Intergenic
1059693922 9:116713005-116713027 CCATGTGTCCAAAGGTCACATGG - Intronic
1060289253 9:122285274-122285296 CCAGCTTCCCAGAGGTAAGATGG + Exonic
1060822913 9:126671827-126671849 CCAGCGGCCCAGAGGCCACTTGG + Intronic
1061945354 9:133905644-133905666 TCAGCTCCCCAGATGTCACAGGG - Intronic
1062174194 9:135151820-135151842 CCTGCTGACCACAGCTCAGATGG + Intergenic
1185449166 X:273713-273735 CATGAGGACCAGAGGTCACAGGG - Intergenic
1185449459 X:274894-274916 CATGAGGACCAGAGGTCACAGGG - Intergenic
1186221497 X:7354158-7354180 CCAGTTGACCAGACATCACCTGG - Exonic
1188650623 X:32627267-32627289 CCAGATGCACAGAGGTAACATGG + Intronic
1188772539 X:34171354-34171376 CCAGCAGGCTAGAGGACACAAGG - Intergenic
1189319925 X:40081801-40081823 ACAGCTGAGAAGAGGTCAGATGG + Intronic
1189801119 X:44692668-44692690 CTAACCGACCAGAGGTCAGAAGG + Intergenic
1197880954 X:131165882-131165904 CCAGAAGAACAGAGGTCAGATGG + Intergenic
1198510789 X:137349533-137349555 CCACCTGAGCAAAGGTCAAATGG - Intergenic