ID: 1166956447

View in Genome Browser
Species Human (GRCh38)
Location 19:46468645-46468667
Sequence TCAGGGACCCAGAAATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166956447_1166956450 -1 Left 1166956447 19:46468645-46468667 CCAAGAAATTTCTGGGTCCCTGA 0: 1
1: 0
2: 1
3: 24
4: 194
Right 1166956450 19:46468667-46468689 AACATTTCTATTCCCCAGCCAGG 0: 1
1: 0
2: 3
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166956447 Original CRISPR TCAGGGACCCAGAAATTTCT TGG (reversed) Intronic
902681717 1:18048463-18048485 ACAGGCTCCCAGAAAGTTCTAGG + Intergenic
902841686 1:19078239-19078261 CCTGGGACCCAGAAGTTTATTGG + Intronic
904603834 1:31688425-31688447 TCAGGGACACTGGAGTTTCTTGG - Intronic
905552363 1:38853423-38853445 TCAGAGACACAGAACTTTATAGG + Intronic
906359528 1:45141358-45141380 TCAGGGAACCAGAAAGTACTAGG + Intronic
906833316 1:49057949-49057971 TCATGGACCTAGAAATGTCAGGG - Intronic
907238667 1:53068734-53068756 ACAGGGACTCAGACATCTCTGGG - Intronic
907737743 1:57131472-57131494 TCTGGGACTCAGAAGTATCTGGG - Intronic
908783537 1:67713396-67713418 TCAGGTTCCTAGAAATTCCTAGG + Intronic
910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG + Intergenic
910950277 1:92639606-92639628 TCAGGAACCCAAACATTTCATGG + Intronic
912164719 1:107029669-107029691 TAATGGACCCACAAATTTCAGGG - Intergenic
913710066 1:121473810-121473832 TCAAGGGCCCACAAATATCTAGG + Intergenic
915398285 1:155602861-155602883 TTAGGGAACCAGAAATGTATTGG + Intergenic
915414208 1:155728058-155728080 TTAGGGAACCAGAAATGTATTGG + Intronic
916089556 1:161297020-161297042 TCAGGCATCCGGAAAGTTCTTGG + Intergenic
917039122 1:170783774-170783796 TCAGTGACCCAGGAATTTTGAGG + Intergenic
919295348 1:195692060-195692082 AAAGGAACCCAGAAATATCTAGG + Intergenic
920602845 1:207346631-207346653 TCAGGGAACCAGAAAATGCCTGG + Intronic
920700362 1:208213713-208213735 CCAGGGACCCAGAAATATTTTGG - Intronic
920775475 1:208932612-208932634 TTAGGTACCCAGAGACTTCTGGG + Intergenic
921583096 1:216917591-216917613 GAAGGGACTCACAAATTTCTGGG - Intronic
922062591 1:222106380-222106402 CCAGGGACCCAGAAGGCTCTGGG + Intergenic
922347738 1:224710491-224710513 ACTGGGATCCAGAGATTTCTGGG - Intronic
1063269328 10:4488808-4488830 GCAGAGACCCTGCAATTTCTGGG + Intergenic
1064488668 10:15825879-15825901 TCAGAAACCCAGAAGTTTCTTGG - Intronic
1066045597 10:31592835-31592857 TCACAGACCCAGAGATGTCTGGG - Intergenic
1068747874 10:60555789-60555811 TCAGGGACCCAGATCTCTTTTGG - Intronic
1069565890 10:69463183-69463205 TCAGGGATTCAGAAACTTGTGGG + Intronic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1074259441 10:111836994-111837016 TTTGTGACCCTGAAATTTCTAGG - Intergenic
1074932726 10:118145512-118145534 GCAGGGATCCAGAAACTTCTTGG - Intergenic
1075335298 10:121604567-121604589 TCAGGAACACAGACTTTTCTGGG - Intergenic
1075679273 10:124320957-124320979 GCAGGGACCCGGTGATTTCTTGG - Intergenic
1075997766 10:126892488-126892510 TCAGGGAACCAGAAGTTGCAGGG + Intergenic
1076992735 11:284263-284285 TCAGGGCCTCAGAAAGGTCTCGG - Exonic
1077456622 11:2685320-2685342 TCAGGGACCCAGCCATGTCATGG + Intronic
1080222139 11:29918201-29918223 TCAGTGAGCCAGATATTTCTAGG - Intergenic
1085758340 11:79220067-79220089 TCAGGGACCCAGCAGGTTCCTGG - Intronic
1089233722 11:117004556-117004578 ACAGGGACCCTGAAAATACTTGG + Intronic
1093870024 12:24279812-24279834 TCAGAGACACAGAAATAACTAGG + Intergenic
1094029165 12:25991454-25991476 TCAGGGATCCAGGAATGGCTTGG + Intronic
1095990172 12:48029058-48029080 TCAGGGACTCAGAGATCTCTTGG - Intergenic
1098246903 12:68529058-68529080 ACAGGGAGACAGAAAATTCTTGG + Intergenic
1098367694 12:69722432-69722454 TCAAGGACCCAGAGATCTCCAGG + Intergenic
1098482693 12:70984215-70984237 TCATGGCCCCAGAGATTTTTTGG - Intergenic
1099288062 12:80739727-80739749 GCAGAGAGCAAGAAATTTCTGGG - Intergenic
1099406160 12:82265919-82265941 TCAGGGACCAGAAAACTTCTTGG - Intronic
1103140033 12:118540469-118540491 TCAGAGACCCAGAAGTCCCTGGG - Intergenic
1103996625 12:124834281-124834303 TCAGGTTCCCAGAAACTTCCAGG + Intronic
1105599139 13:21870162-21870184 CCAGGGTCCCAGAAACTCCTGGG - Intergenic
1105700090 13:22929236-22929258 TCAGGGACTCAGACCTTTCAGGG - Intergenic
1108330978 13:49383411-49383433 TCAAAGAGCCAGAAATGTCTAGG - Intronic
1109170370 13:59088764-59088786 TCAGTGTTCCAGAAATTTCCAGG + Intergenic
1111074326 13:83213337-83213359 TAAGGGAGCCAAAAATTGCTAGG + Intergenic
1111102499 13:83606246-83606268 AGAGGGACCCAGATATTGCTTGG + Intergenic
1111363486 13:87208434-87208456 TTAGGAACCCAAATATTTCTAGG - Intergenic
1112933370 13:104769382-104769404 CCAGGGACTCAGAAATTGCCTGG - Intergenic
1113163333 13:107408948-107408970 TCAGGAAAACAGAATTTTCTTGG - Intronic
1117206937 14:53452780-53452802 TCAGGGACACAAAAAACTCTTGG - Intergenic
1118437546 14:65785241-65785263 TCTGTGACCCACAAGTTTCTGGG - Intergenic
1121829756 14:97039956-97039978 TCTGGGACCCATGAATGTCTGGG + Intergenic
1123852922 15:24379124-24379146 GTGGGGACCCAAAAATTTCTGGG + Intergenic
1124559059 15:30755400-30755422 CCAGGGACCCAGACACTACTGGG - Intronic
1124672200 15:31650325-31650347 CCAGGGACCCAGACACTACTGGG + Intronic
1124815852 15:32991222-32991244 TCAGGGACCCAGGAGATTCTGGG - Intronic
1126346956 15:47705715-47705737 TCAAGAACCCAGGAATTTCCTGG - Intronic
1132942020 16:2513230-2513252 TCAGGGACCCAAACATTAGTGGG - Intronic
1133684097 16:8149415-8149437 CCAGGGACCCAGAAGTCTCCTGG + Intergenic
1138004831 16:53323402-53323424 TCTGGGACCCAGAAAATCATGGG + Intronic
1140944464 16:79754955-79754977 TCAGGAACCCAGGGATTTCTGGG + Intergenic
1141505807 16:84477602-84477624 TCAGGGCCCTAGAAAGTGCTAGG - Exonic
1144500212 17:15779640-15779662 TCAAGGTTCCACAAATTTCTAGG + Intergenic
1146647084 17:34582636-34582658 GCGGGGAACCAGAAATCTCTAGG + Intronic
1148737500 17:49873103-49873125 TCAGGGACCCACCAATTCCCAGG + Intergenic
1151398716 17:73841996-73842018 TCAAGGCCCCAGAAATTCCTTGG - Intergenic
1153146607 18:2039700-2039722 CCAGGGAGCCAGAAAATGCTGGG + Intergenic
1153504963 18:5787657-5787679 TCAGTAACCCACAAATTTATGGG + Intergenic
1153863845 18:9243608-9243630 TCAGAGACCAAGAAAGTCCTTGG + Intronic
1154091260 18:11365450-11365472 TCAGGGAACCAGAATTTTGCAGG + Intergenic
1154286903 18:13066850-13066872 TCTGGAACCCAGACCTTTCTGGG + Intronic
1155139136 18:23028085-23028107 TCAGGGACCCAGATGTCTCCTGG + Intergenic
1155485973 18:26343253-26343275 CCAGGGAACCAGAAATTACTGGG + Intronic
1157434206 18:47654734-47654756 TCAGGCTCCCAGGAATTCCTAGG - Intergenic
1159826704 18:73221489-73221511 TCAGGGACCCACACATTGGTGGG + Intronic
1161855579 19:6762992-6763014 TCAGGGTCCCAGAATTTTTGGGG + Intronic
1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG + Intronic
1165096289 19:33411578-33411600 ACAGGGACCCAGAGGCTTCTGGG + Intronic
1166956447 19:46468645-46468667 TCAGGGACCCAGAAATTTCTTGG - Intronic
1167329345 19:48845307-48845329 TCAGGGACCCCCACACTTCTGGG - Intronic
1167371593 19:49085771-49085793 TCCCGGACCCCGAAATCTCTGGG + Intronic
1168583757 19:57576571-57576593 TCAGTCACCCAGAAATACCTGGG + Intronic
925877722 2:8327330-8327352 CCAGGGACCCTTAAATCTCTTGG - Intergenic
926982352 2:18585111-18585133 TAAGGGACTCGGACATTTCTAGG + Intronic
928680211 2:33693593-33693615 TCAGAGTCCCACAAATCTCTAGG + Intergenic
928841925 2:35618703-35618725 TTATGTACCCAGATATTTCTTGG - Intergenic
931484736 2:62679248-62679270 TCAGGAATCCAGAAATCTCTTGG + Intronic
931677244 2:64709565-64709587 TCTTGGACCAAGAAATTCCTGGG - Intronic
931772277 2:65507959-65507981 GCAGTGAACCAGAAAGTTCTAGG + Intergenic
932375483 2:71231895-71231917 GGTGGGATCCAGAAATTTCTTGG - Intergenic
932834562 2:75023996-75024018 TCAGGGACCCAGAATTGACAAGG - Intergenic
934576563 2:95405480-95405502 TCAGGTTCCCTGAAATTCCTAGG - Intronic
935840776 2:107107533-107107555 GCAGGGAACCACAAATTCCTTGG - Intergenic
936773047 2:115938146-115938168 TCAGGGACCAGCAAAATTCTTGG - Intergenic
937223661 2:120356269-120356291 TCAGGGAACCACGAGTTTCTTGG - Intergenic
937786195 2:125901898-125901920 TGAGAGACCCAGATTTTTCTAGG - Intergenic
938104897 2:128523290-128523312 CCAGGGACCCAGAAACTGCAAGG - Intergenic
938195598 2:129324708-129324730 TCAGGGGCCCAGGACTGTCTGGG - Intergenic
941019051 2:160388723-160388745 TCAGGGAACCGGAAATTGCTTGG - Intronic
942613518 2:177765874-177765896 TCTGGGATGCAGAAATGTCTGGG - Intronic
946689656 2:222300623-222300645 TCATGGGTCCAGACATTTCTGGG - Intronic
1169551833 20:6708923-6708945 GCAGGGATTCAGAAATCTCTTGG + Intergenic
1170007162 20:11681769-11681791 TCAAAGACCTAAAAATTTCTTGG + Intergenic
1170747790 20:19116178-19116200 TCAAGGACTCAAAAATTTCTGGG - Intergenic
1171101168 20:22384999-22385021 CCTGGTACCCAGAAAGTTCTTGG - Intergenic
1172875044 20:38158919-38158941 TCCGGGCCCCGGGAATTTCTTGG + Intronic
1173324031 20:42016493-42016515 TCAGAGAGCCAGACATGTCTGGG - Intergenic
1177511494 21:22092526-22092548 TCAAGAACCCAGACATTTCATGG + Intergenic
1183106014 22:35615619-35615641 TCAAGGACTCAGAGAATTCTAGG + Intronic
1184493541 22:44824270-44824292 TGAGGGACCGAGACATCTCTGGG + Intronic
1184803168 22:46774733-46774755 TCGGGGCCCCTGATATTTCTGGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
950528140 3:13536531-13536553 TGAGGGACCCAGGGACTTCTGGG - Intergenic
951615499 3:24538787-24538809 TCAGGGAAACAGTTATTTCTGGG + Intergenic
951622123 3:24614296-24614318 TCAGGGACCCAGGATTGACTTGG + Intergenic
957580407 3:82065278-82065300 ACATGGACCCAGAAATCCCTTGG + Intergenic
957848143 3:85766345-85766367 TCAGGGCCCCAGAACATACTAGG + Intronic
958686837 3:97408928-97408950 TCAGGGACTCATAAACTACTGGG - Intronic
959684638 3:109131003-109131025 TCAAGGACCCAGGAATTTCAAGG + Intergenic
960520268 3:118646745-118646767 TCTGGTACTCAGAAATTTCTGGG - Intergenic
961618606 3:128205267-128205289 TCAGGGACTCAGATGTATCTGGG + Intronic
963066935 3:141271596-141271618 TCAGGGACCCAGAGTTTCCCGGG - Intronic
966889282 3:184395080-184395102 CCAGGGCCCCAGCCATTTCTTGG + Intronic
967144470 3:186594807-186594829 TCTGGGACTGAGAAGTTTCTGGG - Intronic
967505319 3:190246666-190246688 TCAAAGTCCCAGAAATCTCTAGG + Intergenic
967548904 3:190766346-190766368 ACAGGGACACAGAAAGTTCATGG + Intergenic
968403482 4:318324-318346 TCAGGGTCCCAGAGCTTTCTGGG + Intergenic
972619620 4:40734073-40734095 TCTTGCACCCAGAAATTCCTAGG - Intergenic
973061461 4:45731127-45731149 TCAGGGAAACAGAAGTTTCCTGG + Intergenic
973958987 4:56090734-56090756 TTAGACACCCAGAAATTCCTTGG - Intergenic
975179204 4:71324062-71324084 TTGGGGACCCAGCAAATTCTTGG + Intronic
976903827 4:90211253-90211275 TAAGAAACCCACAAATTTCTGGG - Intronic
979021291 4:115501647-115501669 TATGGAACTCAGAAATTTCTTGG + Intergenic
979425429 4:120558736-120558758 TAATGGATGCAGAAATTTCTTGG - Intergenic
979606630 4:122645378-122645400 TTGGGCACCCAGAAATCTCTGGG - Intergenic
981817260 4:148845076-148845098 TTAGGCACCAAGAATTTTCTTGG - Intergenic
982966290 4:161912969-161912991 TCAGAGTTCCACAAATTTCTGGG - Intronic
983657732 4:170099958-170099980 TCAGGAACCCAGCCATTTCCTGG - Intergenic
988997637 5:36729700-36729722 TTAGGCACCCAGAATGTTCTAGG - Intergenic
989115168 5:37945536-37945558 TCAGGAGCCCAGGAGTTTCTGGG + Intergenic
989751973 5:44905945-44905967 TCAGGGAAACAGAAATGTTTAGG - Intergenic
990234003 5:53746499-53746521 TCAGAATCCCAGAAAATTCTGGG + Intergenic
991034758 5:62118004-62118026 CCAGAGTCCCAGAAATTACTTGG - Intergenic
992048418 5:72921303-72921325 GCAAGGACCCAGAGAGTTCTTGG + Intergenic
993097443 5:83496035-83496057 GCAGAGGCCCTGAAATTTCTGGG - Intronic
993430065 5:87821927-87821949 TCAGGGACATAGAGGTTTCTTGG - Intergenic
994049600 5:95347603-95347625 TCAGGGTATAAGAAATTTCTTGG - Intergenic
994132845 5:96250329-96250351 TCAGGGCCCCAGGACCTTCTAGG + Intergenic
996236958 5:121142090-121142112 TCAAAGATCCAGAAATCTCTAGG + Intergenic
998087590 5:139339446-139339468 TCAGGGGCCCAGTATTTCCTTGG - Intergenic
998516837 5:142763395-142763417 ACAGAGACCCAGAATTATCTGGG - Intergenic
998697167 5:144653377-144653399 TCAGAGTTCCACAAATTTCTAGG + Intergenic
998850856 5:146349399-146349421 CCTGGGACCCAGGAATTTATGGG - Intergenic
999772185 5:154784039-154784061 TCTGGGAGCCAGCAGTTTCTAGG + Intronic
1000165122 5:158640825-158640847 TCAGGGGCCCTGTCATTTCTTGG + Intergenic
1003926358 6:10881529-10881551 TCAGAAACCCAGAAATTTTGCGG + Intronic
1004126539 6:12879464-12879486 CCAGGTACCCAGTATTTTCTAGG + Intronic
1005588074 6:27296329-27296351 TCAGTCACCCGGAAATTGCTGGG + Intronic
1005918347 6:30375010-30375032 TCAGGGACAGAGAAATTTAGAGG - Intergenic
1006319058 6:33308895-33308917 TGAAGGACCTAGACATTTCTGGG - Intronic
1006338943 6:33435400-33435422 TCAAGGAAACAGAAACTTCTGGG + Intronic
1007285009 6:40741310-40741332 TCAGGCAAGCAGAAATTTCTGGG + Intergenic
1008393477 6:50979847-50979869 GCAGGGTCCTAGAAATTTCCAGG + Intergenic
1008545295 6:52577732-52577754 TGAGGGTCCCAAAAATTACTGGG - Intergenic
1009735869 6:67675235-67675257 TCAGGGACCCAGACCTCACTTGG - Intergenic
1009912759 6:69952936-69952958 TCAGAGACTCAGAAACTTATAGG + Intronic
1011520368 6:88197616-88197638 TCAAGAAGCCAGAAATTTCCTGG - Intergenic
1012232373 6:96775367-96775389 ATAGGGGCCCAAAAATTTCTAGG - Intergenic
1012691697 6:102320961-102320983 TCTCGGACTCAGAAATTTCTAGG + Intergenic
1017942397 6:159064528-159064550 TCAAGGACCCAGACTTTGCTAGG + Intergenic
1017942646 6:159066659-159066681 TCAAGGACCCAGACTTTGCTAGG + Intergenic
1019386227 7:757742-757764 TCAGCACCCCAGATATTTCTGGG + Intronic
1019865012 7:3699622-3699644 TCAGAGCCTCAGAGATTTCTGGG + Intronic
1020257814 7:6511752-6511774 CCAGGGACCCACAATTTGCTAGG - Intronic
1022258661 7:28683523-28683545 CCAAGGACCCAGAAATGTCTGGG - Intronic
1024752679 7:52486733-52486755 GCTGGGACCGAGAACTTTCTTGG - Intergenic
1026930123 7:74219324-74219346 TCAGGGACCCAGCAATGACTTGG - Intronic
1027731096 7:81873608-81873630 TCAGGGTCCCAGCCATTCCTCGG - Intergenic
1036544119 8:9749881-9749903 TCAGGGTCCCGAAAATTTCTAGG - Intronic
1036925062 8:12896397-12896419 TCAGGTACACAGTAGTTTCTGGG + Intergenic
1037650082 8:20828434-20828456 TCTGAGACCAAGTAATTTCTGGG - Intergenic
1043136646 8:76535581-76535603 TCACGGACACAGACATTTGTTGG - Intergenic
1043777131 8:84283798-84283820 TAAGGGATTCAGAATTTTCTGGG + Intronic
1045425099 8:102058344-102058366 TCACTGACCCAGAAATTTATTGG - Intronic
1047003003 8:120591696-120591718 TAAAGGACTCAGAAATTTGTTGG - Intronic
1048088963 8:131218048-131218070 AGAGGGACCCAGAAATATTTGGG + Intergenic
1048185754 8:132239083-132239105 TAAGGGGCCCAGGAATTTCTTGG - Intronic
1048259668 8:132935059-132935081 TCAGGGACCCAGAATTTCATGGG - Intronic
1048954915 8:139527790-139527812 TCAGTGACCAAGAAATTCATTGG + Intergenic
1050180067 9:2912645-2912667 TCAGAGACCCAGAAATATTGTGG - Intergenic
1051352623 9:16212802-16212824 TCAGGGGCCAAGTAAATTCTGGG + Intronic
1052027279 9:23587729-23587751 TCAGGGTCCCTTAAATCTCTAGG - Intergenic
1052705471 9:31989138-31989160 TCAGGGTTCCACAAATATCTAGG + Intergenic
1052991245 9:34520525-34520547 GCAGGGATCCAGAATTTACTGGG + Intronic
1056286447 9:85092150-85092172 GCAGGGAACCAGGAATTTATGGG - Intergenic
1056329266 9:85508561-85508583 TCAGGGACCAAGAAAAAGCTTGG - Intergenic
1058055599 9:100445669-100445691 TTAGGTACTCAGAAATTTATTGG + Intronic
1059458313 9:114413486-114413508 CCAGGGAGCCAGAGATTTGTGGG + Intronic
1061295372 9:129674129-129674151 CCAGGGACCCAGTGCTTTCTGGG - Intronic
1187831515 X:23387310-23387332 TCTGTCACCCAGAACTTTCTGGG - Intronic
1189601020 X:42626355-42626377 TCACAGACCCTGCAATTTCTGGG + Intergenic
1189725128 X:43960618-43960640 TCAAAGAGCCAGAACTTTCTTGG + Intronic
1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG + Intronic
1190277854 X:48910810-48910832 TGAGGGAGCCAGACCTTTCTTGG - Intronic
1194261420 X:91700181-91700203 CCTGGCCCCCAGAAATTTCTGGG - Intergenic
1194878101 X:99214918-99214940 TCAGGATCCCAGAATTTCCTTGG + Intergenic
1196031258 X:111097067-111097089 CCAGGGACCCTGAGCTTTCTGGG - Intronic
1198297977 X:135305470-135305492 TGAGGTAACCAGAAATTCCTAGG - Intronic
1200043712 X:153388461-153388483 CCAGGGAGCCAAAGATTTCTGGG - Intergenic
1200580070 Y:4938982-4939004 CCTGGCCCCCAGAAATTTCTGGG - Intergenic