ID: 1166959669

View in Genome Browser
Species Human (GRCh38)
Location 19:46489922-46489944
Sequence GCGTGCCAGGCACGGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166959659_1166959669 28 Left 1166959659 19:46489871-46489893 CCGCGTGGTTCATTCCGACCGTC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG 0: 1
1: 0
2: 2
3: 32
4: 245
1166959661_1166959669 10 Left 1166959661 19:46489889-46489911 CCGTCAGTCATTCAACAAATAAC 0: 1
1: 0
2: 8
3: 84
4: 503
Right 1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG 0: 1
1: 0
2: 2
3: 32
4: 245
1166959660_1166959669 14 Left 1166959660 19:46489885-46489907 CCGACCGTCAGTCATTCAACAAA 0: 1
1: 0
2: 2
3: 37
4: 237
Right 1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG 0: 1
1: 0
2: 2
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166959669 Original CRISPR GCGTGCCAGGCACGGTGTTG GGG Intronic
900187753 1:1340256-1340278 GCGTGACAGTGACGATGTTGAGG + Exonic
900244481 1:1630971-1630993 GCGTCCCAGGCAGGGTCTGGGGG + Intergenic
900630900 1:3634635-3634657 TCGTGCCAGGCACTGTGCTCTGG - Intronic
901850367 1:12011173-12011195 GCTTGCCAAGCAAGGGGTTGAGG - Intronic
902837962 1:19058809-19058831 CTGTGCCAGGCACGGGGATGTGG - Intergenic
902925761 1:19694739-19694761 GGGTGCCAGGCATGGTGTGCAGG + Intronic
903290638 1:22311942-22311964 GTGTGCCAGGCATGGTGCTGGGG - Intergenic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903776333 1:25796426-25796448 GCGTCCCAGGCACGGAGAAGAGG - Intergenic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
904081818 1:27877041-27877063 GTGTGCCAGGCTCCGTGTGGCGG + Intronic
904288960 1:29471487-29471509 GGGTGCCTGGCACTGTGCTGGGG - Intergenic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904615284 1:31746211-31746233 GTGTGCCAAGCAGGGTGCTGAGG - Intronic
904683877 1:32247296-32247318 GCGTGCCAGGGAGTGTGTGGTGG - Exonic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
907310687 1:53537333-53537355 GCACGCCAGGCACTGTGCTGGGG - Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907484444 1:54767467-54767489 GAGGGCCTGGCCCGGTGTTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
912429035 1:109619594-109619616 TCGTGCCAGGCACTGTGTAAAGG + Intronic
912557764 1:110528582-110528604 GTGTGCCAGGCTGGGTGTGGAGG - Intergenic
912953301 1:114135443-114135465 CTGTGCCAGGCATGGGGTTGAGG - Intronic
914332712 1:146687177-146687199 ATGTGCTAGGCACAGTGTTGGGG + Intergenic
914352605 1:146853510-146853532 GCCTGCCAAGAAGGGTGTTGTGG - Intergenic
916484048 1:165242150-165242172 GCATGCCAGGCACCATGTTAGGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
921046172 1:211479362-211479384 GGGTGCCAGACCCGCTGTTGTGG - Intronic
921290475 1:213652233-213652255 ACGTGCCTGGCACTGTGTTAAGG + Intergenic
921324125 1:213973703-213973725 TTGTGCTAGGCACAGTGTTGAGG + Intergenic
922035741 1:221846185-221846207 GGGAGCCAGGCACAGTGTGGTGG + Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
923500204 1:234558349-234558371 GTGTGCAAGGCACGGTCTGGAGG - Intergenic
923638694 1:235728240-235728262 GAGTGCCAGGAACTGTGTCGAGG - Intronic
924306172 1:242691284-242691306 GCGTGCCAGGCTCTGTGCTCTGG - Intergenic
1065214472 10:23437484-23437506 ATGTGCCAAGCACGGTGTTAGGG + Intergenic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1067031459 10:42880651-42880673 GCGCTCCAGGCAGGGTGGTGAGG + Intergenic
1067053360 10:43037764-43037786 CCCTGCCAGGCACGAGGTTGGGG - Intergenic
1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG + Intronic
1068934278 10:62621019-62621041 ACGTGCCTGGCACTGTGCTGGGG + Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1070615883 10:77968828-77968850 GGGTCCCAGGCACCGTCTTGGGG + Intergenic
1070838108 10:79464106-79464128 GTGTGCCAGGCCTGGTGCTGAGG + Intergenic
1071558238 10:86623604-86623626 GCATGCCAGGCTGGGTGTGGTGG + Intergenic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1073489593 10:103844236-103844258 GGGTGCCAGGCACTGCGCTGAGG + Intronic
1075532528 10:123241867-123241889 GCGTGCCAGGCACTGTTCTGGGG + Intergenic
1076551215 10:131279171-131279193 GTGTGCCAGGCACTGTATCGGGG - Intronic
1076919056 10:133441910-133441932 GCGTGGCAGGCGGTGTGTTGGGG + Intergenic
1077302495 11:1853775-1853797 GGGTGCCAGGCACCGTGTGTTGG + Intronic
1077460240 11:2705465-2705487 GGGTGCCAGGCACGGGGGGGTGG + Intronic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079131635 11:17750185-17750207 ATGTGCCAGCCACGGTGCTGGGG - Intronic
1079390214 11:20015686-20015708 GTGTGCCAGGCATTGTGCTGGGG - Intronic
1079941616 11:26687599-26687621 GCGTGCCAGGCACTGTTCTTGGG - Intronic
1080571314 11:33559552-33559574 GTGTGCCAGGCAGGGTGCTAAGG - Intronic
1081812480 11:45921883-45921905 GCGTGCCAGGCCCTGTGCTAAGG - Intronic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1083669098 11:64290702-64290724 GTGTGCCAGGCTCTGTTTTGAGG + Intergenic
1084114490 11:67033841-67033863 GCGTGCCAAGCGCGGTGCTGGGG + Intronic
1084433080 11:69122342-69122364 GTGTGCCAGGCACTGGGTAGGGG - Intergenic
1084440354 11:69169274-69169296 GGGTGCCAGTTACGGAGTTGTGG + Intergenic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085321100 11:75574586-75574608 GGGTTCCAGGCACTGTGTTAGGG - Intergenic
1085532980 11:77202706-77202728 GCGTGCCCAGCACTGTGATGAGG + Intronic
1089767347 11:120777496-120777518 GTGTGCCCGGCACGGGGTTGGGG + Intronic
1090277081 11:125427849-125427871 GGGTGCCAGGCACAGGGCTGTGG + Intronic
1090363951 11:126191014-126191036 GCGAGCCAGGCACGGTGCTGGGG - Intergenic
1090422280 11:126583728-126583750 GCGTGCCAGGCACCGTACTGAGG - Intronic
1090607557 11:128437134-128437156 GCTTGCCAGGCACTCTGTTCTGG + Intergenic
1091635328 12:2192731-2192753 GAGTGCCAGGTACCGTGTGGAGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1094854468 12:34396804-34396826 GAGATCCAGGCACTGTGTTGTGG + Intergenic
1098150564 12:67542127-67542149 GGATGCCAGACACAGTGTTGAGG - Intergenic
1098819179 12:75207887-75207909 GTGTTCCAGGCAGGGTCTTGAGG + Exonic
1100362097 12:93888621-93888643 GCATGCAAGGCAGGGTGGTGGGG + Intronic
1100635249 12:96429295-96429317 GAGTGCCAGGCACTGTTATGAGG + Intergenic
1103444424 12:120984891-120984913 GTGAGCCAGGCACCGTGCTGAGG - Intronic
1103853182 12:123946621-123946643 GGGTGCCAGGCACTGTGCTAGGG - Intronic
1105242783 13:18622418-18622440 TAGGGCCAGGCAGGGTGTTGGGG + Intergenic
1106470448 13:30049615-30049637 GGGTGCCAGGGAGGGTGTTAAGG + Intergenic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1113606646 13:111612626-111612648 GGGTGCCAGGCACATTGCTGTGG + Intronic
1117718012 14:58600417-58600439 GCCTGCCAGGCTATGTGTTGTGG - Intergenic
1118349063 14:64960633-64960655 GCGTGCCAGACCCTGTGTTATGG - Intronic
1118453295 14:65923599-65923621 GAGGTCCAGGAACGGTGTTGGGG - Intergenic
1119263979 14:73253565-73253587 GAGAGCCAGGCCCGGTGGTGGGG + Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1119753733 14:77098882-77098904 GCTTGCCAGGCTTGGTGTCGGGG + Intronic
1121327323 14:93028804-93028826 GCGTCCCAGGCACGATGATGGGG + Intronic
1122353866 14:101112167-101112189 GAGTGCCAGGCACCGTTCTGGGG - Intergenic
1122829535 14:104389069-104389091 GGGTGGCCGGCACGGTGTGGGGG + Intergenic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1130913254 15:88285201-88285223 ACGTGCCAGACATTGTGTTGAGG + Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132104404 15:99052300-99052322 AGGTGCCAGGCAGGGTGCTGGGG - Intergenic
1136612788 16:31377438-31377460 GTGTGCCAGGCAGGGTGCTGTGG + Intronic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137584843 16:49658271-49658293 TCTGGCCAGGCACGGTGCTGGGG - Intronic
1138451400 16:57095166-57095188 CCCTGCCAGACACGGTGGTGTGG + Intronic
1139282538 16:65783132-65783154 GAGTCCCTGGCACGGTTTTGTGG - Intergenic
1139981424 16:70862008-70862030 GCCTGCCAAGAAGGGTGTTGTGG + Intronic
1140000902 16:71024064-71024086 ATGTGCTAGGCACAGTGTTGGGG - Intronic
1141141044 16:81497079-81497101 GCCTCCCAGGCACAGTGATGGGG + Intronic
1141159369 16:81618825-81618847 ACGTGCCAGGCACCGTGCTGAGG + Intronic
1141791930 16:86242907-86242929 GCCTGCCTGGCACAGTGTTGGGG + Intergenic
1142020148 16:87777194-87777216 GGGTGCCAGGCACGTTTTGGGGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143661121 17:8325158-8325180 GCGTTCCAGGCATGCTGGTGGGG + Intergenic
1144029896 17:11310222-11310244 GTGTGCCAGGCACTGTTTTAGGG + Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1146195033 17:30804493-30804515 GCTTGCCAGGGATGGAGTTGGGG - Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1151311990 17:73298807-73298829 GCGTGCCAAGCACTGTACTGAGG + Intronic
1152656553 17:81522541-81522563 GTGTGCCAGGAACCGTGCTGGGG - Intronic
1153088576 18:1318143-1318165 GGGTTCCAGGCAGGGTGCTGAGG + Intergenic
1154446155 18:14437459-14437481 TAGGGCCAGGCAGGGTGTTGGGG - Intergenic
1155518982 18:26650357-26650379 GTGTGCCAGGCACTGTATTAAGG + Intronic
1157359436 18:46964147-46964169 GCGGGTCAGGCCCGGTGTTTCGG + Exonic
1157361030 18:47023666-47023688 GCGGGTCAGGCCCGGTGTTTCGG + Exonic
1157362020 18:47029581-47029603 GCGGGTCAGGCCCGGTGTTTCGG + Exonic
1160794531 19:938779-938801 GCCTGGCAGGCACCGTGGTGAGG - Intronic
1161007427 19:1943599-1943621 GTGTGCCAGGCACGGTTGGGAGG + Intronic
1161111203 19:2471278-2471300 GCAGGCTGGGCACGGTGTTGCGG - Intergenic
1161609634 19:5234680-5234702 GCGTGCCAGGCACTGTGCTAAGG + Intronic
1161978671 19:7619604-7619626 GCGTGCCAGCCGCAGTGTTTGGG - Exonic
1162145847 19:8611586-8611608 GTGTGCCAGGCACGGTGCCCGGG + Intergenic
1163333544 19:16657111-16657133 GCGTGCCAGGCAGTGTGCTAAGG - Intronic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1166204725 19:41262337-41262359 GCGTGCCAGACACGGTGGGCTGG - Intergenic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
925444256 2:3914353-3914375 GTGTGCCAGGCACAGTGTGCAGG + Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926156606 2:10458360-10458382 GCGTTCCAGGCCAGGTGTGGTGG - Intergenic
926205390 2:10831618-10831640 GTCTGCCAGGCAGGGTGTGGAGG - Intronic
927518084 2:23683476-23683498 GCCTGCCAGTCACCCTGTTGGGG - Intronic
930123425 2:47778296-47778318 GCGTGCCAAGCACTGGGCTGAGG + Intronic
932886630 2:75554718-75554740 GGGTGCCAGGCACTGTGTTAGGG - Intronic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
941917155 2:170820395-170820417 GTGTCCCAGGCACACTGTTGCGG + Intronic
944973009 2:205015779-205015801 GTGTGCCAGGCAAGGTGCTGAGG - Intronic
946219991 2:218217644-218217666 GGGTGCCTGGCAGGGTGTAGGGG + Intronic
947159476 2:227197778-227197800 CTGTGCCAGGCATGGTGGTGAGG + Intronic
948465143 2:238148625-238148647 GGGTACCAGGCCCGGGGTTGGGG + Intronic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168952589 20:1812571-1812593 GGGTGCCAGGTACTGTTTTGGGG + Intergenic
1171179424 20:23081601-23081623 GCCTGCCAGGGAAGGTTTTGAGG + Exonic
1172287847 20:33753503-33753525 GTGTGCCAGACACTGTGCTGGGG + Intronic
1172714510 20:36952648-36952670 GTGTGCCAGGCACGGTTCTAAGG + Intergenic
1173519509 20:43688728-43688750 GGGTGCCAGGCCAGGTGTGGTGG - Intronic
1173658834 20:44719211-44719233 GCATGCCAGGCCCTGTGCTGAGG + Intronic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174392859 20:50228694-50228716 GTGTTCCAGGCAGGGTGTGGAGG - Intergenic
1175415361 20:58797266-58797288 GAGTGCCAGGCACAGTGCTGGGG - Intergenic
1175871652 20:62212113-62212135 GTGTGCCAGGCATGGTGGTGGGG - Intergenic
1176376582 21:6089685-6089707 GCATGGCAGGCACAGGGTTGAGG - Intergenic
1176722407 21:10403028-10403050 GGAAGCCAGGCACGGTGTTTCGG - Intergenic
1179564733 21:42240161-42240183 GCGTGGCAGGCACCGTGGTCTGG - Intronic
1179746893 21:43448559-43448581 GCATGGCAGGCACAGGGTTGAGG + Intergenic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1182091734 22:27600442-27600464 GAGTGCCAGGCACTGTGCTAGGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183313045 22:37121799-37121821 ACCTGCAAGTCACGGTGTTGGGG - Intergenic
1183985931 22:41570428-41570450 GCCTGCCATGCAGGGTGTTCAGG + Intronic
1184409211 22:44317062-44317084 GCGTGCCAGGTCAGGGGTTGGGG - Intergenic
1185332367 22:50257492-50257514 GCGTGCCAGGCTAGGGGCTGAGG + Intronic
949951197 3:9230131-9230153 GAGTGCCAGGCACTGTGCTAAGG + Intronic
950180979 3:10912888-10912910 GCGTACCAGGCACTGAGTTCAGG - Intronic
950640412 3:14344890-14344912 ACATGCCAGGCATGGTGATGGGG + Intergenic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
954112811 3:48444868-48444890 CAGTGCCAGGCAAGGGGTTGGGG + Intergenic
954909139 3:54088196-54088218 GCGCGCCAGGCTCAGGGTTGTGG + Intergenic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956700566 3:71955339-71955361 GTGTGCCCAGCACGGTGGTGTGG + Intergenic
956767566 3:72496790-72496812 GCGAGCCAGGCATGGAGGTGGGG - Intergenic
961042591 3:123687950-123687972 GTGTGCCAGGCCAGGTGTGGTGG - Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962742568 3:138372623-138372645 ATGTGCCAGGCCTGGTGTTGAGG - Intronic
968624678 4:1621790-1621812 CCGTCCCTGGCACCGTGTTGGGG + Intronic
969309144 4:6342518-6342540 CCGGGCCAGGCACGTCGTTGGGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969492110 4:7505311-7505333 GGGAGCCAGGCACGGGGCTGGGG + Intronic
970425378 4:15940953-15940975 GCGTGCCAGGCACTGTGCTAAGG + Intergenic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
976613558 4:87053680-87053702 GTGTGCCAGGCCTGGTGCTGGGG + Intronic
978198727 4:106000139-106000161 GTGTGCCAGGCAATGTGTTAAGG + Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
984929477 4:184834104-184834126 AAGTGCCAGGCACTGTATTGGGG - Intergenic
987600571 5:20063680-20063702 GAGTACCAGGCACTGTCTTGAGG + Intronic
988180819 5:27789405-27789427 TCGTGCCAGTCACTGAGTTGTGG + Intergenic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
991933586 5:71780752-71780774 GTGTGCCAGGCAGGGCGTGGTGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
994149397 5:96431553-96431575 TCGTGCCAGGCTCCGTGTTAGGG - Intronic
997610238 5:135210641-135210663 GCTTGCCAGACAGGGTGTTGAGG + Intronic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
999743751 5:154576376-154576398 GTGTGCCAGGCACTGGGTTAGGG - Intergenic
1002088252 5:176789448-176789470 GTGTGGCAGCCACGGTGCTGGGG + Intergenic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003515972 6:6818959-6818981 GGGTGCCAGGCACTGTTCTGAGG - Intergenic
1005164885 6:22908466-22908488 GCATCCCAGGCACTGTGGTGTGG + Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006680344 6:35792735-35792757 GTGTGCCTGGCACCGTGTTTTGG - Intronic
1006717548 6:36130312-36130334 GCGGCCCAGGCACGGGGTCGGGG - Exonic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1009857257 6:69280718-69280740 GTGTGCCAGGCATTGTGCTGAGG - Intronic
1011471682 6:87714314-87714336 GTGTGCCAGGCACTGTTCTGAGG + Intergenic
1016553989 6:145314619-145314641 GCATGCAAGGCATGGTGTTGTGG + Intergenic
1017899465 6:158706491-158706513 GGGTGGCAGGCCCGGTGTTCTGG + Intronic
1018131406 6:160735327-160735349 GAGTCCCAGGCACGGTAGTGGGG - Intronic
1019595908 7:1858315-1858337 GTGGGCCAGGAACGGAGTTGGGG - Intronic
1019860022 7:3649606-3649628 GAGTGCCAGGCACTGTTTTAAGG + Intronic
1020086554 7:5313591-5313613 GTGTGGCAGGCATGGTGATGAGG + Exonic
1021402945 7:20230866-20230888 GTGTGCCAGGCACTGTTTTAGGG - Intergenic
1022801437 7:33780807-33780829 GTGTGCCAGGCACAGTGGTAAGG + Intergenic
1023844662 7:44113919-44113941 GCGTGGGAGGCACAGTGTGGGGG - Exonic
1024226964 7:47332722-47332744 GTGTGCCATGCATGGTGTTGGGG - Intronic
1024227074 7:47333906-47333928 GTGTGCCATGCATGGTATTGGGG - Intronic
1025207759 7:57003547-57003569 GTGTGGCAGGCATGGTGATGAGG - Intergenic
1025664177 7:63573325-63573347 GTGTGGCAGGCATGGTGATGAGG + Intergenic
1026720845 7:72829480-72829502 GCCTGCCAGACACGCTGTGGCGG + Intergenic
1026988410 7:74569258-74569280 GCGTGCCAGACCCTGTGCTGTGG + Intronic
1027570620 7:79861406-79861428 GGGTGCCAGGCACAGTGCAGTGG - Intergenic
1029381666 7:100219441-100219463 GCGAGCCAGGCTGGGGGTTGTGG + Intronic
1029401827 7:100351889-100351911 GCGAGCCAGGCTGGGGGTTGTGG + Intronic
1035898966 8:3436451-3436473 GTGTGCCAGGCACTATTTTGAGG - Intronic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1038320627 8:26523215-26523237 GAGTGGCAGGGATGGTGTTGAGG + Intronic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1041124139 8:54618117-54618139 GGTTGCCAGGCACCTTGTTGGGG - Intronic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1042795950 8:72663472-72663494 GTGTGCCATGCTGGGTGTTGGGG + Intronic
1042863497 8:73336184-73336206 GTGTGCCAGGCATGGGGCTGTGG - Intergenic
1046792210 8:118334278-118334300 TTATGCCAGGTACGGTGTTGAGG - Intronic
1046913821 8:119658793-119658815 GTGTGCCAGGGACAGTGCTGGGG - Intronic
1049095831 8:140547593-140547615 GCGTGGGAGACACGGTGCTGGGG - Exonic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057311607 9:93946560-93946582 GCGTGCCAGACACTGTGCTGGGG - Intergenic
1058278707 9:103083841-103083863 GCATGCCAGGCAGGGCGTGGTGG + Intergenic
1059472009 9:114512390-114512412 GTGTGCCAGGCACTGTGTGTGGG + Intergenic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060855712 9:126914179-126914201 CTGTGCCAGGCACGGTGAGGTGG - Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1062008840 9:134256271-134256293 GCCTGTCAGGCAGGGTCTTGTGG + Intergenic
1062060442 9:134492659-134492681 GGGTGCCCTGCACGGTGCTGAGG + Intergenic
1062190954 9:135247613-135247635 TCCTGCCAGGCACGGTGTGCTGG + Intergenic
1062349820 9:136133223-136133245 GCGGGGCAGGCTCGGGGTTGCGG - Intergenic
1186670868 X:11765789-11765811 CAGTGCCAGGCATGGTGCTGAGG + Intronic
1189305722 X:39985234-39985256 GCGTGCGAGGCACAGAGTGGGGG - Intergenic
1190484643 X:50912346-50912368 GAGTGCCAGGCAGTGTGTTTGGG + Intronic
1190571612 X:51788333-51788355 GGGTGTCAGGCACTGTGATGAGG - Intergenic
1192331152 X:70176260-70176282 GTTTGCCAGGCACTGTGTTTAGG - Intergenic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1200181154 X:154151453-154151475 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200186799 X:154188567-154188589 GCGTGCCAGGCTCTGTGCTAAGG + Intergenic
1200192450 X:154225705-154225727 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200198205 X:154263509-154263531 GCGTGCCAGGCTCTGTGCTAAGG + Intronic