ID: 1166960104

View in Genome Browser
Species Human (GRCh38)
Location 19:46492085-46492107
Sequence CATCTGGGTGTCCCTGACAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166960100_1166960104 5 Left 1166960100 19:46492057-46492079 CCCTGCAGCAGGTCTCAGTCAGC 0: 1
1: 1
2: 0
3: 17
4: 168
Right 1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG 0: 1
1: 0
2: 2
3: 19
4: 179
1166960098_1166960104 11 Left 1166960098 19:46492051-46492073 CCCACGCCCTGCAGCAGGTCTCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG 0: 1
1: 0
2: 2
3: 19
4: 179
1166960096_1166960104 28 Left 1166960096 19:46492034-46492056 CCAAGCAGAGGGGAGCACCCACG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG 0: 1
1: 0
2: 2
3: 19
4: 179
1166960101_1166960104 4 Left 1166960101 19:46492058-46492080 CCTGCAGCAGGTCTCAGTCAGCT 0: 1
1: 0
2: 1
3: 32
4: 204
Right 1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG 0: 1
1: 0
2: 2
3: 19
4: 179
1166960099_1166960104 10 Left 1166960099 19:46492052-46492074 CCACGCCCTGCAGCAGGTCTCAG 0: 1
1: 0
2: 2
3: 35
4: 324
Right 1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG 0: 1
1: 0
2: 2
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166960104 Original CRISPR CATCTGGGTGTCCCTGACAT AGG Exonic
902076748 1:13793134-13793156 CATCTAGGTGTTCCTTACCTGGG + Intronic
902160568 1:14527119-14527141 CATCTGGGTGGTCCTCACTTGGG + Intergenic
902526209 1:17059355-17059377 ATTCTGGGAGTCCTTGACATCGG - Intergenic
904783510 1:32968027-32968049 CATCTGGGTCTACCTGGAATTGG - Intergenic
905856877 1:41320265-41320287 CATCAGCATGGCCCTGACATAGG + Intergenic
908775078 1:67631928-67631950 CACCTGGGAATCCCTGACCTAGG + Intergenic
912552798 1:110495121-110495143 CATCTGGGGCTTGCTGACATGGG - Intergenic
913199864 1:116487163-116487185 CATCTGGATTTCATTGACATGGG - Intergenic
913260845 1:116996593-116996615 CTTCAGGGTCTCCCTCACATGGG + Intergenic
915335739 1:155140171-155140193 CACCTGGGTGGCCCTGACCACGG - Exonic
919418226 1:197338123-197338145 CATCTTGGAGTCTCTGAAATGGG + Intronic
919654127 1:200180853-200180875 CATCTGGGGGCCCCAGAGATGGG - Intergenic
920541007 1:206777997-206778019 CCTCTGGGCTTTCCTGACATTGG + Intergenic
923853686 1:237823004-237823026 CATCTGGGTGTTCCTGTATTGGG - Intronic
924253146 1:242156021-242156043 CATCTGGGTGTTCCTGTATTGGG + Intronic
1063055466 10:2499739-2499761 GATCTGGTTGACCCTGGCATTGG - Intergenic
1064277760 10:13922260-13922282 CATCTGTCTATCCCTTACATTGG + Intronic
1064921486 10:20524011-20524033 TTTCTGGGTGACCCTGACACAGG + Intergenic
1065769011 10:29059414-29059436 CTTCTGTGTGTTCCTCACATTGG + Intergenic
1066028700 10:31394463-31394485 CATCTAGGTGTTCATCACATAGG - Intronic
1069912930 10:71770862-71770884 CCCTTGGGTGTCCCTGGCATTGG + Intronic
1070978354 10:80623872-80623894 AATCTGGGTTTCCATGACTTGGG - Intronic
1071928056 10:90434308-90434330 GGTATGGTTGTCCCTGACATTGG + Intergenic
1073347736 10:102796997-102797019 TATGTGAGTGTCCCTGACAAGGG + Intronic
1073541843 10:104321407-104321429 CTTCTGGGTGGCCCGGACAGAGG + Intronic
1075077184 10:119359285-119359307 CATGTGGGGTTCCCTGAAATAGG - Intronic
1076346434 10:129781836-129781858 CTTCTGAGTGTCCCTGACATAGG - Intergenic
1076785739 10:132749028-132749050 CATCTGGGTGAAGCTGACGTGGG - Intronic
1079419786 11:20275452-20275474 CTTCTGGTTGTCACTAACATGGG - Intergenic
1081814406 11:45930440-45930462 CTGCTGGTTGTACCTGACATAGG - Intronic
1084041590 11:66545999-66546021 CAGCTGGGTGTCCAGGCCATGGG - Exonic
1084679565 11:70658818-70658840 CATTTGGTGGTCCCTGCCATTGG - Intronic
1085297090 11:75437424-75437446 CAGCTGGGACTCCCTGAGATTGG - Intronic
1085476783 11:76794058-76794080 CATCTGGGTGGCCCTGCTCTGGG - Intronic
1089432819 11:118437043-118437065 CATCTCGGGGTCCCTGACCCGGG + Intronic
1089596861 11:119585962-119585984 CATCGGGCTGTCCTTGGCATGGG - Intergenic
1089989649 11:122847283-122847305 CATCTCTGTGTCCCTAACCTGGG - Intronic
1090080632 11:123609894-123609916 CACCTGTGTCTCCCTGACAGTGG - Exonic
1091016358 11:132054531-132054553 CATCTGCCTCTCCCTAACATGGG - Intronic
1091940462 12:4475822-4475844 TATCTGGGTTTCCTTGAAATGGG - Intergenic
1094002965 12:25716075-25716097 CACCTGGGTGACCTGGACATGGG - Intergenic
1097019430 12:56009174-56009196 CATCTGGTTGACCATGACGTTGG - Intronic
1097153322 12:56995207-56995229 CAGCTGGGTTTCACTGACATTGG - Exonic
1100212921 12:92416858-92416880 TATCTGGGTGTCCCATAGATCGG - Intergenic
1100447961 12:94678577-94678599 GATTTGGGTGTTCCTGTCATTGG - Intergenic
1101599600 12:106197651-106197673 CACCTGCGATTCCCTGACATAGG + Intergenic
1102462736 12:113110005-113110027 CACTTGGGTGTCACTGATATTGG + Intronic
1105231439 13:18499931-18499953 GATCTGAGTGTCCCTCACATAGG - Intergenic
1105280267 13:18959162-18959184 CATCTGGGTGTCTCAGCAATCGG - Intergenic
1105379049 13:19869978-19870000 CACCTGGGTGGCCCTGACTCAGG + Intergenic
1108216937 13:48194635-48194657 AATCTGAGAGTCCCTGGCATGGG - Intergenic
1110199470 13:72831916-72831938 AATCTGGGTGTTCCTGTAATGGG + Intronic
1110963885 13:81666379-81666401 TATCGGGGGGTCCCTCACATGGG + Intergenic
1115353904 14:32426809-32426831 AATCTGGATATCCCTGCCATGGG + Intronic
1117820856 14:59647270-59647292 AATCTGGGTGTCCCTGTGTTGGG - Intronic
1118837686 14:69488107-69488129 CATCGGTGGGTCCCTGACTTAGG + Intronic
1119738554 14:76999403-76999425 CATCTGGGGAACCCAGACATTGG - Intergenic
1119779392 14:77268305-77268327 CTGCTGTGTGGCCCTGACATGGG - Intronic
1121421472 14:93818716-93818738 CATCTGGGTGTCACTGGCATAGG - Intergenic
1202838118 14_GL000009v2_random:93833-93855 GGTCTGAATGTCCCTGACATAGG + Intergenic
1202907474 14_GL000194v1_random:83752-83774 GGTCTGAATGTCCCTGACATAGG + Intergenic
1202885577 14_KI270722v1_random:103901-103923 GGTCTGAATGTCCCTGACATAGG - Intergenic
1202885964 14_KI270722v1_random:107449-107471 TGTCTGCATGTCCCTGACATAGG - Intergenic
1202886207 14_KI270722v1_random:109688-109710 GCTCTGAATGTCCCTGACATAGG - Intergenic
1202886234 14_KI270722v1_random:109924-109946 TGTCTGAATGTCCCTGACATAGG - Intergenic
1127901392 15:63343646-63343668 CATCAGGGTGTCCCTAAAGTGGG - Intronic
1128894307 15:71358289-71358311 CATATGGGAAACCCTGACATAGG - Intronic
1132744183 16:1429876-1429898 CATGTGACTGTCCCTGACCTTGG - Intergenic
1133332057 16:4980946-4980968 CATCGACGTGTCCCTGCCATGGG - Intronic
1135855404 16:26005664-26005686 CATCATGGTGTCCCTGGCAGAGG + Intronic
1139953684 16:70683659-70683681 CCTCTGGGAGGCCCTGACCTTGG - Intronic
1144527684 17:16004345-16004367 CATCTGGGTCTCCCAGAAATTGG + Intronic
1144812394 17:18008836-18008858 CTTCTGGGTGTCACAGACATGGG - Intronic
1147421269 17:40323227-40323249 CATCTGGCTGTGCCTGACCGTGG + Intronic
1147952165 17:44113297-44113319 CCTCTGGGTGTCCCTGTCCTGGG - Intronic
1150490089 17:65568412-65568434 CATTTGGCTGTCCCTGGCAAGGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153994011 18:10423904-10423926 CATCTGGGTAATCCTGGCATTGG + Intergenic
1154522035 18:15240349-15240371 GATCTGAGTGTCCCTCACATAGG + Intergenic
1156457075 18:37300845-37300867 CATCTGGGGGTGCCTGGCAGAGG + Intronic
1157695703 18:49721748-49721770 CTTCTGGGTGTCTCTGTCTTTGG - Intergenic
1162143028 19:8596041-8596063 CACCTGGGTGTCCCTCAGAGCGG - Intronic
1162861753 19:13510934-13510956 CATCTGGGTGACAGTGGCATGGG + Intronic
1165935325 19:39385282-39385304 CAGCAGGGTGTCCCTCTCATGGG + Intronic
1165942722 19:39423304-39423326 CATCTGGGAATCCCTGATGTTGG - Exonic
1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG + Exonic
1167376981 19:49117651-49117673 CACGGGGCTGTCCCTGACATGGG + Intronic
1202650985 1_KI270707v1_random:3390-3412 GCTCTGAATGTCCCTGACATAGG + Intergenic
1202660980 1_KI270708v1_random:70927-70949 GGTCTGAATGTCCCTGACATAGG - Intergenic
1202661364 1_KI270708v1_random:74429-74451 TGTCTGAATGTCCCTGACATAGG - Intergenic
1202661555 1_KI270708v1_random:76141-76163 GCTCTGAATGTCCCTGACATAGG - Intergenic
1202661698 1_KI270708v1_random:77418-77440 TGTCTGAATGTCCCTGACATAGG - Intergenic
925035636 2:683201-683223 CTTGTGGGTGTCCCAGACACTGG + Intergenic
927527182 2:23755607-23755629 CTCCTTAGTGTCCCTGACATGGG - Intronic
929864924 2:45709661-45709683 GATCTGGAAGTCCCTGACTTAGG - Intronic
930685057 2:54299261-54299283 CATCTGGGAGCCTCTGACGTTGG - Intronic
933157747 2:78993512-78993534 CATCTGAGTGCACCTGAGATAGG - Intergenic
933293983 2:80469610-80469632 CTTCTAGGTGCCCCTGAGATTGG + Intronic
937361422 2:121232512-121232534 CATCTGGGTGTCACTGGGCTGGG - Intronic
937481440 2:122264303-122264325 GATCTGGGTGCCGGTGACATGGG - Intergenic
937883773 2:126886607-126886629 CATCTGGGTGACCCTCCCACTGG + Intergenic
938521403 2:132074081-132074103 GATCTGAGTGTCCCTCACATAGG + Intergenic
940267937 2:151859771-151859793 TATCTGTGTGTTCCTGACATGGG - Intronic
940335694 2:152525080-152525102 TATCTGGGTGACCTTGGCATTGG - Intronic
942893513 2:181020826-181020848 TATCTGGATTTCCCTGACATGGG + Intronic
945577102 2:211545293-211545315 AATCTGGGTGACACTTACATGGG - Intronic
946445593 2:219737463-219737485 CAGCTGGATGACCATGACATTGG + Intergenic
948838520 2:240637633-240637655 CATCTGAGTGCCCCTCAGATGGG - Intergenic
948884214 2:240874880-240874902 CAGCTGTGTGACCCTGCCATGGG - Intronic
1170314350 20:15027344-15027366 GATTTTGGTGTTCCTGACATAGG + Intronic
1171273268 20:23833080-23833102 CAGCTGGGAGTCACTGACCTGGG + Intergenic
1172260726 20:33562456-33562478 CATCTGTGTTTCCCTGGAATGGG + Exonic
1174646884 20:52094064-52094086 CATCTGGCTGTTCCGGACAGAGG + Intronic
1175324758 20:58115685-58115707 CATTGGGATGACCCTGACATTGG + Intergenic
1176601137 21:8796105-8796127 GCTCTGAATGTCCCTGACATAGG - Intergenic
1176626781 21:9098185-9098207 GGTCTGAATGTCCCTGACATAGG + Intergenic
1176775410 21:13128236-13128258 GATCTGAGTGTCCCTCACATAGG - Intergenic
1177362421 21:20090694-20090716 CATCTGTGTGACCATGAAATAGG - Intergenic
1180168761 21:46046491-46046513 CCTCTGGGTGTCCCTGATGGTGG - Intergenic
1180328463 22:11454475-11454497 GGTCTGAATGTCCCTGACATAGG - Intergenic
1180343423 22:11687642-11687664 GCTCTGAATGTCCCTGACATAGG - Intergenic
1180522915 22:16226676-16226698 GTTCTGAGTGTCCCTTACATAGG - Intergenic
1180522958 22:16227200-16227222 GATCTGAGTGTCCCTCACATAGG - Intergenic
1180599159 22:17003151-17003173 AATCTGGGTGCCCCTGTCTTGGG - Intronic
1181013499 22:20055638-20055660 CCTCTGTGTGTCCATGCCATGGG + Intronic
1181436135 22:22912043-22912065 CATCCCGGGGTCCCTGACAGTGG + Intergenic
950033895 3:9870305-9870327 CATCAGAGTGTCCCGGACCTGGG + Exonic
951513252 3:23528231-23528253 CATCTGGGTTTCTATGAGATTGG - Intronic
954416287 3:50395000-50395022 CATCTGGGTGACCCGGACTTAGG - Intronic
954671390 3:52293083-52293105 GAGGTGGGTGTCCATGACATTGG - Exonic
962318301 3:134372271-134372293 AATCTGGGGCTCCCTGTCATGGG + Intronic
965628756 3:170708871-170708893 CATCTGGGTGTGTCTGAAAATGG + Intronic
967709469 3:192688209-192688231 AAGCTGGGGGTCCATGACATTGG - Intronic
968087206 3:195879118-195879140 CATCCAGGTGTCGCTGGCATGGG + Exonic
973396163 4:49594885-49594907 GGTCTGAATGTCCCTGACATAGG + Intergenic
973396483 4:49597698-49597720 GGTCTGAATGTCCCTGACATAGG + Intergenic
973551742 4:52042378-52042400 CATCTAAGTATCTCTGACATCGG + Intergenic
974889364 4:67861197-67861219 AAACTGGCTTTCCCTGACATGGG + Intronic
979350819 4:119642723-119642745 AATCAGGGTGTCCCTGACCTAGG + Intergenic
979595682 4:122531760-122531782 CTTCAGGGTGTCCCAGAAATGGG + Intergenic
981126547 4:141113489-141113511 AATCTGGGTGTTCCTGTAATGGG - Intronic
1202761909 4_GL000008v2_random:119986-120008 GGTCTGAATGTCCCTGACATAGG - Intergenic
986156802 5:5184301-5184323 CATCTGTGTGTAGGTGACATAGG - Intronic
986233663 5:5887737-5887759 CTTCTACGTGTCACTGACATTGG - Intergenic
986639176 5:9855162-9855184 AATCAGGGAGTCCCTCACATAGG + Intergenic
994285632 5:97962222-97962244 CATCTGTGTGTCCCCCTCATTGG - Intergenic
996272648 5:121625518-121625540 CATCTGGGTTTCCCTTAAAATGG + Intergenic
998410511 5:141907126-141907148 CATCTGGGAATCCCTGATAGAGG - Intergenic
999333101 5:150691474-150691496 CATCTGCGTGTCCCCCACACGGG + Exonic
1002926019 6:1606104-1606126 CATCTGGGTGGCCGCGACCTTGG - Intergenic
1008963476 6:57290325-57290347 AATCTGGGTGTCCCTGTATTGGG - Intergenic
1011700207 6:89948756-89948778 CACATCTGTGTCCCTGACATTGG - Intronic
1012243513 6:96900563-96900585 CACCTGCCTGTGCCTGACATTGG + Intergenic
1013978814 6:116105831-116105853 CATATGTATTTCCCTGACATGGG + Intronic
1019179775 6:170178910-170178932 CAGCTGGGTGGCCCTGTCCTGGG - Intergenic
1019182512 6:170199751-170199773 AATCTGGGTTTACCTGACAGTGG + Intergenic
1021851054 7:24809019-24809041 GATCTGTGTGTCCTTGACACAGG + Intronic
1025859438 7:65312628-65312650 CATCTTCGTGTTCCTGAAATTGG - Intergenic
1032310511 7:130781829-130781851 GACCAGGGTGTCCCTCACATGGG - Intergenic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1033063621 7:138130874-138130896 GATCTGGGTGTCAGTGACATGGG - Intergenic
1033934579 7:146568128-146568150 CATTTGGGTCTGCTTGACATGGG - Intronic
1034823260 7:154236717-154236739 CATATGTGTTTCCCTGACGTCGG + Intronic
1034931623 7:155168014-155168036 CATCTGGATGTCATTGTCATTGG + Intergenic
1035064585 7:156095573-156095595 CATGCAGGTGTCCCTGAAATGGG - Intergenic
1035936617 8:3848187-3848209 CTTCTGATTGTTCCTGACATTGG - Intronic
1035974617 8:4294190-4294212 CATTTTGGTGTCCCTGAAATTGG - Intronic
1036127690 8:6078377-6078399 CAGCTGGGTGTCTCTCACAGAGG - Intergenic
1038165919 8:25085018-25085040 CATTTGGCTGTCCTTGACATTGG - Intergenic
1038478864 8:27887643-27887665 TATCTGGGTGTCTCTGCTATGGG - Intronic
1038499778 8:28033875-28033897 CGTCTGGGTGCCCCTGCCATGGG + Intronic
1041754308 8:61296857-61296879 CATCTGTGTATCCCTGATACAGG - Intronic
1041889591 8:62854370-62854392 CATCTGGGTGCCCCTGTATTGGG + Intronic
1047644687 8:126857750-126857772 CATCTGGGTTTACCAGACAGGGG - Intergenic
1048271164 8:133029377-133029399 CAGGTGGTTGTCCCTGACAATGG - Intronic
1049015069 8:139914307-139914329 CACCTGGGTGTCCCTGCCTGCGG - Intronic
1049642291 8:143721162-143721184 CGTTTGGGGGTCTCTGACATAGG - Intronic
1051763610 9:20497712-20497734 CATCTGGGTGTCCTTCAGTTTGG + Intronic
1052811941 9:33068922-33068944 CATCTGGGTATGCCTGAAAAAGG + Exonic
1053140935 9:35682296-35682318 CATCTGTTTGTCCCTGCCAAGGG - Intronic
1053353835 9:37430454-37430476 CATCTGGTTGTCCCTAGCCTGGG + Intronic
1055255396 9:74364009-74364031 GATCTGGGTATCAGTGACATTGG - Intergenic
1056535049 9:87519638-87519660 CATCCCTGTGTCCCAGACATAGG - Intronic
1059389954 9:113992781-113992803 CATCTGTGTGTCCATGACCCGGG - Intronic
1061288670 9:129638703-129638725 CCTCTGGGTTGCCCTGACCTGGG - Intronic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1062125967 9:134863213-134863235 TATCAGGGTGTCACTGACATAGG + Intergenic
1062305210 9:135902206-135902228 GATTTGGGTGTTTCTGACATGGG - Intronic
1203493442 Un_GL000224v1:128426-128448 CATCTGAATGTCCCTCACTTAGG + Intergenic
1203506062 Un_KI270741v1:70301-70323 CATCTGAATGTCCCTCACTTAGG + Intergenic
1203542677 Un_KI270743v1:104867-104889 GGTCTGAATGTCCCTGACATAGG - Intergenic
1185885866 X:3782197-3782219 CATCTGGGTGAGACTAACATGGG - Intergenic
1188335524 X:28927566-28927588 CATCAGGGCTTCCCTGACATAGG + Intronic
1189056243 X:37702061-37702083 CATCTTTGTGTCCAGGACATGGG - Intronic
1194277698 X:91907553-91907575 TATATGGCTGTCCTTGACATTGG - Intronic
1198158693 X:133986084-133986106 CAGGTGGGGGTCCCTGACTTAGG + Intergenic
1200595041 Y:5129621-5129643 TATATGGCTGTCCTTGACATTGG - Intronic
1200612236 Y:5338545-5338567 CATATTGGTGCCCCTGACACAGG + Intronic
1200778858 Y:7196187-7196209 CATCTGGGTGAGACTAACATGGG + Intergenic
1200879339 Y:8195920-8195942 CATCTGGGTGTTCCTGTATTGGG - Intergenic
1201163352 Y:11183956-11183978 GGTCTGAATGTCCCTGACATAGG + Intergenic